tg_tRNA-Val1

Coordinates:299808-299884

>tg_tRNA-Val1 tRNA-Val (TAC)
GGGCCCGTGGTCTAGACGGTTATGACGCCACCCTTACAAGGTGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA
>tg_tRNA-Val1 tRNA-Val (TAC)
GGGCCCGTGGTCTAGACGGTTATGACGCCACCCTTACAAGGTGGAGGTCCGGGGTTCGAA
TCCCCGCGGGCCCACCA


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 299308 - 300384 (Additional range around tg_tRNA-Val1 is :500nt.)

>Thermococcus gammatolerans EJ3 CGCCCCCAGCATATACTCGGCTGTGGCAGTGACGGGACTTCAGATCTACAAGTTTGGAAAGAGCGCGACCGTCGCTTATC CCGAGAGGAACTGGTTTCCAACGAGCTACTACGACGTGATTAAAGAAAACAGGGAGCGTGGCCTGCACACCCTTCTTTTC CTTGACATAAAGGCCGAGCAGAACCGTTATATGACAGCTAATGAGGCGATGGAAATACTCCTTCAGGTTGAGGATATGAA GAAGGAGGGAATCTTTACGCCGGAAACACTCGTCGTGGTTTTGGCCAGAGCAGGTTCGTTGAACCCGACGATAAGGGCGG GCTACGTTAAAGACATGATCCATGAGGACTTTGGGAGACAGCCGCACGTTCTTATCGTGCCGGGAAGGCTCCACGTTGTT GAGGCTGAGTATCTGGTTGAGTTCGCTGGGGCTCCTGAGGAGATTTTGGAGGAAGTTTAGCGAAAGCTTTATATCCCACT TCAGTTTTTCCCTTTCGGGC GGGCCCGTGGTCTAGACGGTTATGACGCCACCCTTACAAGGTGGAGGTCCGGGGTTCGA ATCCCCGCGGGCCCACCA GTTACAAACTTCGCGCAGGCGAAGTTTGACCAAGGTTCGTAGCTCCTTCTGGAATGTTATA TTTCGAGTGATTTTTTCTTCAGTTGGCAGTTTGAGAGTGGGAACTCATCAAATTGTCCCTGGTTGTGGGTTTACTTTTAA ATCGACGCCCGAAGGGCGTCAAGGAAAATAAACCCCTTTGAGAGTGTACGACTAACTTTTTGCTCATTTGGAGGAGGGGC GGTCATTTCCCCAGCCTTTCCCAGAGGCTGTTGCAAAATTTTGTCAGAAAAGGTTTCTATGGTGGACCGGGCGGGATTTG AACCCGCGGCCTCCGCCTTGCGAGGGCGGCGCTCGTACCAGGCTGAGCTACCGGCCCACACCCGCTTATAGTGGGGACTA GTTGACTTTAAAAAGTTTTGGTTCATCGCGGTGCATTGTTGGACATGTTTGGGTTTAATTTCCACTGGAAAAGGATAACT TTTAACATGCAAATGCCAATTAGCTACTGGGGTAGGAT