tg_tRNA-Ser1

Coordinates:801209-801295

>tg_tRNA-Ser1 tRNA-Ser (CGA)
GCCGGGGTAGCCTAGCCTGGGAAGGCGCGGGACTCGAGATCCCGTGGGCGTCCGCCCGCC
AGGGTTCAAATCCCTGCCCCGGCGCCA
>tg_tRNA-Ser1 tRNA-Ser (CGA)
GCCGGGGTAGCCTAGCCTGGGAAGGCGCGGGACTCGAGATCCCGTGGGCGTCCGCCCGCC
AGGGTTCAAATCCCTGCCCCGGCGCCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 800709 - 801795 (Additional range around tg_tRNA-Ser1 is :500nt.)

>Thermococcus gammatolerans EJ3 ATCAGAGAATTTTGCCCTCTTCCTTCATTCTGACGAGCCTGGTTATATATCCCGCTATCCTGTTTCTTATGGTCTTGCTC GTTACGTTTGTGAGCTCCTGAACCATCCTCTTGTTGTGCTCAAAGTCCCTTGTGAACTTGTCAGGATACCTATCAAAGAG CTCGCGAGCGGTCCTCTTGATGAAAGCCTGCTTTATGTTTCCCATTCTCATCACCTCGGATTAGCTTAAGCCGTAACCCA ATCCGGGGAATCTTTTTAAAAGTTTTCCCTGGGGGAGAAAAAGCTACCGTTTTCTCAGCTTCTCGTAAATTCATTCGCCG AGGTGGATTGAGGTTTTCTCTGGCCAGACGATGCTGAGGGAGTAGCACCTCACCAGTGCAAAGCCAAAGTTAATCATTTC GAAATGGCTGAGCTCTTCTGTCAATTGAGAGGACAGAGTTAGACCCCGAACCTGAATCCTAAAAATTTATAAACTCCATT CCTTTCTCGTCATTGGTGAGC GCCGGGGTAGCCTAGCCTGGGAAGGCGCGGGACTCGAGATCCCGTGGGCGTCCGCCCG CCAGGGTTCAAATCCCTGCCCCGGCGCCA CTCAACTGCCGAGCCCGTTGGGGATCCCTACCCAAATTTCTACCCTTCTA TCGTTTTCAACTATCAAAAAATATCCTTCGGACGTTGGGAAACAGAAAACATAACTCAATTCGGTGTGTTTGAAAGAACC CGTAACTTAGCGCCAAAGTTGGAAAAAGAGATGCGGAATTTTACATCCTCTTAGAGGGGGCTTCTTCCTATACTTCTCTT ACATCCCCAATAGAAGCGCGGGACTCGAGATGTTGTAGTCATTCTAAAAACAAACAAAAGAGAAGAGAATTCATGTCGTT ATGTGAGCCCCGTCCTTCTCGACTATAACGGTATGCTCGAACTGGGCCACCATTCCACCCCTAACCTCGCGCAGTATCGG GTAGCTGTATATCGCGCCGACCTTGTCCAGCTGTGCCAGTGCCATCTTGAGCTGTCCCTCTGGCATAAAGCCCTGGAGCC AGCGGTAGGCGAAGGGAAGCGTTTTGTACTCGCGCTTGATGTGCATTA