tg_tRNA-Ser4

Coordinates:1886670-1886756

>tg_tRNA-Ser4 tRNA-Ser (TGA)
GCCGGGATTGCCTAGCCTGGGAAGGCGCGGGCCTTGAGAGCCCGTGGGCGTTTGCCCGCC
GGGGTTCAAATCCCCGTCCCGGCGCCA
>tg_tRNA-Ser4 tRNA-Ser (TGA)
GCCGGGATTGCCTAGCCTGGGAAGGCGCGGGCCTTGAGAGCCCGTGGGCGTTTGCCCGCC
GGGGTTCAAATCCCCGTCCCGGCGCCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1886170 - 1887256 (Additional range around tg_tRNA-Ser4 is :500nt.)

>Thermococcus gammatolerans EJ3 TGCTTCAAGTTCATCACGGCGAGCGGTGTCTTCTCCTTCGGGAAGCTCGATAGGGGGACGGAGCTGCTCATAGAGAACAT GGTGCTCGACAGGGGCTGGCGCGTCCTTGACCTGGGCTGTGGTTACGGGGCAATTGGGATAGTTGCATCGCGCTTCGTTG ACTACGTCGTCATGACCGACGTGAACAAACGTGCAGTTAGCATAGCGAGGAAAAACTTAAAAATCAACGGCGTTAGAAAC GCCGAGGTCAGGTGGGGAAGCCTCTACGAGCCCGTTAAGGGCGAGAAATTTGACTCAATCATCACTAATCCCCCCGTGCA CGCGGGAAAGGAAGTCCTGAGGGAAATAGTTATAAACGCTCCCCGGCATCTCAACGATGGTGGCCTCCTGCAACTGGTGA TTAAGACGAAGCAGGGGGCAAAGTATATTAAGGCCCTCATGGAGGAGACCTTCACCGAAGTGAGAGAGCTCGCGAAGGGG AGTGGTTACCGCGTGTAC GCCGGGATTGCCTAGCCTGGGAAGGCGCGGGCCTTGAGAGCCCGTGGGCGTTTGCCCGCCG GGGTTCAAATCCCCGTCCCGGCGCCA AAATCCCTTTGATTCCCAAGAGGGATGGGAGGTGTATTCGTAATGACCGAGAA CTTCAGGCACATAGTCCGCGTTGCGGGCGTTGATTTGGATGGACACAAGCAGTTGAGATGGGCACTGACAGGGATTAAGG GAATAGGAATAAACTTCGCCACGATGGTGCTCAGGGTTGCAGGACTCGACCCATACATGAAGGCCGGTTACCTCACCGAC GAGCAGGTTAAGCTGATAGAGAAAATCCTTGAGGATCCAGTCGCCCACGGAATCCCGGCCTGGGCCGTCAACAGGCCGAA GGACTACGAGACCGGCAAGGACATGCACCTCATCACCGCCAAGCTCGTTATGGCCTGGCGCGAGGACATCAACAGGCTCA GGAGAATACGCGCTTACCGCGGTATAAGGCACGAGCTCGGCCTGCCGCTCCGCGGTCAGAGGACCAGGTCGAACTTCAGG CACGGAACTACGGTCGGCGTTAGCAGGAGAAAGAAGTGAGGTGGTGTA