tg_tRNA-Thr1

Coordinates:466428-466504

>tg_tRNA-Thr1 tRNA-Thr (GGT)
GCCCCGGTGGCTCAGCCTGGTGGAGCGGCCGCTTGGTAAGCGGCAGGTCGCGGGTTCAAA
CCCCGCCCGGGGCTCCA
>tg_tRNA-Thr1 tRNA-Thr (GGT)
GCCCCGGTGGCTCAGCCTGGTGGAGCGGCCGCTTGGTAAGCGGCAGGTCGCGGGTTCAAA
CCCCGCCCGGGGCTCCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 465928 - 467004 (Additional range around tg_tRNA-Thr1 is :500nt.)

>Thermococcus gammatolerans EJ3 TTTTACATGCCTCCCGGAATATACCGGGAGGTCATGAACTTCGTGGACGAGGAGGATCTATCGCCTGAGCTCGAGCTCTA CATCATAAAGAAGCCCCCGAACGTTCACGATATAAAGATTCCCGCCTTTGTGGTGTACGAACTAATAGACGACATCAGGA GGAGAATAGATAAAGGCCTTCGCGTTGCCGAAAAGGCCGTTAGGGAGAGCGTTATCGAGACCGATAACGTTGATAAGATC ATCCAGAAACTCAGAAGAAACTACCGCAAGGCCCTTAGGGAGGGGATAGTTGACAGTAAGGAGGACTTTGAGTTGATCTT GCTGGCAAAAGAACTTGATGCGACCATAGTTTCGGCCGATGTTGGAATATTAACCTGGGCCCAAAAGATGGGCATTAAGT GGATAGACGCCGCCAAGTTCAAGGAAGTTCTTGAGGAGCTCGTTGAGAAGGTCAGGGAAGAGAAAAATTTATAAATGCTC GGCTTCATCGTATCATCGAC GCCCCGGTGGCTCAGCCTGGTGGAGCGGCCGCTTGGTAAGCGGCAGGTCGCGGGTTCAA ACCCCGCCCGGGGCTCCA GTTTCTTGGGGGGCCGTGGGGTAGCTTGGTCTATCCTTCCGGCTTCGGGAGCCGGAGACCC GAGTTCAAATCTCGGCGGCCCCACCAATTCCCAACCGTTGCATTCTTGGACGTTATATCCAAAACATTAATATATGCCTT CACCCTCTTCTCACTGGACAATTAATCCAGGTGATGGGGATGAAAAAGGCAACGGTTTTTGTTATTGTCCTCCTCATGAT GGGCTCTGTGATAGCTCTAGGCTGTATTGGGGGTTCGGGTACATCCTCCAGTTCCTCTAGCACCTCCACGACTTCAGCTT CTTCCAGTGCCACTCCGGCTACAAAGACTACCGCTACTTCAAGCACTACCACGACAGCTACTACAACTACTACAGCAGAG CACACCCAGACGGAAAGGGCATACTATCCGATAACCATCAAAGATTTCGCGAACAGAACGGTTACAATCGAGAAGGAGCC GAGGAGAGTGGTTACCATTGCACCCTCGCTCACGGAGG