tg_tRNA-Tyr

Coordinates:82912-82989

>tg_tRNA-Tyr tRNA-Tyr (GTA)
CCCGCGGTAGCCTAGCCTGGGAGTGGCGGCGGACTGTAGATCCGCAGGTCCCCGGTTCAA
ATCCGGGCCGCGGGACCA
>tg_tRNA-Tyr tRNA-Tyr (GTA)
CCCGCGGTAGCCTAGCCTGGGAGTGGCGGCGGACTGTAGATCCGCAGGTCCCCGGTTCAA
ATCCGGGCCGCGGGACCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 82412 - 83489 (Additional range around tg_tRNA-Tyr is :500nt.)

>Thermococcus gammatolerans EJ3 TGCCGTCCTTTTCCTCCTCGAAGTCGCCCAGAACGGGATTGCTCTCGAGCTCACCGGTTTCGAGGTTCACTATCACGGGC TCGAGCCCTATGTTGCCCTCGTACTCCAGATCGTTCGCAGGCAGTATCTCAAGGATAAGAGAGTTGAGCTTTCTGTCGTG GTAAGCTATGATCTCAAGCGCGTCGCTTACCTCTCCGCTCGCCGGGATCACGTCAACGACTAAGCTCTCCCTCGGGAACA GAAGCGCCACAACGTCCCCGCTCCTGAAGAGTGCTATCCCTTTTCCCGCGTAGAGCTCCTCAAGCCCAAGTTCCCTCAGG AATTCCCTAACCTCGTCCCCGCCCGGGAGACGCTTTTCAGTGACCATGACGTCCCTCATCCTCTTCGCGAGAGGAACCGC GACGGTTATCGGCTCCCTCATCTTCTCCCACCGCATGTACTCCGAGGGAAAAATTTATAAACCTGCCCCGGGGATAATGG ATCGGGCTAACTGTAGGGT CCCGCGGTAGCCTAGCCTGGGAGTGGCGGCGGACTGTAGATCCGCAGGTCCCCGGTTCAA ATCCGGGCCGCGGGACCA CCAGAATTCTCGGTGTTCTCGATGGGGGCAATCTCAAAGGCTATGCGGCTTCTATCATGGG TTTTAGTACTGCTTCTCCTCGGGGTTACCCTTGACGTTTCCCTGAACGACGGCGCTCTAACCAAGAAGTACCTCCCCCGC CCGGTTCTTGATGAGTTTGAGGGGCTTCGGGAGCGGGTTGCGTCCCGCGCTGAGGACTACCTCGTAACCGAGGCCTTTGA GCGCTACCTCAACGATCCTAACGAACTCTCCGTGCTCAGGAACATCTCCGTTGCCCTCAAGGGAGAGGACGCCGTGAGCT CCGCATGGAACGTTCTTACCTGGGAGGACGAGCACCTCAATTACGATCGCAACAGAACTGAACCGATGTTCATACCGCCC TCAGAGTTCATCTCCCGGGGCAGGGGAATATGCGGCGATTACGCACTACTGACCGCAGGGCTTCTCCTGGTTATGAACCA CTCCCCGGTTTACGTTCTCTCGATAGAGTTCAATGATTC