tg_tRNA-Thr3

Coordinates:1753470-1753546

>tg_tRNA-Thr3 tRNA-Thr (TGT)
GCCCCGGTAGCCTAGCCTGGCGGGGCGGCGGACTTGTAATCCGCCGGTCGCGGGTTCAAA
TCCCGCCCGGGGCTCCA
>tg_tRNA-Thr3 tRNA-Thr (TGT)
GCCCCGGTAGCCTAGCCTGGCGGGGCGGCGGACTTGTAATCCGCCGGTCGCGGGTTCAAA
TCCCGCCCGGGGCTCCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1752970 - 1754046 (Additional range around tg_tRNA-Thr3 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAATGCACTCACTGACGCGTAGCCTGTCGCTTGAATCTAGAAAGAGTGTAAAGTCCCTCTTCGCGAGCCTATCCTCGAC GGGAGCATGCTCAACGAGAAATGCTATTATTTCAGCGGTGCTGTACGGAACCTTCACTCCAATCTCGTCAGCCTTCCTGA AGAGCCTCTCGGGGATTTCAAAGATATCATCGCCCCTCCTTACTTCAACGCTTACCTTTGAGTTGATCTGTTCCCAGAGG AGGAGTGTGTTCCTGGCTTTCTCGATTTTTTCGAGTGCCCGCCTCTCAAGTATACTCACGTTGGCCCTGCTGGTGCCTAA AAGCTCGGCGATCTCGCTCTGTCTCAATCCCATCGCCCTCAATCGAAGTATTTTAATCTGCTGATCAGTGAGGAAGCTCT TGGATGGCATCTTAAACACCGAAGTTTAACAAAACGTCAAACATTAAAAGACTTTCGGGAAACGAAAGGTTTATAATTTT CGGCCTTTCCTTTAGATTGGT GCCCCGGTAGCCTAGCCTGGCGGGGCGGCGGACTTGTAATCCGCCGGTCGCGGGTTCA AATCCCGCCCGGGGCTCCA TATTCTGGTCCGATGATTGGAAAGAGAGTGAGCTGACGGGATGATGACCGACTTCTCGCT GAGGACCAAAGTTAGTTCATTTTTCATACCTCAGTGGCCTTTAGTGTTCTTCAATGTATATAAAATCCTCGATGTACATT CCCCCATTCGACCAGATCTTTGATCTAATGGGGCCATTAAATCAAAAATTTTCGTAGTAAACTTTTTGTTTTGAACGGAC TGTTTTCCGGCCTTTTTTCGAAAGGTTTATATACGCAAATGCCTAAGAGCCTATCGCAAATTACCGAGAAACAGAGGTGG TATGGATGGTCGAGATTGACCCGTTTGAGATGGCCGTTAAGCAGCTCGAGAGGGCTGCCCAGTACATGGACATAAGTGAG GAGGCCCTCGAGTGGCTCAAGAGGCCCATGAGGATTGTTGAGGTTAGCGTCCCCATCGAGATGGACGACGGTTCTGTTAA GGTTTTCACCGGTTTCCGCGTTCAGCACAACTGGGCCC