released: 06/13/01
genome sequence : 04/09/01
Orfs revision 4.2

>SSO0001 Hypothetical protein
atgataactgaatttttacttaaaaagaaattagaagaacatttaagccatgtaaaggaa
gagaatacgatatatgtaacagatttagtaagatgccccagaagagtaagatatgagagt
gaatacaaggagcttgcaatctctcaggtttacgcgccttcagctattttaggggacata
ttgcatctcggtcttgaaagcgtattaaaagggaactttaatgcagaaactgaagttgaa
actctgagagaaattaacgtcggaggtaaagtttataaaattaaaggaagagccgatgca
ataattagaaatgacaacgggaagagtattgtaattgagataaaaacttctagaagtgat
aaaggattacctctaattcatcataaaatgcagctacagatatatttatggttatttagt
gcagaaaaaggtatactagtttacataactccagataggatagctgagtatgaaataaac
gaacctttagatgaagcaacaatagtaagacttgcagaggatacaataatgttacaaaac
tcacctagattcaactgggaatgtaaatattgcatattttccgtcatttgcccagctaaa
ctaacc
>SSO0002 (thiD-1) Phosphomethylpyrimidine kinase (EC: 2.7.4.7)
gtgcacactagaccagtagttgccacaatagctgggagtgacagtggaggaggtgctgga
ttacaggctgatctaaagacgtttagcgcattaggagtttttggtacaacaataataacc
ggtttaacagcacagaatacaagaacagttacaaaagtattagagataccattagatttc
attgaagctcagtttgatgcggtttgcctagatttacatccaactcacgccaaaactgga
atgttagcttctggtaaagtggtagaacttgtactgagaaaaattagagagtataacata
aaactagttttagatccagtgatggttgcgaaatctggatcattattggtaacagaggat
atctcggagcaaataaaaaaggcgatgaaggaggccataatatctactccaaacagatat
gaagctgagataataaataagacaaagattaatagtcaagatgatgttataaaagcggca
agggaaatttattctaagtatgggaatgttgtagttaaaggatttaatggagtagattac
gccataattgacggagaagaaatagagttaaaaggtgattacatcagtactaaaaataca
catggtagtggagacgtattttctgcctccataactgcatatcttgccttgggatacaaa
cttaaagatgcattaataagagctaaaaaattcgctacaatgacagtcaaatacggtttg
gacttaggaggaggatatggaccagtagatccctttgcccctatagagtccatagtgaag
agagaagaaggaagaaatcagctagaaaacttactttggtacttagagtctaatcttaac
gttatacttaaactaattaacgatacctcgaaagtaaatgtggcatatatgacaaagtat
aatgatgtattaagtttagctggaggattaataaaatatttggacaagctgaagattgat
ggaccgatacttaataatgtaaataacgagataactagaatcatgagagaaacaccagat
gagaaaataggaatattattgccatttactgataaaatattagacgctgcggaaaaaggt
aaaataaaattaaataaaagtggtattaatggggacgcaatactacgagataatatggta
ttaattatagccaaggataaggatgagttaataagaaagttaaaagaggtagctataggt
>SSO0004 (rbsK-1) Ribokinase (EC: 2.7.1.15)
ttgataatcgtagtaggaagttacaacgttgatgtaatattgaaagttaataaaatacct
gaaattggagaaactgtaatagctgatgaattatacataacgcatggaggtaaaggctca
aatcaggcagtatcagcttcaagattaggaagccatgttaaaataatcgttgcagtggga
gatgataaacatggaactgatgcgatcgaattttggaaatcagaaaatattgacgtatct
aaagtgaaagtaaagagtggtataaacactggaactgcatatatattcgttgacaagaaa
ggaagaaatatcattgttgtaaacagaggtgcaaattactatttgtcagaagacgattta
aataatagcctcgagggtgacatattattaatgcaattggaaataagggaaagtgtagtt
aaaaaggcagcaaaggagtttaacggaataaaaatacttaatcccgccccagctaacctt
aaagatactgaaattttgtcattagtagatattataacacctaatgaaatagagttcaaa
gagttagtaaatactgacgatttcgaatatggtttaaatctattgctaaagaaagtaaaa
aaggcggtgatagttacgctaggggaaagaggagcacttctggcaactagagacggaaaa
aaggtacttataccagctcctaaagtaaatgttatcgatgaaacgggagctggtgacgta
tttaatgcagcgctttccgtgtatttagaaaaggggtatgaccttgagactgcagttgaa
tatgcgaataaggttgcagcgctttccgtaactaagataggagctttaggaccaaaatta
gatgaggtggtgagatttcttgaagaaatcgacaaagcg
>SSO0006 Conserved hypothetical protein
atgaaaattacctttattggaactggagctggttctagtctagggctaaaaagggttaag
tccagtatattaattaacgataaagtacttcttgacttaggtcctggggctgagttaaga
ttagaagatctaagaatacatccgaaagctctctttattactcatttgcatattgatcat
ttcagtggagtttttgactatttagtccagaggaaaataagacaaatccccgaattagta
atctattctcccaaaggcttttcagaagtcctaaacatatacactagaataggaaataat
atttcggctaaaatatatgaaagcgacttacccagcggtaaaattgacgaaatggaaata
tattcgattcaagcttgtcactcgatttatgccgttagctacattataagcgatggaaat
acgagagtattatatactggtgatactaaagaaccttgtaatgctatactagaaaacata
aaagatgttgatttgatcattcatgaaacaacttgtgtagatgactgtagtatttgggga
catacttcaataaaacaaatatttgagttatttagcaataagagaatttttgctacacac
attccggccgaaattgaagaaaaaataataagccttgctaataataaaataaatattgct
tttgacgggttgtcattaaatgtg
>SSO0007 Conserved hypothetical protein
atgtgtagaattttggcttttcatactaagggcgaaatttcaaaagaatacgtaaatgca
ttaataagggcaagtagaaatgatattttctctaaatatggaagtcatccagatggatgg
ggtctaagtatatttctcaagagaaatgataaatggaaggtaatttattatagatcagaa
gatccaatatatgaggatcctaacatcagttatctaattgatattgccaagggagaggac
atagttggagttattcatgcaagaaaagccggtaggaaatttcttaccggactatctcac
gctcatccctattacatgcgagcaaacatctatgatctctactttgctcataatggttca
gttagtagaacaagctttaaagatagcaatagaccattcacagatagctatctaattcta
gaagagattaagactttaatagagagtaatatgtctccatttgacgcgtatgcaataact
ctagataaactgaaggactgttctacgagcttaaattcaagtttgatttattacaataag
aaggaaggaccctctattctaattggatattattataataggaatagattatcaaaagag
actaatgaagagtattacaagctatatacagacaataaaagatacatcttttcatcaaca
ataaaatattatctaggagtagatgcagaggaacttataatgggaagtattatacatctt
>SSO0008 Transposase, probably IS605-TnpB family
atgaaggagagtctcatagaagcaaaagttatggattatggtaaactaaaggacattcaa
aaggaaattttatattacaagctctatgttgacgcattgaaaaagaaagggattaaggaa
aaagtggacccaccccctaccttgcccaaatctattgtatcttcagtgctcactggagga
atccctagagatggcccactacagatagaattagttagtaatgatgtagtaaagataaag
gagtataacactttagtaaaaatacagagtgattctaggctaccgttatatgccatagta
gagtacagggatactgatataagggtttatttagcttatcgagagaatcctagcatagtt
ggattagacctaggcttacggcatctaataacaattgttgcaataaaagataccaaacca
tggaaagtgagattctttgatgagcctaaacttatggagaaatttgcaaatttcttaagt
gaaaatcaaggaattattaagttagaagaaatgaagagtaacgctaaaagaattatttac
gaagctgtaagctttattgaagatttagaaccaaaagtagttgcgatggagaatttggaa
tattttgagaccaaaacgggtaaaggattaagagctttacagaatatgctagagaacgaa
atacgaagaagaggtattagatatagaaaaatagacccatataacacatcaagggtatgt
gcaaagtgtggatacaagaaaggtgaaatattaggctcgctatttgtatgtccagcatgt
ggatataaagcggatagagattataacgcagcatataatatagcactaaaatgttattac
acttgc
>SSO0009 Deacetylase, putative
atgataactattgtttatgatgatatatacaagtatcatgctccaaaggggtatcacgtt
gagaatcccagtagaatagacaaggcattatctgcaattaatcaacttaaggttaagttc
aaaaaacctattaaagttgatgatccacaaataatacattcggaagattacgttaaatta
gttgaaaaacactccaaattagaagagaacttagacgaagatacttatactaataggtac
acctatgagtccgcactttatgcaatgggtggtgcattagaggcatttgagactaatggt
tttgcattagttaggccacctggtcatcacgctggagttaacggtagagcgtttggtgct
cctaccctaggtttttgcatttttaataatgtagcatatcccattaagaagtacaagcta
aagagagttgcaattattgattttgatgtgcattacggcaatggcactcaagagattttt
tatgatgatccagatattttgcatattgatgtgcatcaagatcctagaactatctatcct
ggaaacggtttcccagatatgataggcgagaaagatgcagaagggacgaagattaactta
ctaattcctcctttaggtagtgacgatttatatgaggaattaattccaattatccaggca
attttagatgacttcaaaccagcagttatcgcttattctgctggatttgactcttacatg
ggcgacggtctagcatcagtgaacgctactgaatacacattctatagttttggagtactc
agtaataaattcactaaaaagtatgcagttttagaggggggctacgataaaggtttaata
aaaggtttaaaggcgtttttagaaggatttgcaaacataaaaatggagtataaaaaatat
cagtcaaacgattcggtgagatccagatttatgaattatctgagtgaagagaagaatatt
ttgaggaattattggagtatt
>SSO0010 X-pro aminopeptidase
atgaatcgaatacagagagtacaaaaagaattggagagagctaatgcagattacttaata
actggcactactagcaatatgtactatttaataggattttctgaggaacaaatggaaagg
ccacttttacttttcattaccagagacgattattttctacttgtaccaaaactttatgag
gagcaattaaagcaatttccgcttatcgtctacagagacggagaggatccttactccaag
ctaaatttgaaggaaaattctaatgttttaattgacgatacaaccttctcgctatttact
atagaaatactaaatagattcaaacctggaagaataggcagagcctcacgtatattggga
aagcttagacaagtaaaggatgatgaggaattagaaaaaatggagaaaggtgttaagaaa
gcggaacaacttattttagaatttgtatcgaacataaaggaaaatatgacagagtgccaa
atagagagaaaattaaagagtttcttgatcgaagaggcgggtaatatatcgtttgatcca
atagtaacctccggtcctaactcttctatgcctcacttaagatgtagtgataaaaaggta
aaacgaggtgaggcaatagttatagattatgggataaagcatgatggctactctactgac
accacaagagtgttctccttaggtaaacctaatgatcctttaattttagaaattgtcgaa
attgttaaaactgcgaatgaagaggctgaaaagcatgtaagagaaggtatgagagcaaag
gaaattgactattttgctagagaagtcataactaataaagggtatggggactattttatt
cacagaactggacatggtataggaatcgacgttcatgaagatccatatatttcgccggat
aacgatgatgtaatagagcaaaatatggtgtttactatagagcctggaatttatctacca
ggcaaatttgggataaggatagaagacgaagtagtagtaaaaaaaggttatgggaaaaca
ctaaacatgttacaaaaagaattatacattata
>SSO0011 Conserved hypothetical protein
ttgaaggtgatttcggtgaaaaagagtttgataatattactttttgtaatattatctcct
ataacatatttaacattaccactatcctcacaatccactcctattcaaggatatgcgaca
agtagtgagttgataacacccggcgaaattgaggtaccaataacctttcatttgattaac
ttaggtcaaaccttaactgaggttacaataacccctgcagatacttatccgttttacctt
tacccctataataatggaactgaacttacacacatacccttgtggaatcaaggacagaca
gtaaatgttacttacttgtttgatatagctagtactgctaagactggtacatatactgat
gtagttgtagttcaaggtatcactacctctggtacccaagtaacttatgatgttttagta
ccagtagtaatagctggctatgttaatttctccgcatcatcagtatggggaacaacatca
aacccaatggtagtaggaccaggagaaaacaacatcccactaacaataatactacaaaac
ttaggtaattcgttagtcaccaatataacattagaactaaactcacagtttccagttgga
ttcctacaaaataacgctacaatttccgcaataccagcaggatattatggagaggtaact
gtaatgacttcagtatatcctaatgcaactgaaggtttgtattacatcaagctaaatgta
atatactatcataatgcgactactacagtattagtacctattgatataggatcatctaat
caagtgtcactagaggacgcatggggtacaccatcagacccgatggtagctgcgcctggt
gaaactttacttcccctcactatttacgtaaagaatcttggcgagaacctactatccaat
gtcatgttaatattgcaatctcactatccaattcaattcctccaaaattacacaatgata
ggtttcgtaccagctggaggttataattacgttacagtagtagcaaacgtctataagaac
gtaacacctggagtatattacgtaccaataaccttagtggcatacgatggagggttcatg
cagacttttgaaatgccagtctacgttttaggctatgttaatttctccgcatcatcagta
tggggaacaacatcaaacccaatggtagtaggaccaggagaaaacaacatcccactaaca
ataatactacaaaactctgggatagttactgtaactaacgcaaccttgttcctacaatca
cagtatccggtacagtttctacagaacaatgtaacccttgggaacgtcccagccggctat
cctataccagtaacagtactagcaaacgtttatcctaacgtaacaaataccggtgtttac
tacataaccgcaaaagtgatgtattacgatggtgtgatacaatatgtaaaggtcccaata
tatatagagtcactaaatcaagtttcggtagagggtatatggggttctttatctaatcca
atactggtagctccgggtgagaacaatgtaccactaacgctagtgataaagaatcttggt
gaaaacctactatcaaacgtaagcctaatattgcaatctcattatccgatacaattcctc
cagcaaaacgcctccgttggtttcgttcccgctggtagctacaattacgtaacagtgacg
gccaacgtgtttccaaatgcaactccaggagtatactacataccagcaaccctagtggct
tatggtggatttaaggaaaacataatgataactgttgatatcctaggatatgttacaata
caagctcaaagcttgtggggagaagtaacatccccaataacggtctcctcaggtgagact
gatgtacctttaacggttttactcaaaaacactggtgacgttaatattcttaatgctacc
ctagttttccagaacgtagagtatccattaatcttccatcaggccactgcacaaatcggt
attgtaccagctggtcaagagaattatgcaacagttactgtaagtgtgtttccaaatgca
actccaggagtatactacataccagcaactctatattacttcaatcatcaaaccacaata
acagttccaataacaatttattcacctaatatttcagtaaatttagtaactattccacct
caagtatttcctagctattatgatgttagattattggtaattttaacaaactttggaggt
ggtatagcggaaaacgctaacgtgagcattcaatcaccattccaagttatatcttctaat
ccactacacttaggagcactaccagtgggagtccccatcaatgccacatttcttattaat
gttccaaataatacagtgcctaaaatctacattgtaaacattactattaactatgatggt
ggaaaagaaacgtatcaatatccattacagatatatcccaaggctaatctgatagtagta
ggagtttcttatccttcactaagtgcaggagacagcaacgtgccaattacaataactctt
aaaaacgctggaaattcgacagctaagaacgttatagttaggctaggaacttccaatcta
atatatcctcatgtgagttcatcaaacccattgcaagcattaacagcatctgaggtattc
gctggagatattgcacccggacaagcaataaatgtaacttttgtagtcgatgtaagtggt
ggagcgtctgctggaacttacccattagcaattgctttgatatggaatcaaactggtgca
ctatttccatttgagcagtctgatacattctacgtaacaatatctcctccattctatgaa
cagttctttaaatcacctattggcataataacaattatagtaataatagttataattata
gtgattgctgccgtactcctaagagtaagaaataaaagaaga
>SSO0012 Conserved hypothetical protein
atgtatatgatcctagaattacttaacataattggtataattgcatttacaatttctggt
tctcttaagggaactaataagggactagatatttttggtgttgtaactctaggtgtaata
actagttatgccggaggtataattgcagatatcttactgggcatatatccaccacagata
ctaaaggaattgaattacctactactaagtgtaggtatttccattttcgtcttttacttc
tataaatggttacagactaatcctataaagatgataattgcgataagtgatgcagtagga
ctttcaacttttgctacattaggtgcatcattagcttactcttatgggttaaatccaata
tcagttggattaattgcggctattgttggcactggtggaggtgtgataagagatgttctt
gtaaacgaaattcctatggtacttacaaaggaaatatatgctactgcagcccttcttagt
ggatttatatactatttcactactccttatttacatcatgatagtttatttgtagctttt
ctgggttcatttttattgagaatactttcaataaaatacaattttaatttacctaaaagg
gaagacaacaaaagc
>SSO0013 Hypothetical protein
ttgttattatactttaagcctaccaaaaaagaaagagatataaacgttgctttggaaatt
gtatctgagttattcgcttcgagaattggtaaactaatgggtttgcctattctagaagtg
tctttaataaaacatggggatgaaataggattattaatggattatttaccggataaagct
acagagcagaatatatataatttagatgaaatcaagatgagtttagcatttgaagaatgg
attctaaacatagatttaaaagaggatcatgtactatcaaagaacggaaagggattcatc
attgatcatggacattcattgtctgcttggaaaccattatactatataatacaaatcata
gataaaaaggtaagtagatttaatttgtgggctagtgaggatgattttagagatggaata
gaactgttatcgtcaatagatcataatactatatctgaaattcttaaggaaagcttctcc
gaggtagttgagagtaatttctgcaaattatttactagggaagttgctgccgagtacatg
gacttgaatattaagattttggaaaaaagaatgaaatatctgaaagatggtaagatttta
tttacctataattataggcaa
>SSO0014 Conserved hypothetical protein
atggactttaacaatattataggtaatacgttaagaataggcgtaataattagtgcaata
ataataattttcggagttgctctactatttgtgaataatggttcaaacggctttactatc
actcagatatcaagttcaaattcaattgttaatagttcaattttcaaaccctctgaaata
tttagtggactgcctaagctatacggtttagattatatatacttaggcttaatggttcta
atagctacccccgtacttagagtgttattagggattgcgcagtttgcgtcagagagaaat
aagctatatacaataataactataattgtattttttaatctaatgtttgctatatttcta
ttgcctataattataggtaaa
>SSO0015 Conserved hypothetical protein
atgttgacgccaatagaattttttgttacagttgtgctaataagtgctctttcaggtata
ctaggcgctttaaccggtttaggtggagccacgtttttagtaccaatttatacattatat
ctaaatgtgcctattgcctatgcttctggagctagtctaatctcaaccatagcaacctct
agtggtgcagcaagtgcttacgttaaggatagaataactaacgtcaaaataggaatggga
cttgaaatagctactacaacaggctctatagctggagccttaacagtggcctatatttac
gctcatcacttggaatttatagtatacattgtctttggaattgtcttactttcccaggtt
tatgtacaacttgctaagtctaaatttgaacttcctaaacccattaagccagattggaca
actagagtttttgagctctatgggaaatattacgatacagtcctaaaacaagaggttgaa
tatcatggtgttagatggtggttaggtgaaataattatgttctttgctggtttcatctct
ggtttgttgggaataggttccggtgcgctcaaggttttaggtatggattgggctatgaac
ttaccgatgaaagttagtactactactagtaacttcatgattggcgtgacagctgcaact
gggagctcaatttactggatattcggatacatacagccatttttggcagcaggtactgca
ttgggtgttttaattggtgcgtttgttgggactaaaatattagttagagttacaaataaa
actataaggtacatttttactgcaattctcatctttctaggaattcaaatgatactaagg
gggttcggatatggactt
>SSO0016 Transcription regulator (exsB) related protein
gtgtgcagtgtatctggagtcctcatattaaaccctaaaaattttgagaaagttgagctg
aaattagctagtatcctcaaaaaggcagaagataggggtagggacagttttggtattgtt
gtaattcaaaaggatggtacagtaaaagtaagaaaatccataggaaagccctcagaaaaa
gaggaattactatacggcattttagatgaagactctagggttgtcatagctaataatagg
gcagaacccactactgaatacgttagacagaaaactgaggacgacattcaaccttttatt
ggagacagatatattgtaactcataatggaataatcgcaaatgatttagaattagagaaa
aaatatgaattaaaaagaaaaactaagatagatagtgcaattcttccactacttttggac
aagacgtgggacggtaatcttgaagcactaaagggaatattagagcaaatcaaaggaagt
tttgctttggttataggagataagaaaaaccctgatagaatatttctagctcagaacttt
aagccattatacatggcttatgaccactcgttggagtccctattctttacatctcttgac
gaatattttgatgcaaaaccattcgacccagtaaatataactaaattggaaccatattcg
gtagtaatggtcacttcgaataaactaataactacgttgcctatcatggaaaaaagaaag
aagtatagggtacttgttgtggcaagtggtgggttagattccactgtagcagcaactaaa
cttctaagagaaggtcatgaagttactctaatacactttaattaccaccataaggctgag
gaaaaggaaagagaggccgtgaggaaaattgccgaatatttgcaaataccactgcttgaa
ataaatacagatttattcaaaataataggtcatgccacgttaataaagggaggaggagag
atagttaaggataggaaaggagaagaaggagcagagtttgcacatgaatgggttcctgca
agaaatctaattttcttctctgtttcattagcaattgccgaagcctatggatatgatgcc
atagcatctggaataaatttagaggaagctggagcttatccagataacgagatggaattc
ataaggatgttaaataagttaagcccatatgcaactggtccaaacaagagaattgagata
ttaatgccagttggtaatttagtaaagcacgaaatagtaaagctgggatacgaaattggt
gccccactacatttgacctggagctgttatgaaggtgggcaaaaacattgtgggaaatgt
gggccttgttatatgaggaagatggcgtttaggatcaatggacttaaagatccagttgaa
tatgatgaagag
>SSO0017 ATP-dependent helicase
gtggagattctaagtgaagtaaatgacaagctaaaaacgtttaacgctaagatagctcac
gttcatacagaaacttttctggaaccggaatatggaccatccataaacgaaatagatatt
gatgataagctaaagaaatctattatagaatatggaatagagagattatataaatatcaa
tatgatgcataccgaaaaataaaaaataaggaaaacgtcatgatcatatcaggtactgga
accggtaaaactgaagcatttttaatcccaattctagacctagcattaaagggcgaaaga
agtgttttagtttatcctacaaaagctctagcaagggatcaacttactagagtttacaaa
ttagcaagagaattaggattgaatgttgggattttcgatggagatacaccggaaaaagag
agagaaagattgtatagaaatcctcctcacatactaataactaatccagatatgatacat
ttaggcctagctttaagtactagattcaggtttttgttaagaactgctgatcattttata
tttgatgaagttcatgtatatgaaggcgttttaggtgctcatataagaaatctagctgat
agaatcaaggaatttaagaacgatattcatatagtagcgtcaagtgccacagtaggcgct
acaaaatacttgtttgaggagctgttcggggttgagggggaaataatagaggggataaga
agaagaaaaggaatcgcaatacatagcattattgatagtggtaattctagtaggtggacg
ttggctgcttatttggcggcagttctagttaaaaatgggctaaaagtactagtgtttact
gattctcaacagatggcagagttagtagctaagatagctgatagatttagagtaaatcta
gaggtgcatagagcaggtttaattgcagaagaaaggataaaagtagaggagaagctaaga
aatggagaattggatggagtagtggccacacctactttagagctaggaatagacatagga
accattgatgcagtaataatggcagagaatccaccaagttatactaaatacgttcagaga
gctgggagagcagggagaaggaataacgctggtttagtatttacaatcttaggagatgat
cctatagatagttactatcttaggcacccagaggagttctttaccagaaaaatacaagca
ttaacatttgatcctacaaacatagaagtaattaaaattcatgctttagcatatttggct
gaaaaatatagagtaaagttgaataatttacctcctctttggaaaaaagcatatgagata
ttagctaccgaaagcagagctaaaattgtaggtagttatgtcttagctactccagaaact
aaaaaatatgttgccacaacctctcttaggagtgtaggccccatagtaagaatatatgaa
gataagaagaaaatcggcgaaagagaactgcctgcggcattgcatgacctatatccaaat
gcagtatatttgatttcaaagaagacttacattatagaggaatttgatattgacagatta
atagcaaaggtaagaaaagttaatagtgagttatcgtattacactaaacccctttattca
atggatctattggagtttaataaaaaagatgagagagaagtatacggagaaaaagtggaa
tatggggacatgaaattagtcatgagagtggaaggttatgtaacttatgatgtatattct
aaaagggggaaaaatgagtacttttatgaaaaccctatttcatttacatataatacgaag
gggcttctaatataccacccattaatagatgacttcactctcatagatcatatggagacc
taccatgcaaccgagcacgtattaatatctgcagccagagttgccgcaggagcgtcgtta
actgacttgggaggaataagctatcctagtggacacgttgtaatatacgactcctccata
ggaggaagcggagtttctaaattattatttgaaagattggagcaagcttacgaagttgca
ttagatatagttaagagttgcaattgtgaggatggttgtcctaattgtgtatacagtcca
tattgtggtaataataataaatatttatctaggaaaaaatcgttaagattaatagacggg
ttaataaagggtacaataaaaggagtaaacaaggatagagagggaaacccaattgca
>SSO0018 Hypothetical protein
ttgcataataacttttacagaatattaaagccaacaaaagtaggcaatgttgaggtaaag
aacgtaataaaatactcagaaggtatatctatcttaccaaatgccgtacctagatatgaa
tactttaggggattagagggtgagaatgtaattgatttcattgattataagggtgtagat
gacttaggtgacaagctacgagtaaaggctggtactaaatggagtgaagttctggaaaaa
tataaagtagaattttggtctaatgcggatttttctattggagggtctgtattctttaat
gacccaattacaggctttaatgaatttggaaagataaatgggagagttgaagttgatgcc
tacttggatggcaaatattactctggacgatataagggtggaattgtaatacatgtctat
ttgaaaaaagaggaaaaggaaatagtgtataaaaggttatatggaaacttatccgaatta
atttctattataaaaagttggtatacttcaagaataccagtatttagggaagttagtcta
gtaaagaaagataaggagagttatatactggtatcatatcccaaaacaagagaagtactg
ctacagggtttattaagcgagtttaacgaagaaagttcacctattgttgagaagatagag
tatgagtattggtatctaggttactcacctctaaacacaattgatagtataattaatctt
gcaaaagaatctcagctgtcggtaatacgatttagaaaggatgaaatcgcttattcaatt
tactctaataagcgactagagtctataagaaacactctagagtattctaccatagaggga
gaaggcttattcaatggatgcattctatgcggtaaatgtgttagtgtttgcccttacggt
aaacaaactaatgacgtattccatactcctcttggtttctattcaatcacatattttgag
aaagagaacgatctggctaattgtcacatgtgtggtttatgtgaacaagtttgtcctgta
agattagatatcactaatgaattaagaaaagctacaaaaattaatcaaatatcccctaag
aatctactcagaagtattaacagcgatctaagtagtgttctgataataacatctttatca
gaagaacttaatgatcaaataattaagtctcttatatacttaattaaaaaaggtaagaga
gtaggtatattttacctagcagaagacttttcgaaaatagtgaagaatgagtttagttta
gagggattgttaaaatttaaagaaatttataccataacacctgaagaatatttctattta
cagaaactaaagaaaaggactgtaatagatatatacaatatacaattattagcaatgaac
gacttaaaaatgaataaagataaccttcatataccatgcttgttagggagtgagttaaac
gagtcaaattttacttgcaccaatgtgtttcttaatatccttaataataaggataatatt
aataggacaattgataaaaaagttacactatgcccattaactgcaagggaattaaatatt
aaaacaccgttagatttagttgaaataaacttagatgaaaattatattagcgatttttac
aaaaagcttgagatcggtactaaagatttaggagaagatattgaggaagatttaggttgg
tacaaggatattgaggatagaatagtagatgaagtatactctacactaatagatggaata
attaaaggcgagaacatagagaacttagttctactgtatttcaaactaaatagtatggac
ttaaccaaaaatattaaagagatcttaatggataagttaactaaaattattttctcc
>SSO0019 (moaB) Molybdenum cofactor biosynthesis protein B
ttgaataatcttatgtcagctcataaacaacataggcaacacgctcctactaatataaac
ttttacgtaattacaataagtacttctagatatgagaaattagtgagaaaggaaccttta
atagatgagtccggggatattataaaacagttaattatacaatcgaactataatataata
ggttacgaattagtgccggatgagaaagtaaaaatacttaaagcttttgcaaacgcctta
gataattcccaaactgacgtaattatatcaacaggcggtactggttatacgcagagtgat
gtcacagtagagactataagaagaatattcgatagagaaatcgagggtttttccgatgta
tttagactggtgagctataatgatcctgaagttaaatccgcatcatatttgacaaaagct
actgctggaataataaacgacaaggtaattttcctgttgcccggttcacctgacgctgta
agattagctatgaaggaattgatattaccagaaattggccatctgctttatattgttagg
agaaaa
>SSO0020 Hypothetical protein
atgatagttgagggttattttctaaaatatagagatgtaatatggagcattaaaggatgc
tatcatccagatgggtatgctgttgcaatacctagattattcaatggggtaaagatcaag
aggttaaatgatgcgttagaagtagtaagaactaaatttagcaatttattaaaatatgtt
gatgagataggatttaatgtacctttagttcccctaaacgaaagtgaaatcttagatcca
ttcaatgctaagatattcaataacagagtaagagaattcctgcgcttttttaatggagat
gtaggaattactgggagctatttgtatttaggcaagggtaatgatatggacttcttgagc
ttcaaaccagaacattattacgtcttagaggagttaagaaaaaaggggatcactaaaccg
ttatccactgtcgaagagtctgaaatagagactctagactattcttcatttaagatttta
aaaagtaaaaggattttagaaggcatttttgaagggcgaggatatacatttaaaattgtc
caatgtgaaaaatttggtccagttagggaagtaaaggaatttgaaggatatgtgagaatt
ttaaaatcaattaaaccatttactattccagtaaagtatcttgtaactgacaatcatggc
aacgagtatattttaactagttttaggactagatttacagaactattacctaatatggaa
atttttattaaaggaaagattctggtgagggatgaatttaacgatatggatttagatata
gctgaaatagtaaagttaaaatcattt
>SSO0021 (soxB-like) Oxidoreductase, soxB-like, putative
ttgataattctctctgctggagcgtggagtaaatatttaattaacgttaagctccctgta
aagacttactattgttgggcttcactatttttaagtaaaaagaaagaggtaggatctaat
ataatatatgattacgttaataacttctattctagaccagttatagggcttggatttccg
ttagctattatgggagatggaaaagctatagaaactactcctttacagcaaaatatctgt
atagaagataagaatgaagtttccgctagaatttccaggaggctaggtgaagtcaaggag
ttatatacttctggtagtttttgtgaagccacgccagacatgagaccagcatatggaaaa
atagctgaaaatgtatattttataggtggatttaacggttatggagctgaggtagggcca
gggttagctcatgtccttgtagaggagattttatctaaaaaagaagatacttattttacg
gaatatagactagaaaggcttaatgggtatgatggcaatttcgaaatagggcaagaacct
catgagtta
>SSO0022 Hypothetical protein
atgatatcatggctattaggatcacaaccttccccttggtcatttctggaagatctgttc
caagattatagaaacgtagcgatatacgttgacaataataacattgtacaaatagttaag
gtaagtgatatagatgaattttacacaccattttcagtacttatacacgcaaaatatttc
aagaattactctccgtattacataaaattagagaaaatggtggcatttccaactacgaat
gagaaagtagccgatagtttgcttatcaaagagggatggagaggaattaaatattattat
ggtgacgaatttttaggagcgtggatactatacgattgcataaaatgtagagataagcag
aggtctcatttagaaattagcaagctatccataagtgaggatgaaacgataaaagctcat
ttaagaatctataactca
>SSO0023 Conserved hypothetical protein
atgagatccaaattgatgtttattagtgatctagaaaaattagctaaaagactagaggaa
ttgtatggagatatagaactagatgatatagtacaaagactaatagatttttatgaatta
ggattcacaaatattaaccactccagtctacaattaatattatctgcttacttcaagagt
ctaggctatagagtattcgtggagtatgagaagaaaggaaaactacttgatctctacgtt
agtgatgaagatatgggaatagaagtagaatatggttatatacccaattcagatgccata
gatgctgaagagtatctattaagtagaatttcactaaaaattctgaggtatagtagttta
tcatcgaagttctatattgcagtgccctctttttatatgccacctatccccgaggaatta
acagctgacgtaaaagataaagcaaaactgaggagagtaattgaaataattagaaaattt
tataaaattaatgatgtaacttttaatgatgtaaaattagctaaaattaatggtataata
tctgtagatattagcaacttaagtataagtgtaatcgatattagaaagtataaacagcta
aaggactcttacaaa
>SSO0024 Conserved hypothetical protein
atgttaataactattagcgatatcgcttggggaatagcgctaagtatatgggtggcgatt
gttgttctgtacatttctaagttaatctcaaaaaaattcggagcatatgtaactagaaag
gcaatacacatgttaggaggggggattgtagcagtactatctccatttgtttttaactct
cccttagttccaataattacatcttatctcattatggcgtatttgataaccataagagtg
ctaaggaaagagatgagttggtttatggataaggaaaatttaggggaagtgttcttcgcg
ttctcctttgggactgttttattagtaatgtttattttagatcccaattattggactagc
actgatctaatttacgttgctgttcttcccttaatcttcatgtcttttggtgatggcata
accggaataataagaaattttgtgtataagaggagagttaaaggactttggggatcaatg
ggaatgttaatattctgcgctacagtaggctactttgtattaaatatacctggtttaata
gccggaatccttgctaccgttgctgaactattaccgtatatcgatgataatatttctgtg
ccgtttttatcgtttctatttctttatctatttgtaagagtcctt
>SSO0025 Hypothetical protein
atgcaattatacaaatactcattaaaggacggatatttggttccaaatgaaaatggtgat
gttacagtattcgtggaaggaaattttatctcaataactgataaaaacggtaataagata
gaaggcgctagatttaagtatctagggaatgaatacctcctcttagaaaaacttaggtat
ttggcgaagttagttaacgtagatgtagatgaggatgttcttttggctcaccctacatta
agaaatagaacacttgcaataaacaaacttatgggcgaactatttgaagttttcatttat
aatctcttgctagcaaaggactataaggtaaaaagacaatttgaaatttatccttcgctt
cgtaaattcactcatactagatggcataataggcccgactttatagtagaagacaagctc
gtaattgaggccaaaattcacaaaaatgattacctacagactctagagtactctaaatat
ttcaagtacggtatggcagtatttccatttactggagagtgtagagtacctaaaggttgg
atttgtatatttaacaccacaaaggatcagtctagattctactctcttcttgaagattta
ttatctagagttaag
>SSO0026 (purT) Phosphoribosylglycinamide formyltransferase 2 (EC: 2.1.2.-)
ttgaagatttattatctagagttaagtaattgccatatggaaattggcactcccttattt
gaaggttcgaagaaaatccttctacttggaagtggagagttaggaaaggaaatggctatt
gaggcacaaagaatgggattagaagttgttgctttagatagatacgatctagctcctgcc
atgcacgttgctcacagaaagtatgtagtagatatgatgaatccaaacgctattaaggca
gtagtgaaaagggaaagaccagatgcgattatagctgaaatagaggcaattaatacagac
gcattaattgaacttgaaagcaacggctttagagtggttcctaatgcaaatgcagtaaaa
gcttgcatgaatagaattgaattaagaagatttgctgcagaaaaacttaaacttccaact
acgaaatacgcatttgccgaaaatgaagaagaggtaaaacgagcttgtaaggatattggt
tttccttgtctgattaaaccggagatgagctctagtgggcatggccatgtattagtcaat
aaaatcgagaatgtagaggaagcttatagagagtctatatctcacgctagaggtaagagt
agaagagtcattgtagaagagttcgtaaaaatagatactgagctaacagtattaacgtat
agatatcattcgaattctgatagcataataactaagaccattgaaccaatagaacataag
agaccaagctattattatgttgagtcatggcatccttctaatgtaagccaaggagtgaaa
gagactgctaggggaatcgcacaaaaggttgcagaagaactaggaggtctaggaatatat
ggtgttgaaataatagttagtggaaatagaattctctttagcgaagtagcgcccagaccc
catgatactggattagttacattagctagtagcgatataaatgaattccaaattcatgtt
agaagtgcaataggcttgccgactccagaagttaagttagtttccccagcggcctctcat
gtgattttagcacaaacagaaaatgtttggggacctaaatttctaaacatagagaaggca
atggagattccgggcgtacaagttaggttgttcggaaaacctgttacatacgagaagaga
agaatgggtgtagtattggcaactggaaatagtgtagaagaggcgttagaaaaagttaga
aaggcatcttcaataatattagttaag
>SSO0028 Acetylpolyamine aminohydrolase
ttgcacaaaacggcttttatatggacagacgaatattataactattcgttcccagactat
catccatttaaatccctgagagaaagcatgactaaaaggctcctagaagaaagaggtgca
tttcatttcatcacactagttgaacccaagtcgattccagaagaggctcttcagctggta
cactccaaagaatatatagaatttgtaaaatataaaagtaaggagggtcaaggctatttg
gatgacggagatactccagcgtttaagggtatatatgaggcggcattaatcagagtaagt
ggtagtgtaaaggcattagagttaataaaaagtggagaatttaaccacactatcaatatt
ggtggaggttttcatcatgcaaagaggaatagagcagctggtttttgcgtttttaacgat
gtggctctaatatctaaattaggggagagtttcttttcaagaatagccatagttgatata
gatggtcatcacgctgatggtacacaagagctattaattgatgataataatattttgaaa
atttctttacacatgtttcatcctaatttcttcccgggtaccggggatgtgaacgagatc
gggctagggaaaggggaagggtatactatcaatatccctcttccacctggtactggagat
gatggttatctcttagccttcgacgaaatagtagtccccgctatagaaagatataagcca
gaactaattattcttgtagcaggtggtgattctcattttaacgaccctttagttgagtta
aaattatctacccatggctatttagatgtggtaaccaagatccatcgcctagttcacgaa
tattctaatggtaggctcataatgttaggtgggggtggatataattacgatgcgactgcc
agaatttggacaatttcaatagccgagatagctggaatatacgacttagaatatgaaact
cttcatgactccttctcaactaaatcgtcgcagtttgttatggagaaaataagaaacact
ataagtctaataaagaagatacattcacttaac
>SSO0029 Conserved hypothetical protein
atgatagataacacactcatcacaaagccgagttatgttgcgcatagtatggataaattg
agcgatattatttctaagatgaaagaaaacaagatgtggactgtacccgttatcaaggat
aggaaattaataggtttgatctcttataaagatcttctttctagaagggtgagtctagag
actaaagcgataaacattatgagtcccagtgttactgtacaaattgatgaggatattaat
agattaattgcaaaattctatactactaaggctagagtaataccagtcataaatgagaag
cgggaatttattggtttagtaacaagggagtcattactctcgtatttgctgaaagcaaac
gaaatcccagaaaataggactgcaagagaatacatgacctctccagctacatcaatagac
gaaaacgattctatagccagggcaagatggttaatgataagagataatataagcagactg
ccagcaactaaagagtatagactaactggaatcataagtgcaagagacatagttgatgct
ttgtacagtgtaagtggaaggaaaagagagtcgataatgaaagatgaagaaagggttatg
gcgatgccagttaaagaaattatgaagtacccggttataacggcaaatggaaaagactca
ctgacggatgtagtagagaaactacttaaatttagaatctctggaatgcccgttatggaa
ggcgatagattaagcggtgtaataagcggattagatattattaaggcagtagctgaaaaa
atgcaactatcaatacccattgaagctaaaatacctcaagagctaaaatccaacttagag
tttaaggcaaacatagatgacatacttgaaagatatttaagtaaaatagaaaggttaacc
gaagttataaactttaaggtatcgtttaaggaagaaatgaggagtagtacgggaaataaa
aaactatatactgcaatggtaagggtaactactaaaataggtgattatgtagctagggat
acagattgggaacccgtagttgcgttaaagaatgctgtagaaaaaatagaggaaagaata
ttaagaaaactaagaaaaatagaagagagtaacaaaaaagggattaaggcagaagaggct
>SSO0031 Conserved hypothetical protein
ttgaaaattggagtagtgcaacctttagaagttaagtcagcaattttactagctgaaaaa
gcattaaaggagggagcagagctagtactattaccagaaaaatggacaagaaatatagat
gatgtaccactgcttgaatttcagaaattagctaaaagatacaccgcttatatcttacct
ggagcatttgaagatggagtatcagtaatcactccaataattgatgatagtggaaaccta
aaaggaatagcgaagaaaattcacctatttaatgaagaaagagtgagactcattccaggt
aatgaagcagtcctctttacctatagaggaataaggttcggaatctcaatatgctatgat
atagacttccctgaagtggtcagagaattattttctaaaggagccgagataatattggta
ccctcaaaaataagaagcaatggtttagatatttggaatgaattccttaggataagagtc
ttggaaaataggataggaatagtaaacgcaaacgtatacaatccaccagatttccctgga
agaagtgtggctatcgttccggaacagagacaagatggtattgttatacctaaagtagta
ggagaattaggaagtgaagaaagttatatgatagttgatatagacccgttaaaatacatg
tatctacgaggagatagattaaaagagtacgtcaaatttacagttaaggaatta
>SSO0032 Hypothetical protein
ttgatgatggattcacttaaacttctatcaaaatacgataatcttacaaaaattttagaa
ttaacgaaagaatatgcaagcaagttaagtttagtttttgctattcatgcatattttgaa
aatgagataatttctaacgtagtgaagagtctggagtctaaagtcaagaatatatacgaa
gattacaaatttgatagaaccctatttgtaaagaatgcgtcaaaaactttaggcattaag
gaagacgatttcgcatattatccatattatgcaattccaattagtaaagagacgaaggtt
aaatttatcgataattctactatacctcctaaggctttaataatgaagggagtcgtaagg
tttacttttatggcatataggagttttcaagagttagaggatcatgtagcctcaagagaa
gaggaagatattgttatagaattcgaaaacggtaaaattaagtcgcataacaggaaaagg
aatatatttactgatgcaaatgtcgttagtaaaataatatcatctaataaggaggtttta
ttaaatttaacattaccaagtagttattatctaattccttctctagtttctatgaatgtt
ttgccttatgaaaatgaagttttggtaattagggaaggggaaagtcttgattttaggata
attaacggaaaggtttctggtgatagggtagttatgggggatactttgcatcctagattt
aagcttgaactatattacgattataagttcaaaaggattttaaaggaggaaatagcggaa
ggtctagcttataaaattccctta
>SSO0033 Hypothetical protein
atgtttgagaagctctatagtgcaataatttattctgatgaatttaaaaaaatactattg
ggaagaggtgtagatgacttagagatagcttcagcctacatagcgttcctttatgaggat
cttccaataattggtaagaatttatgtgcggcattcttaaggatgggattagatgctgtt
tataacgtaatgccttctggtaaagtctattcacctaggcataaattatatccaatttcg
agatacggaattgatggagtttgtattaattgtgatggaggtaaaataattttaagaatt
agtaacaaaggttatgatccagaagacttactagagtctaagggtctagagagtagaata
ttcgtaagtaaaaattttaagaaaaaaagtatggaaatcatagagaaaatttgggacgtt
aataagataagattaattgctagaaaagaaattctggaaagaatcagtgccggtggtatt
cttcacatgatccga
>SSO0034 (soj) SOJ protein
atgatagtcacagtaataaatcagaaaggaggagtaggcaaaacaacgacttcagtaaat
ttatcttactatttaagcaaggaaaagaagacaggattgctcgatttggacccggaagga
ggagcgaccatatcttatggaatgaaaagagaacttaaagagctcccattaggcgaaaaa
agtgtaaatatctttaatgtggaagtgtttccagcacacattggactgttaaagttagaa
ttgaatggagatgtagaagaaattagtaacaaaattaaggaaatagggaaacagttcgat
ttcctcgttatagatactccaccaaatctgggtacgttagcaatatcagcaatgttggtt
gctgacagaatagtttcaccggtaacaccacaacccttagcactagaggcaataaagaat
ctcgactctagattaaagagtatagggaagaacgcttattcttttacaaatttttcaaaa
aaggtagttaagctagataatctatcatcagtaaaattcacagaaattacaataccaccc
tctagattattcattgaagcttctagactaggagttccagcgttaagatatgaggaagtt
agaataaagaaacctaagctagctaactattatcagcaattagcaaaggtgattagtgaa
>SSO0035 Conserved hypothetical protein
atgagtgaattagatttcctattgaagaagaaaagaaaaagtgaggacgaagagaaaatc
attaataataacgagaatgcaaaaaaagaggaaattacaaatgaagaggaaaaaattaag
aacgatatgttgaagtatattgagaaagatccaaaaataggtgtatggagttatcccgca
tttttagttcttcaatacctctatcatacagttccgggatttaaaatgagtagaacagcc
aaggaagcgttagaaaagggattgaaagaaatgtaccctacactatttaccattgcagaa
aaaattgcaaaagagagatttaaagag
>SSO0036 Hypothetical protein
gtgattagaatggacatatgtgtaaaggctagaaacgatgaagaagctacaagggctcta
caattaaattacaattgtgttgtgtacagtagacctttaaataatatattaacatttata
ccagatcaatatatatctgatataaatattaataatgaacgtaccgttgtaatcacagat
agtttagaattaattaatacactaaaaagtagaaatctcaaaattgcgtatagagttaat
aagccttatatgaatattttgatatatgattattttgtactagagtttataccaaaaaat
attagagatctgagattctacaaaggtaaagtttatatagataatatcgataatttagat
atatatagtaaattggaaaacttaaagatatcaggagtattcaccaataacttagatttt
atagtaaatctcaaaaaattaggattatataaaaataggattata
>SSO0037 Hypothetical protein
atgaaaaagggaatatcatcaatcctaggtgcaattatattaatacaaatagtagtatcc
tctgtgggattaattctttacttaacttcattaaacgctaaaatgtctaacatagcatac
tcacaaatatatgaagaacttcaaaacgcacctatatctgtaattcccacttaccaagga
ccaatgataatctcaaccagctcatctcacatggcaataacatatataatatatcctaat
gggaaaataattcacacaaacattccactaacacagaacggagtatatataaatttcgat
aataatccttggagcgtaatagtacttaatgatggaaattggtataacatctctgcaaat
gatagactagtaagtcctaatactacagcactaggagggattagattatatgaaccatac
agttacacaataaatcaagggaaaattaacttaagctatctagctaccccacctatatat
ggtaaaaatctagatcctgcaaattggaacctattatcagaaagtccagcttcatataca
ccttatggaattcaaaattcactaatacttattccagaaaatggttcaattccaattata
gcaaatttgtcctctggattgcaatactttgatatagcaatcccttataataatcgtgtt
tttgtaggtgtagcagctggggctacacccggaatatggtatactacgaactcaccccaa
ttctcctattatctgcccttagagtttagtgtgtcataccaagcggattacatagtacca
gtttataacgcaacgtttgaatattccacgtggatagatggtgccagatattatgtaact
ctaagttacgtgacatataatatgatatacttcatgaaacaaaataattatacaataaaa
actcgaaatggtgaaatacaactgctaagctataagtttataggctatcttatggcatct
aaaatagactacggctctgttgagtttggtatatggagctttcccactggtacatcaata
actgatataccaattccaggctataacaactatacattatattctggagtaatgataaac
gcttcgtataccgcatttaatgagtctggtgtagttccaccctcagctcttatactacca
ttacaaggaggtaatggatatctgaatagcacaaatataactgaagagagtttagtaaat
gttgaaatgatgataagtggtggcaacttagactataattctaacggtaccccgatacct
aatgtcatgaattatacttacttctggtatttcataaatcctcaaataaaaaaatccaat
agcgttaacctacttatctccattacacctaattcacaagtaactgtagctctaagagat
agtggagggtttatatatccagactattcttatattgcgtactctttagccgaaaaatac
tcagttacacacaattatgtgggattaaacggagggcctccacttaccgtgattatagac
gacgtgtctggaacattaattaatggcagtaatcaaggatatttaccattaggttatccg
gtagtaaacgctaattataaatatacgataatcccaggtgactatgtacaatacactgag
actgctacatatcaatacttcaaaactattaacttacaaatcaactataatttaccattt
ataataatagtcccagaggatgtctactatccttactttgctgtg
>SSO0038 Conserved hypothetical protein
gtgatctcaaagtttagctttcaaaggcttaagaagggcgccctaaaatacttggtatta
gagtccttaaatgagaggccaatgagaacgtatgaaatcatcaagactatagagaagaaa
ttcgaaggttcttatagacctagcacagggtcagtatacccagttctaaaaagccttgta
gaaaaaaacttagtagaagtgaaagtcgaaaataataagaaaatttacattataacagag
aaggggaaaaatgagctgcaggaaatcaagaataaatcacttaaacttctaggtgataat
acgaaattctcaagacaaatattacaagaattattacaaatcgcattttacttatatgat
aatagatcaaaaatagatgaaaataatatacaaaagatcatagaatacttaaggaattgt
agaaaccaattaaagaatgtcttg
>SSO0039 Conserved hypothetical protein
atgcaagatgaaagtgaaagagaatatgttttaaaaagacttaaggaggcagtagatatt
tttgtatctaatgaaagggcttatctacttattccagaagttagaactaatattggatat
gcagtatctaatgcagccgatgctaatgatgttgcagcaattccaggcaggttaactaca
gcatttaaaaaagtaatatactgtatgctgccagcgtttggagcatctgatcatgtggca
agggtgattttaactgtaatgaagcatgatagaaatataagaagtgcaataaacttaaag
tattatagagaagttattgagaaattaccgtctcaagatctttgtatattcgataggtct
tcggagcctaaagaggtaaaatatagggagcatagtactatgaactttatggttgattcg
tgtattcgtaagttgtctaaggttcctaattatattgtggatttaggtgattatggtaaa
gagccttcactcttcattctagatcgagatccagtcactgttgtaaataaatctctagaa
ttactcaaatatatttcacaagacattctt
>SSO0040 First ORF in transposon ISC1078
atgccgaaatccagaatgcacggtataaggctcaacaagaaacaagaggaagagaggagg
attaacgctgtaaaagatgtgaggaacgggatgagtataaaggacgttgccaagaagtat
gacgtctccatctttaccgtgtacaagtggttgaggaaaggtgacctgagcgctaagccg
aggaagggacccacgaaactgaaggacgaggaaaagctcgtccgaatcttagaaaagagc
ccaagagatttcggcttgaactacgatttctggaccttgaagctcatagcgtatatactt
gacaaggaatttgggataaagtacaacccgaggagtttaagcccagtcctcaagaaatta
ggcttcaagtacaagaaaggaaagagaacttacgttagagacgataacgctgtagaaagg
tgggtgaaggaacaaggggagaagcttttaaaaaaa
>SSO0041 Second ORF in transposon ISC1078
gtgggtgaaggaacaaggggagaagcttttaaaaaaataagagaagggtacaaggtacac
atcttcgatgagtcgtacgtgtcctacataaacaagggtaaaggctggatgaaggtcgga
ggagggataaaggtcaaccctaagaggaagaggtttgcagtagtaggcgggataacgatt
agtaaagagggaataactttctcctattcgacatacaagaagccctcgctgaactcaaaa
gatattatactctacttgaggaaggtaataaaggacgagaagaccgtgatagtgatggat
aatgctagaatacacggtaatgaagtgagggaattccttgaggaaaatggggtggagttt
gtttatctgccgccttactctccggataagagtccggcggaggggccgtgggcagtcctc
aagaaaaggctctactcgaagatttacacggacttcgagaccttaatgtgggatgcaacg
aggttcctacgctccatatccaagagagtaaatgaccttacgtatagtgtgaagaggtgc
ggtgaaccttggacgtcaatactgagtgaagttttcttgccctttaaagtc
>SSO0042 Second ORF in transposon ISC1234
gtgggcaggttgtacggggtgaggaagaagttgttggagatttccttcaagcttgaggag
aagtgcctacccagttacctccctgcgagcgcgcatctcgtggacttcatggcgtggcta
gtggactccttcctactggacttacctcctgggaagaggagcgtggagacctttcgggag
aaggcggagctggagaggagggaaggtaacttggagagggccgggaagctgctctccctg
gggagaaccaagaggaggttcgagggaaggtggaccaagaagagaggggtctcgcactac
gggcttaaggccgtggccgtgatctccgtctccctcttcatgaggtccatcacggtgaag
ccagccaacttctcggacaagaggttcaagtcaccgctcaaggggattaagatcgcggac
aggggattctctccctccccgacacagctcatagcgcgggagaagcccttcactaccctg
agggcccacgtggagttcttcggcacctacctgaacgcgttctggaggccctacgggacc
acgacctggaggaacgacgtcttccttcacgtcctgggagtgatctacaacatcaagata
ttcctcgcgatccaacggaggactcctccagaacgtagagccgttcagctc
>SSO0043 First ORF in transposon ISC1234
atgggagtagagggtagtaccatggcaagaacattaagacacataccaaacttgatgtac
taccctcttcccccaatagaggatatgccgtggagggaaaaatggttaacggagatcaag
cccgtgctggacgccatggatttggagagggttctgggcgagggcgcgctggtttacctg
aagttgttaatcgtcatggtgctctactcctgctcctatagggacgcggtgaaaatggtc
aacgtgaacgtggtcgtggcctggttcgtggggaggaaggtggggaagagcactactgtt
tccagaaatttgttatactttataattcat
>SSO0044 (doxB) Heme bearing subunit I of the terminal oxidase
ttgagtgatatgggattaaaagatgttattgtagatattttccaacttgacaaagattgg
actacaagaattgttatgggaatgttagttttaggtgtaatatggggcttattaggtgtt
attgattcattaatggttagattagttgaggcttcgtggggactttcggctgtcttacct
ttaactcctcaagaatatttcgctggtataacattacatgctgaaagggacttattcggt
tttgctcaacaagttatttacgcaatatttatatattttacaataaagcttctaaacata
gaacctagagccaagtggatgcttaatctcggctttattgcagttaatatttcaatgatg
tttatggagggaccaattttaattataccagcagcgggttttgataactacttctccgct
acaatatggtattatctctcaccactaggaataccgggttattctcaatatgttgtcagc
ccattatttttctggggctggatattactggatgctttcacttatattggtggtttctgg
atagtatatcattactacttagctagtaaaaatatgaaagaaaaacttccagttcctctt
gtttacttcttaatggtcaccttaatgttcatgatagggtattccggtgttacagctgct
gatgtatgggatgttttagcgttctatcacatagtaggattagatccaatagcaaatcag
atagcgttctggatatttggccatgcgatagtttacatggcttgggtccctgcagtaggt
gcattatatctactaataccaatgttagctaacaaaccattatatagtgacagaatggga
agaatatctgcactattatacttaatattctctaacaatgttcctatccatcacttatac
atggtcaatcttcccatagcattaaagttactccaagaagttctaacatattccgtagta
ataccttccatgatgacattctttaacttgtgggcaaccgcaaagggagctgatgtaaag
tggaatattataaccgcctggactgttacctcattcgctggggcaatagcagctggtgtt
actggtatatctaacgcaactataagctttgacgcaatagttcataacacggattgggtt
gttggacactttcatgcaatgatactattctccatagtgcctgcggcatgggcagtatta
tacattatgataactatgatgagtggaaggatatggttctctaagggaatggcatggtta
cattatattggttatatgataggcactacatttctaatcgtgggatttgaactaatagga
ttctacggcgtagttaggagggctgagatttatcctagagtacctgggctaattgatgct
gaagtaatagcaactgttggtgcaattatagccgatttagctactttagtatggttctta
aatctagtattaactttagttaaagggagactagtaaggctagagggactatcattgcct
caagttgctggtgcagtagcaatgagtttagaatggccatcttcaatctcgtttactagc
ccagttttgaagtttataaaaactcacaatactagcaaaaaaggtctagcgtcaactata
gtattagcaattgttggtgcaatacttatcgtagttagtgctgttccgttggcttttgca
ggtgatgcttacactccacaaacttggatttggattactattcttacaatcggaattatt
ttttcagctattggttctcttaaaggtatgaagtctatt
>SSO0045 (doxC) Terminal oxidase, subunit
gtgattaaagtggataggaaagaaaaatttgaactttattgggttatatatgtaattgta
ctattcgcaatagtaataggtgcgactgcacctgcagtatataccgtaggaggcgatttg
tcctctgtccaagctgggattataattccaaacaccgccgttaatgagggaaaggtcata
caaggtacattatatgcttatcagtattatttcgccataaaagaaaatggagggagtatt
acttctaacgagctaggaagtccgtattattataacataatggtagcacatcccggccaa
tatattaacttaactatgtatgctgcaccacacatggctactgctaatttctactaccca
gattacgctacacacgtcgatgatgttcagatagttcctggtctagttcagtatgcacca
gtagtggttcctaatattagcggtgcttttgcctttctaaacggtgagtataatggtcct
tggtttagttatcaagaaggattattattagtactaccctatcaaggatatatgagccaa
actgacgttagtaagtacattacgcaaacccatttggcccaaacaagtactctggttggc
gatccgtataatccccctattgtagtttataataccacaatgactccaacagttgatctt
gttgcggatcaatatgcaatatttaataattctgttcccggtccaacagcagtagtgcta
gctaactccaatgtgaccgtaaacatgtatattccaactcctaatagtgatcataacttc
ctgtacaactattccaccagtggtaccccctatccagtgagaaatgtttacataggcatt
tacgcagtgtggtggaatggtagtataacattagtaaagcaagttcccataccatatgat
aagacgataactttcacttttacagccaatgcgccggcttatctatatggtttaatcact
ccagtttactataattataatttcatgaatatgtctaatactctaaccggagaacaatac
ggatatgtaatgggattatggggtacaattttggttgaacaaggg
>SSO0046 Conserved hypothetical protein
atgttagtagattcccatgctcatattgatgtaaaggaatttgacatggatagggaattc
gtaataaatgaatgccaaatattaatagtgaatgctggtgtcgatttccaaagtaattta
catacactggagctagctaaaaaatataagaatattattccagcaataggttttcatcca
gaatttgtaaaggataaggttaatgagattgataagtgtttggaattaactaggtatggg
aagataataagtgaagtcggtttagattacttttggataaaagacgaggatcttaggaaa
aaacaaatagaagttctggagaaatttttgcaaatagccgaaaaagaaaacaaaccagta
ataatccatataagaggaggaatgaaagatttcttggaaataattaactcctataggatt
agatttgtgatacacagttttgaaggaagcgttaagatagccaataaggtaattgagtac
ggcggattaatatcaattcctccaataatagtaagggataaggttagacaaaaagttgct
aaggaaattcctttagatttcatccttacagagactgattcaccgtttatgggtcctgaa
aaaatgagtagaaataaaccatgtaacgtgaaaattgttgttaagcaaattagtctatta
aaaaggattgaagaaatagaaattgaggagaaaatatacaagaattttgtctctttattt
actagtagtcttacaacaagc
>SSO0048 Transcriptional regulator, putative
atgtctgaaacccaattaagtgagggcacaagaataaagttaccatctggaaaggatgct
ggtctagtagatattttgtcattttgctacggtctatcagaaactgatgttacagtacta
cttgcactaatgaaaggcgatgccagaggtactgaagaattagaaagtgatcttaagctt
tctaaggcttcgatcaatagaagtctaaataagctacttgaaatgggattagtaatgagg
ataaaggagccaggtaataaggctggaagaccaaggtatttgtacaaggcaagggattac
gctgagcttaaaggtaagatgcttagcgatataaaggattgcgcagataagatggcacaa
ctagttgaaaaggaattcaagccattg
>SSO0049 Conserved hypothetical protein
atgttttggcataggagaagagggttaaagtggcttatattatacgtcttatctaagggt
ccaatgacaggtgctcaaattatggatgagatagagaagacaagtcatggtatgtggaga
ccatctccgggttctatctatcctgcattagacgctctggaatctgagggtttaataagg
attagcagagtcgatggatggaaaaaatattatgagttaacagaagagggtagaaaagct
ataggagctatgtcagaggaggataaaatcaaagaagcaatagaacaattggagttctcc
gctagatacatagtcgagaatctagagaaattaaatgacgaagataagcgaaaagtgaaa
aatatattggacgaattaagtaaagttatgcga
>SSO0050 (paaF-1) Enoyl CoA hydratase (EC: 4.2.1.17)
atgcctattgaagtttatgagtatgacaaatacattttattgaaattttatcaagctgat
aatagatacaatctatttaatgttgagtttatgacacagatgatagatgttttatcggca
atcaatgagaacaagggaaaaagatttctcgtcattagaggagaagataactttggtgca
ggtgcagatataagagaattaattaaagcctctaatgatagtgaatttgcagttacattc
tttacctatatgagggaagtatttcataagatgcttgatttaaataaaatagttatttct
caagtgaaaaaaatagcctatggagcttctatggaattattgttattctcagattacgtg
atatcagaaaaaaaggcaatgtttgcaacaccgggtgtgaaaataggcgtatttccccca
gttctctcatcagttggccattttatattaggctataataacgttaagagaattgcaatg
aaaggtgatgttattgatacaaatgaggctaaatctattggcctagtacatattattgac
gacgacttagacaaggcaactttagatttaatagaagaactatcgacccttgcgccttct
gcaacattgtatataaaaagaaatatgttgaggacatttagaaattatattgataaagcc
tttgatgatcttattgtacaaatccagagtgaggaggcaagagaggggctgttaagcttt
cttaataagactaatcctccttggatt
>SSO0051 Conserved hypothetical protein
gtgagaacaatgaataggatattactaactgtttctgcattagttaaggataatttaaga
aatagatttgtaatcttctggattatcgtctttcctattatcataacactactatttggt
cttgtatttggaggatttagtagctattttcacgttactgtcgctgtagaaggaaattat
ggtctagcaaagtatctgaattctacagaaatattccaaggagtaactaacgtaagtcta
aaatacgcagctgaacatgactatatttacgttatatcgaatgggtctagctttacaata
tatactagcaagcaaaatcaggagttcgtaccagtattggaatcggtcattgagcagtac
tatcaaaaggtaaataacacatacgattttacagttttacagatatcaaattatacttat
tataattacttaatatccggaataataggaataatctcactctctaatggaatacttagt
acgataggagtttctgctagttattttagggatagaataatcgaaagattagctacatcg
ccgttaaagagttatgaatgggtgatctcgctaataatctacgtgataattataacatta
atttccacaactgcagtaataattttaggaattctatttggttttataccaataataggc
atagaatttcttggatttttagtaattgcaactttactgtttggcggtctaggagctata
atctacggattgacaccaaaggataaaatatttctttcggagatagtggctaatgttcta
gtatttccgctgatgttcttaagtaatgcgttctttcctcctaacgtatatccgccaata
gtaagaatattcgttgaatatcaaccattatctgtaatcataacaattataagagatctg
atagtatatggtatatcacctaatcccatactggtctctatagtcttcctctttactata
gtcttcctttatgcgggagggcgacttttaaggttaagggaaattagc
>SSO0052 (hypE) Hydrogenase expression/formation protein
ttgtattctttatataagtccttaacctcaactataacattagtcatatatgctaattat
ttcataatagttaatgtgaatttcggtaaagttcctatcaataaatttatttataattta
ccaataggggactgtctcacttgcccatccataggtgaggacgctgcagttcttgaggct
aaagacaaatatttgatagtacattcagatccaattacggaggctaagagtgacagtggc
tttctttcaattgcggttgcatgtaacgatataaatatgaaaggggctcaatgcagatgg
gtaaatagtatcattttactttcagatatttcacacttaaatgctacaatttctgcaata
tcagaagcgtgtaacttaataggctgtaaagttgtaggtggccatacagaggtctcggat
aaagttaaacaagacattataattactactgcaattggtgtttctaataagttcttgagt
tataagaatgtaaaagagggcatgaaagttgtactggtcggcagtcctggaatagaagga
acgtggatcttggctaaagattatgaccagttgttgttagaaaaaggtataagcagggag
attatcgaaaaggcaaaggagtttaagaaggatatagtagttcaaccgaaggctttaagt
attttagattacgtggttgcaatgcacgatgctactgaaggaggaataatgcaagcgatg
cttgaggtcgcaaaagccagtggttatactgtttcgattaatttagataagattgtgttg
agacgtgagacgaaaattataactaaagcgttaaacattgatcctttaagattaatctct
tctgggtcttttatcgcagtatctaacactccggaaaagattcttgagaggataagtgag
gcatatataataggtgagataaaaagaggagatccggttttagagattaaaggtgttgga
acatttaatcaagatttcgaggaggaattggtcaagtttgaaagtaattatcttggctgg
gggaagggg
>SSO0053 ABC transporter, ATP binding protein
atgactaatgttatagttgaggttaaggacttatataaagaatacaaggataaagaagta
ttaagggggatctcgtttacagtttataaaggcgaaatattttcattgctcgggccaaat
ggagcagggaagacaacaactgtgaaaatactctcttgtgtgctaaagccaactagggga
gaggttaaggtaatcggatataaggtaccgaatgagtgtggaaagattagagaaaggatt
ggggtaatgccacaagactatcaaggatttttagatttgactgtaagggagaatatagag
tattttgtcaaattatataatgggaaggaaacgcaagttgatgaattaatttcattatta
gatttagaaaaggtaaaaaatcagaaactaagatatttatctgggggttatgtacgaaga
gtaggaattgcatctgcatttgcaggaagccaagaaattttatttttggatgaaccaact
gtgggtctagatcctaaggctagaagaggattttgggaaattataaagatgatgaaaaat
aagggagtaacaatcttcctaacaacgcattatctagatgaagcgcaaaagctatcggat
agagttgcgatactatatggaggcaaattaataaaagtctcaacagcagacgaaataatg
gcagaatttaaggctactaatttagaagacgcttatctagaattaattaagtctttagaa
gatagtgagaacaatgaa
>SSO0054 Conserved hypothetical protein
gtgttggaacatttaatcaagatttcgaggaggaattggtcaagtttgaaagtaattatc
ttggctgggggaaggggtaaaagaataacgctatttaaaccgttcttagtagtttgcggt
aaaccgctaatttcatgggcttttgacgcggtaaataagttatctgacaaggtatattta
ggcattaaccaatcccatccgttgttcacaatatttaagcattccattttcaaaatattt
cctactccagatatttcttatgaaaacgatgtcaaatacgtggttgagagtttagggcca
ccaatcttagttttgcctgttgatattgcatttattaacaataatattataaataatttg
attgagagatgtgctgtcgatatgtgtactctcaaaagttatggtagctatctcggtgtc
acatattggaccggactaaatttttcaaattatactgatattgaagtaaaggagaagcta
tataacataaatacttgggaagattatattaaagccaataaggagtgtaatatactt
>SSO0055 Hypothetical protein
ttgaaaagaataatcatcctttcgccttttagagggctttttagatctctattatatttt
ttgttaggcctcattatggcgttaatatcagcaggatatttttcccaacttttttcgata
gttggaataaatagagatattgcaataattatttcaataactatttcatttctaagtcta
ttcagtagcccttttaacttggttttaacagaagtgaaaaaggaggctattgcaattgag
gaagatgttgtatttttctttggttttcccatatttataccgcgtatatcaagacaaaat
atgaacacattaattgctgtaaatctaggcggagctcttatcccattgggagtttcctta
tttttaatgtatgaattgcaagcttatattgtatattttataataaatataatagtagta
attattgtgtcaaaactcttttctagggtaattagaggtgttggagttataatgcatccc
ataatacctagcatattttcagtaataagcagttatgttcttttctataagcttcatatt
ctcatacccttatctgcgtatattggaagcgtactagggacgttaataggtgctgattta
cttaacttgagaagaattattaatgaggccagaccacaagttataagtataggtgggatg
ggtacatttgatggtatattcgtatctggtatcatatccgtatttataagtgaacttcta
gttattatt
>SSO0057 Hypothetical protein
atgacaaaggatatcgtaaaaaagcttgttattaattcgatgaaaagagtgaagattggt
atattttaccttgagaacgatatgatagaagaggctcgtaaagaaatccaaaaatcttgg
aggcaaataatgtcagcactcttgatactaaacttgtataatgcggaggaaaaacaattc
acacactataacgttcctagatcaaagatttttagtgtatcgaagtcgttagaagataaa
ggttatagagaccttattaaaatctcctcaatgtacttttcatcactacaagaattacca
aaaagtgagataaagattcttataaccgtgtttattaaagaagaaatagaacacattaag
gaatggtttaaggcaatatgggatgagaaattagatgacgaattaaacgagataaaaaaa
gaaaagcaatggctaatacaatcc
>SSO0060 (gnptA) UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase (EC: 2.7.8.15)
atgagaatacttgcaatactactcccaattttaatttcctttttcataagctatattaca
acggtctgggtaataagacaagctaaaaagagtagattcgtaggtaaggatataaataaa
ccagataagccagaaataccattattgggtgggataggtataatagctggatttatagcc
ggatctttctccttattattaactgatgtaaggagtgaaagagttattcccgccgtaata
ctctcctcactacttatagcgtttcttggactattggacgatatatttaacgttagacaa
tcagtaagggctttcttgccaattttcgcatcagttccactaatagtttacagtgtcggg
cattccataatatcaattccgtttttaggaccaataaatttcggaatattctattatatt
ataataataccatttgcgctaactataacatctaacgcctttaatatgttagaaggtcta
aacggattaggtgtaggtatgggaataataatgctatccgcactggcttatatagggcta
acgcacaccggtcccacatatcaagctggcttaatagcgctttcagcaattttttcacta
tcggcatttctcatatttaataaatatcctgcgaaaatatttccaggaaatgttggtaca
tacttcataggagcattgataggagctataggaattgccggcttcatgtacacggcatta
gcaattctctacataccatacgtcgtggaatttatattgaagctaagaactaacttcaag
ggagtatcatttggcaaagtagactctagcggtagattatattgggatgaaaaacctcat
tcattaacacatatagtaatgaaaatgggtcgatttaaggagtatcaagtagttataatt
ttatggggaatggaggcaatatttgcagtaatagcagtaattctacaaactacaacaata
gtaata
>SSO0061 (gdS-1) Geranylgeranyl pyrophosphate synthetase (EC: 2.5.1.1/2.5.1.10/2.5.1.29)
atgagtagtgatgatctaagtttatattttaacgagatagttaacaatgtaaattttcgg
ataaaaaattttgtaaagagcaattttaagacgcttgaggaagcatcatttcatttattt
acagcaggaggtaaaagacttagaccattagtgttggtttcatcttcagacttaattggc
ggggacagagaaagggcatacaaggcagctgcagccgtagaaattcttcacaattttact
ctagtccacgatgatattatggacaacgatggtctgagaagaggattaccaactgttcat
gtaaagtggggtgaaccaatggcaatacttgcgggggattacttacacgcaaaggctttt
gaagccttaaatgaggcactaaagggtcttgacggcaatactttttataaggcattttct
atatttatcacttctattgagataatatctgaaggtcaagcaatggatatgtcatttgag
aacagacttgacgtaactgaggaagagtatatacaaatgataaaaggaaagaccgcgatg
ctgttttcatgctctgcagcgttaggtggtataattaataaggctaatgatgatgtggtt
aaaaaattaaccgaatatggattaaatttgggtatatcgttccaaatagtagatgatatc
ctaggaattattggagatgaaaaggaactagggaaaccgatttatagtgatattagggaa
ggtaagaagacaattctagttataaaaactttaagtgaagctactgaagatgagaagaaa
attctggtttcaacacttggtaacaaggaagctaaaaaagaagatctagaaagagcctcg
gaaataataagaaaacattcattacaatatgcatacgatttagctaaaaaatactcggat
cttgcaatagaaaacttacgtgaaattcctgtttctaataaaactgctgaaaaggcttta
aagtatctagcacagtttaccattcaaaggagaaag
>SSO0063 FMN-dependent dehydrogenase, conserved hypothetical
atgcctgatatagtaaataggaaagttgaacatgtagaaattgcagcttttgaaaacgtt
gacggtctatcttcgtcaacgttcttaaatgatgtaattttagttcatcaaggatttccc
ggtatatcgttcagtgagataaataccaagacaaagttttttagaaaagagataagtgcg
ccaataatggtaactgggatgacgggtggaaggaacgaactaggaagaataaataggatt
atagcagaggttgctgagaaattcggaatacccatgggggtaggcagtcaaagagttgca
atagaaaaggcagaggctagggaaagttttacaatagtcagaaaagttgctcctacgata
cctattattgctaacttggggatgccacaattagttaagggatatggattaaaggaattt
caagatgctatacaaatgatagaggctgatgcaatagccgttcacttgaatccagctcaa
gaagtatttcaaccagaaggcgaaccagagtatcagatttatgctttagagagactgagg
gatatatctaaggagctatctgtaccaattatagtaaaagaaagtggaaatggtatttcc
atggaaactgcaaagcttctttatagttatggtataaagaattttgatacttctgggcaa
ggcggtactaattggatagcgatagagatgataagggatattagaaggggaaattggaag
gcagaaagcgcaaaaaacttccttgactggggtgtgccgacggcggcttcgataattgag
gtaagatattcaattcctgatgctttcctagtgggtagtggtggtattaggagtgggtta
gatgcagctaaggctatagcgctaggggctgatattgctggtatggctttaccggtactt
aaaagtgcaatagaaggtaaagaaagtttagaacagttctttaggaagataatatttgaa
ttgaaggcaaccatgatgcttactggttctaaaaacgttgaggcactaaagaggagtagt
attgtaattttgggtaaacttaaagagtgggctgaatatagggggataaatttatctata
tacgagaaagttagaaagagagaa
>SSO0064 Conserved hypothetical protein
ttggaaatggatatgggatctgaattgggttacgattatagagttctcaaattaggggga
agcttaataacatgtaaagacgttcctaggtgtgttaaattagaagtgctaagaagagtt
tcagaggagattaggaaatttgttaatgagaaccctgacaaaaagattatactattgcat
ggtggtggtagttttggtcattatgaggcgtcaatattcgatgataataggattgtgagg
acttctgaagctatgcaagagttaaattacatagtggctaaacatcttttaaaaagtggt
attaaggctattagcgttcccggaaagttctacacgtttgatgctgtattgagcgcacta
gagaaggaccttgtacctttgatatacggtgatgtcaaatttgatggatcaataatttct
gcagatgatatgagtatagacattgcgaagaggcttaatgctagattacttttcgcaatt
gataaggcgggaattataggaagaggtggaggagtcataagcgagctaaggggaatagat
gaggtcagtatattaatgcaaacgaattattatgatatcactggtggaatactctctaag
ataaaaaagatatttgaaaacaatttaaacgctttgatttttgatggtagcaaaactgga
aatatatatttagcattaaggggatataatataggtactttagtaagaggtaatccgaat
gcc
>SSO0065 Hypothetical protein
atgcaacttctggtgatacttcgggacctaaagattcagttgtgggttatcttgcagcgc
ggtttggaagttaaagttccgtttctgggaatccctcttaaaggagtaaataatcctatt
ctagtgcttgatggaattatagaaccattaaacatttttgtaaatactgaggcgatcaga
cagttcataatgcaattcaatgaggcagtaggttttgagtgtattaaagaggaggtttat
tgggattcgtcgattcctttctcttcatactatatttacattactgataagctagcaaat
gacgctataaggcgatgtggaattccaattagtgaagatgagagatttgaaatacttcac
ctagtggatgaagcgatatttcctccaaacttcttggttaaagcacttagaacctcactg
caacttaactctcctattctatttagagatggtgaggaaccaattacggttcagttggaa
ccaattagaataaaaataatttcctcatatccttttgataataatcctaaatatttagat
aactcactagttcatctagctggcattattccggttgaatatattgagagtaaatcaaga
aatttaatagaagttgaaaatggactatggagcgccatatattcattaccatatttgcaa
ataaataattggaaatggatatgggatctgaattgggttacgattatagagttctcaaat
>SSO0066 Conserved hypothetical protein
atgaggagattaccagctgttgcaggttctttttatgaatcagatcctaaaaaacttaaa
atgcagattgaatggtcattcagacacaatataggtcccagagatattcctaaacaatct
tacgagaagaagaaaagagataatttattttttatcgtaccacatgctggatatatttat
agtggtccagttgcagctcactcatattattatttagcttcagaaggtaagccagacgtt
gtgataatattaggtcctaatcatactggtttaggttcttatgtttcagcttggcctaag
ggagaatgggaaactccattaggtagcgtaaaagtagatgaagaggttcttatgcaatta
gttatggaatctgaagtaatagatctggaagaaaagtcacacttatacgaacattcaatt
gaggttcaattaccttttttgcaatacttttttgatgataactttaagatagttccaatt
gttattatgatgcaaacgccagagattgctgaattcctagcagatgctatttataaggtt
atacaaaagtattcggataaggatatagtggtattggctagtagtgatatgaatcactat
gacccccatgaaattacaatgaaaaaggacgaggaagcaatagaaaaaattcagcaatta
gattatagaggtttatatgaggttgtagaaggcaaggatgttactttatgcggttatggt
cctataatggttagtctaattctagctaagaagttaggtaaaaaagcctatattttaaaa
catgcaacttctggtgatacttcgggacctaaagattcagttgtgggttatcttgcagcg
cggtttggaagt
>SSO0067 (rps2AB) SSU ribosomal protein S2AB
ttgaaggtgaccaatttgagtgaaaaagaagaaagaggaggagaattaactgaagcagaa
aaagaggaattaagaaaatccgaaaaaggtgcaataatagaattactagtcccagtagac
acatatctttcagctggagttcatataggcactcatagttgtactaaatacatggagagt
tttgtgtatagagtgcgagcagaaggattatatgtattggatgttagaaagatagatgaa
agattaagaattgcggccaagttcttatcgaggtatgatccacaagacataattgtggta
gcaagtagaccctatgcatataggccagttcaaaagtttgcagaagttgtaggatctaga
gcgctagtaggtagaataataccgggaacgtttacaaacccctacttgtcaacatatata
gagccgaaagtattgttagtttccgatcctagaactgatactcaagcaataaaagaagca
gctaaagtaggaataccaattgtcgcttttgctgataccgatgctaaaattgattatatc
gatctcataataccagctaataataaaggcagaaaatcgttggcgttattatattgggca
ttagcaaggcagatactcagagaaagaagagtaattcctccagatggtgatttggcagta
ccagtaagtgagttcgagatgaggcttgttcaa
>SSO0068 (rps9AB) SSU ribosomal protein S9AB
gtggagtggatgagtgaagaacagaaattagttatttccagtgctaggagaaagacagct
agagctacatgttatatatatgctggaaaaggaagagtcttcgtaaataacgtaccaatt
gagttaataccaattgaaatggtaagattgaaaatcatggaaccattacttttagctggg
aatgatattagatcaaaaatagatgctaaaataataacttatggtggtgggataatgggt
caagctgatgctgctaggatggctttagctagggcgttggttaaatttactggtagtaag
gaattagagaagatatatagggcttatgataggacaatgttagctggagatccaaggcag
acggaatcagagaagtggatgagatatagtgcaaggagatggaggcagaagtcgtatagg
>SSO0069 (rpl13AB) LSU ribosomal protein L13AB
atgagcacgcaagttcaagagcaagtggtcataattaacgcagaaggtcagatcttaggt
aggatggctagtaacgtagttaggcttttaaaggaaggcaaaaaggtaattatagtaaat
ggggagaaagcggtaataagtggagagaagaacagagttattgagtcttacaaattactt
ttaaccgtaaaaacgctttttaatccttatagaaatgggattagaaggcctagatcacca
ataaatatagtgaaaaggactataagaggaatgctacctaaaagcagtaaaggacgtaga
atgttaaagaacgttaagatatatgttggggtgccaaaagaattcgaggggagacaattt
attaaattcccagactctgatgtgagtagacttaaaggtaagtatgttacagtagaagtg
gtttcaaaagagctagggtggagtgga
>SSO0070 (rpl18E) LSU ribosomal protein L18E
atgaaagtaactggtagtacaaatataactgttagaaagcttatcagaaatttagaaaaa
tccaaaaaaccgttgtggagaaaagtagctgaagagttatcgataccttccagaaaaagg
ccctacataaatctttacaaaataaatgaacacactaaacctaatgacatagttgtagtt
cccggaaaagtgttaggtataggcaagctggatcacgaagtaactgttattgcattggat
ttctcaaaatctgccatagagaaaattagagcttccggtggtcaagctatgagtatatat
aaagctttagaaacctttaaggattttaaaggaagaagtgtgaggttgatgaaacaa
>SSO0071 (rpoD) DNA-directed RNA polymerase, subunit D (EC: 2.7.7.6)
atgtcaatcaacctacttcataaggacgatacgagaatagatctagtttttgagggttat
cctttagaatttgtgaatgcaattaggagagcatcgatgctttatgtgccaattatggct
gtcgacgacgtatattttattgagaataatagtcctttatatgatgagattttagcacat
aggttggctttaataccctttatgtcagaggaagctttagatacatatagatggccagaa
gaatgtatcgaatgtactgaaaattgtgaaaaatgctatactaaaatttacatcgaagcg
gaggcgccgaacgaacctaggatgatatactctaaagatataaagtcggaagacccatca
gtggttccaatatctggggatataccgattgtgttattaggtacaaatcaaaagatatcg
cttgaggctaggttaagattaggatacggaaaagaacacgctaagtttataccagtttct
ttatcagtagttagatattatccgaaagttgagatattagcaaactgtgagaaagcagtt
aatgtttgtccagagggtgtatttgaattaaaggatggtaagctctcagtaaagaatgaa
ctctcctgcaccttatgtgaagagtgtttgagatactgtaatggttcaattagaatttcc
ttcgtagaagataaatatattcttgagatcgagagtgttggatcgcttaagccagagaga
attttattagaggctggtaaaagcattataagaaagattgaagaattagagaagaaactg
gtagaggtggttaaa
>SSO0072 (rps11AB) SSU ribosomal protein S11AB
gtgtcaagcaggcgtgaaatcagatggggaatagctcatatttacgcatcccagaataac
actttgctaacaataagtgatcttactggcgcggagattatctccagagctagtggaggt
atggtagtaaaagctgatcgagaaaaatcatcaccctatgctgcaatgttggctgcaaat
aaagctgctagtgacgcgcttgaaaaaggtataatggcgcttcatattaaggttagggca
ccaggtggatatggaagtaagacacctggaccgggtgcccagcctgcaattagagcatta
gctagagctggattcattataggaaggattgaggatgttacacctatacctcatgatacc
ataaggagacctggcggaagaagaggaagaagagta
>SSO0073 (rps4AB) SSU ribosomal protein S4AB
atgggagatccgaagaaaagtaggaaaaagtgggaaaccccaggacatccttggataaaa
gagagaataggttatgagcaagaactattaggaaaatatggtttaaggaataaaagggaa
atctggatagcgcagtcaataattagaaagttcagacaccaagcaagatcattattagca
ttgccgcctgcagagagagctgttagggaaaagcagctagttgggaaactgttaaagatg
ggcttattaaagaaagaaaccgcaaccgtagatgatattctaagtttaactgagcaagat
ctattagagagaagattacagactatagtgtataagaaaggattgtcaaatacgatatat
caagctaggcagttaataactcatggacatattgcggttaatggcaaaagagttacatct
ccaggatatattgtcaatgtagatgaggaaaatctaatagattattatgttacttcttca
tttaagtcaagaccaccagttatgtctcaacaagaaggaggtgagataggtgtcaagcag
gcg
>SSO0074 (rps13AB) SSU ribosomal protein S13AB
atgagtcaacagtttaagtatgttgttagaattttcgggcaagatgtagatggaactatg
aaattaccttatgccctagcgatggtaaaaggaattggttacaacactgcgaaagcgata
atacgaaaactaggaatggatccaaatgcgagattaggggaactatctgatgctgaagta
aagaaagttgaatctgtaataagcgatcatacaattaaagggttacctagttggttatat
aataggcgtaaagattacgagagtggtttagatttacatttagtgacttctgatttgatc
ttctatgtaagaaatgatatagaaagagagaagaagagtagaagttggagaggagttagg
cattcgttaggcttaaaggttagaggacaaagaactaggactacagggagaactggtatg
actataggtgtggctagaaagaaagcagctcaaccacaatctcaacaatcttcttctcaa
caacaaaaatcctct
>SSO0076 Conserved hypothetical protein
atggcattatattttgcgttaatggatctagagggaatagtaagaagactttatccggac
attgaaaaagcaaaaactaaactaatagaggaaataaggttctataagagtgataggtat
aatgcagaagaaatctctaacgttattttgactgaagttattaattccatgaaggccgat
gataaatttggttttcctaaaactaacataagagctggggaagccggattaggatctaga
ggtataggtgataatttaatacatactaagttatttgagttagctggtaagcaaatcgaa
gaatatgatgatgctggaattagggaaaacgtagtcgtctccatagatggtatccattct
aggctatcttattttccgttcctagccggcttttatgctactagagcaacattgcgggat
attatggttaagggggcatacccattaggtctaattgtggacatacacctttctgatgat
agcgatataggaatgttgatagactttgaagcaggtgtaactactattagtaaagcttta
gatatcccaatactggctggtagcacattaagaataggtggcgatttagttttaggagat
aggataagtggtgctgtaggttcaataggaatattaaagtctaaggatttcttaaggaaa
agagtgaagaaggggctaaaaatactcatgactgaaggaaatggcggtggaactattgca
actacagcaatatataatggtatgcctgatgtaatttcggagacgcttaacataaaagac
ttacttacttgtattatagttagagattatttgtcaagcgacgtttattctatgacagat
gttactaacggagggatacgtgctgatgctctggaggtttcgaagataactaacttaagt
tttgtaatagatgaggagaagtttctttcattaataaatccaaaggttagaaagatgctg
aatgagattaacatagatccttttggtatatcaattgattcaatacttatatttactgat
aatccagatttagttaaaaagaggttggctcaatataatattagaagcgaaattgtaggt
tatatagatgatttcagacaatatcctataattacatatgatgggaaagaacttaagcca
caatttagagaaagtccttatactcctataaagaaatattttgggaattattcaccttat
agcatagaatatatatcaaaccgtttagattatgctatagctgaggctaaaacaaaaatg
gataacgtattgaaaaacttaaaaactagttttaca
>SSO0077 Hypothetical protein
gtgtttatcatgaaattacgggataataatagcttttttagtagtagtggcgtaataaat
atgggacaaaaattgccacctacaaacaaaccttcttttgaaaagttatatgactgtgaa
actgaaagttgtattcaaaaactagtagatgattatatttataatttaataactgacaat
aataatattaataattataccacattcaagttatttaaagatgaggatgataatgaacat
aaattcgttttaaatgaaaaagtgatgttaaatagttacttatttatcaaagtacttcta
aggagaatacttgagacagatctcgattttgaatacgtagttgaggacctcgagaaaaaa
ttgggaaatacacatccagttgttctctttttgaaacaattcaaagatgat
>SSO0078 (tyrS) Tyrosyl-tRNA synthetase (EC: 6.1.1.1)
ttggggaaactgattatgagtatcgatcaaaggttacagcttataatgagaaatacagct
gaagttataactatagatgaattaaggaaaaaattagaatctgatgagaaattaaagggt
tatataggatttgagccaagtggattattccacattggatggctaatctggacacaaaaa
gtgaaagatttagtagaagcaggcattaatatgacattattaagagcagcttggcacgca
tggattaacgataagttgggtggagatatgaacctaataaaaatggctgctgactacgca
gttgaggtaataaagaattacggagtcgacgtaggtaagttgaacatagtagatgctgac
gatatagttaaggagaaagattattgggctcttgtgataaaagtagcgaaaaacgctagt
ttagccagaataaaaagagcactaacaataatgggaagaagggcagaagaggctgaaata
gatgcatcaaaactgatatatccagccatgcaagttagtgacatattttatctggattta
gacatagcactaggaggaacagatcagagaaaagcccacatgttagcaagagatgtagcg
gaaaaaatgggcaagaagaaaatagtatcgatacacacaccacttttagtagggcttcaa
ggaggacagagaatgaacataacagagggaatggaagaagacgatatacaagctgaaata
aaaatgagtaaatcaaagccagaatctgcgatcttcgttaatgatagtagagaagatgtg
gaaagaaaaataatgggtgcatattgtcctaaaggtgttgcagaaaataatccaattctt
caaatattaaagtatatcatatttccgcgttataattttgtaaagattgaaagagatatt
aaatatggtggggacgttgaatttaaggattacgaggaattagaaaggacttatattgaa
ggaaaaatacatccgatggatttaaagaagactactgcgagaaaactaaatgagatatta
gaacctataagaaaaagtttagaaaagaaacccgagttcgaggaaatgattcagaagata
tccaaaagtgtaacaagg
>SSO0079 (dnaG) Bacterial-like DNA primase (EC: 2.7.7.-)
gtgagcttccaaatgaaatatgatataaggttaagatttgaagtagagggtatagtcgaa
aaaactgatgtaataggtgcaatatttggccagactgaaaacttatttggagatgaattc
gacctaagagagttgcaagataagggaagattgggaaggattattgtagaggtaaaaact
aaaggagggaaaagcgaaggagaaataattataccatcgaacttagacagaattgagacc
gcattaattgctgcaatggttgaaagtgtagataaggtaggaccatacaattcaaaattt
gagcttatagaaatagaagacattagagctgagaaacttaaaaaaatcatagaaagagca
aagggaattttgtcaagctggagtaaagagaaatcactggacataaaggaagtaataaat
gagataagtagcgcagtaaaggtaggggaaataacagaatatggaccagaaagattaccc
gcaggcccagacgtggacaaggatcctaatttaataatagtagaaggaagagctgatgta
ataaatctactcagatatggctacaaaaacgtaatagcagtagaaggagccacgtcaagg
ataccggaaacactaattaacttatctaagatgaagaagacagtaatagcgtttttagac
ggagaccacggtggagatctgatactcaaagaattattaagtaataatgtaaagatagat
ttcgtagcaagagcaccgattggcagagaggtagaagaactaacagggaaagaaattgca
aaagccctttccaatatgatgccacttactcaatatctaaagaaggttcaagaggcagaa
caagcaatagctaaaaatgttattgcaaaagaagagaaaccaatacagtctgaaactaca
caacaagtagtccagataactttgccacaaaatatccttgaagaaatcaagaaactccct
ggaactctagagggcgttctctatgataataattggaatttgattgagaaagttcaagta
cgagatataatacctaagttagaggcttacgaagacaataaagtagcttatataatattt
gatggggtaataactcaaagattattagatttagcgtctcaaaaaaacattaaaatgata
ataggagctagaataggtggaataaacaaaagaccgcaaaacgtcgatatattgacattt
accgatattatttcttct
>SSO0081 (dpo3) DNA polymerase III (DNA polymerase B3) (pfu polymerase). (EC: 2.7.7.7)
atgattaaggatttctttatattagatttctcttatgaaatcaagggtaacactccacta
gtttacatttggagcgttgatgatgaaggaaacagtagtgtggttatagataataatttt
agaccatatttttatataatatatgagggcaatgagaatgaaataattgagaatataaaa
aagaattgtgaagctctccaaatcactaaagttaaaaggaaatacttaggtaatattgta
gacgctttacttatacaaacatccacgcctactcaaatcaaaaagtgtagagaaaaaatc
agcgaactaaataatataaaaggcattttcgatgcggatataaggtatactatgagatat
tcactagattttgatcttaggccatttacttggtttagagcggaggtaaatgaagtaaag
tttgatggatttcgcacgaagaaagcatacattttagataagattctttcacattatgag
ggtaatatgccagaattaagaactattggagtcgattttcagatctacagtaaatatggc
tcgttaaatcctagaaaagatccgatagtagttatgagtttatggagcaaggaaggtcct
atgcagtttagtttagatgaaggtatagacgatctcaaaattataaggagattcgttgac
tacatattaaattatgatcctgatataatatttgtatatgattcagatctccttccctgg
aaatatattacagaaagagctagttcattaggagtaaaaatagatataggaaggaaaata
ggttctgaggtaagtgtgggtacttatggacactactcgatttctggaaggcttaatgta
gatttaactggtttactagtaaatgaaaggtcattaggacatgtagatttaatcgacgta
agtaattatttaggtatatctcctagtcgttactcttttaagtggtatgaaatttctaga
tattgggataacgagaagaatagaagaattattagagaatatagtatagaaaacgctaga
tcaatatatttattaggtaactatctactatctacctatagtgaactagttaagatagtt
ggtctacctttagataaattatcagtagctagttggggaaatagaatagagacttcacta
ataaggactgctacaaaatctggggaattaattcctattcgaatggataatcctaaccgt
ccttcaaaaataaaaaagaatataattattcaaccaaaagttggtatctatactgatgtt
tatgttcttgatatatcttcagtttattcattagtgataagaaaatttaatatagctcca
gatactttagtcaaagagcagtgcgatgattgttatagttccccaatttctaattacaaa
tttaagagagaaccgtctggcctttacaagacatttttagatgagttaagtaatgttcga
gattctaacaaaataaaggttattgaagagttaatatcgtcatttaatgattatgttcat
tgggtaaatgcaagatggtattcgagagaaattgccagtgcttttgatgaatttagtaat
gaaataattagattcattatagatctaattaaaagttcaggtttagatgtgattttagct
aatgaccttttaatatttgtgacaggcggatctagagataaagtaaatgagttaataact
aagataaatagcttatataatctagacgttaaggtaaaaatattttacaaatcattattg
gtcttagataataatagatatgcggggctatcggagggagataagatagatattgctaga
aaaggggaagaggatatgaatctttgtgaattagctaggaatataaaaagaaagattata
gaggagatattaattagcaaagacgttaagaaagcgataaagctagttaaatctacggta
atcaagttaaggagaggggaatttgataatgaagaattaataacttgggcgaagatagaa
agagatctcaacgaatataataatcagttaccttttgtaactgctgcgagaaaggccatt
caatctggctatttaatatctaaagattcgaaaataggttatgttattgtaaaaggtctt
ggccctctaaatgaccgcgctgaacctttctttcttgtaaaagagaaaaacagaatagat
attgaatattacgttgatcagatatttagagaaaccctaaagctactcaagcctttagga
gtaaatgaggaaagtttgaaaaaaactaatataactgatatactagacttatttggagct
tctaagaagaaa
>SSO0082 N-terminal acetyltransferase complex ard1 subunit (EC: 2.3.1.128)
atggtaattataactgatgcaacagaggcagatttagatcagatttttcaaatagaaacg
gaaagtttcgaagatccttatccttattcattattaagagcgtatttgtttcttgcaaat
aaactttatttggttgctaaacaaagagagaaagtagttggatatataataggtataatt
caatatggctatagagggcacatagtctcaatagctgtcgaacctatatacagaaaacaa
ggcattggcgccaaacttctaaatgaaattgaggagagattcaagctaaacggagctaga
tattcgtatttagaagtcaatactaataacttatcggcgatttccttttatcgagctaac
ggttatcttataatgtatgtacgtaagaattattatggaagagataagcacgcatttgtg
atggtaaagaatttatattataaatatctggat
>SSO0083 (pelA) Cell division protein pelota homolog
gtgagaatattagaatttgatgagaaacgccaagctgtcaaattacatatagagtcagaa
gacgatttatggcttttacatttaattttggaaaaagatgataaagttgtagcaaaaact
acgagagacgtgggattaggaaaagagagtagaagaatacctatgaccattatccttaaa
gtagattacacggagtttcaagagttcacaaatagattacgaattcatggaataatagaa
gatgcgcctgaaagatttggaataaagggggctcatcatacaattaatttagatatagga
gacgagattatcattataaaacagcaatggaataagtatgtgttagataggcttaagaga
caagctaataagagaagcagaataataattgcgttagtggactttgacgaatatctaatt
gcaataccgtttgaacaagggataaagatcctttcagagaaatcattaagaccattaaat
gaggaagaaggaataatagagcaaaatgcattagagattgcaacggagcttgcagagtac
gtaaagcaatatgatcctgatgctatactattagctggaccaggattctttaaagaagaa
gtaagtaaaaaggtaaatgctattttaaagaataagaagatttacatcgatagcgtatca
tctgctactagagcgggacttcatgaggttctaaagagagatataatagacaagataatg
acagattatgagattgcgattggagctaagaaaatggaaaaagctatggaactcttggct
aagcagccagaactagtaacctatggcttagagcaagtaaagaatgctattgaaatgggt
gctgtagaaactgttttagtgattgaagacctattatcctcagatgaacaagagaggcta
acaatcgaaagaatgcttgaagatatagaaaataagaggggggaggtaatattagtacct
aaagaatcaccaatctattttgaattaaaaaatcttactgggatattagctattcttaga
tttagaataaat
>SSO0084 Conserved hypothetical protein
ttgaccattataggaaatccagagataggactgtatactgggaaattacctaaaggatgt
gaactctgtagattaggagggaaattagtgctctttatcacaggcgaatgtgatgataac
tgttattattgtccagtaagtgatgatagatttggaaaaaataagatatttgcaaatgaa
actgaagtaaataactctatggacgttatatatgaggcgtataggatgaaagctttaggt
gcaggaataactggcggtgatcctattctcgaaataggtagagtaatcgagattattgag
gagttaaaaaatgaatttgggtatgattttcatattcatctttacactactggacgttat
gttaatgacgatataatgagggaattagtcaatgcagggttagatgagatgcgttttcat
ccagtaaaggaattgtatctaaatgcggtaaaggttgcattaaagtacgatattgatata
ggtttagaattaccggctattccgaacgagaaggataaaatagttagattaattaaatgg
gctgaggaaaataatgttaagtttgtaaatttgaacgagctagagctgaattctaggaat
tatttaaatctaaatagtaaaggatttcatgcaaaacatggaataactggtgtagaaggt
agttttgaaactgccttggatgttctgaaaaaatttgaagataataaaaaaattaccgtt
cattattgtagttctatctataaagatcttgtcgaaactagaactagattttttagaata
atcaaatatagttcaaaaccctatgaggagtatactaatgaagctacagtagtaagagca
atagttaagactaaaggcgaaattcctattctggaaaattttggtgagtccactggttca
gatgagtactctatatcgccaagtattgtcggagatcttctaaatgattacactaattta
ataaatgaaatttatatagttgaagaacatcctgattcccgaagattaagagtaggagag
aagctaatttattctaaatctaagaatagc
>SSO0085 Conserved hypothetical protein
atgtctgaacttaatggagtaaatcttagtgcattctataagttagaagtaagaaatttg
aaaaatactcatataaaagaacttgtgtcatttgatcttctattaagcaacggtagacaa
atagggaaatgtaattactttaaaggcagggattactatactccttggctagagatagac
tattatcctattctaagaaatgaaaatctggaggtaatttttttcaaagtcgtatataac
ttcctttctccaggaggcaaactatttgtaacttatattagggacaatgaaacccgtgaa
aggctttatatagggaaacatcctgttgagactcctttaggtttttcactgttatcagca
ggtttcacttggtttaaagattggtattttccagagggtggcaacgagggttttcctaag
ttacaagcaaacaagcccattaatagtgatgagggaattaggcagttagagacgataaga
gaagaaattaaaaacgtgaatgtcattagaaagatagatgagttaattgaccattatagg
aaatccagagataggactgtatactgggaaattacc
>SSO0086 Conserved hypothetical protein
atggaaggatacgtttatggctctgtagctcgaggggatgtgaatgaaaaaagtgacgta
gatatcatagtatttaatcctaatcaaatcgtattggatacgctaaacgtaaatcataag
tatcttattcaagctacacctaactccgtacctaaggcctatctatcgttagatgaggaa
gagactatagttatatcatttccattaggcagattaaggagaaatgagattgagttttat
tcatttggtgggttagtagatttaaaaggtctctcaaaaaatgaacgcgttcctggcgtt
aacaaaaaactaatgttaattatccctactgaaaatggccatatggagattccattagaa
ggaaatgaggattatgcttcaaaacttcttaagatttcattagagacaataatggaaagg
aaaaggttattggcgaggaggatggaacgaggacatactggcgtatttttgagatacgat
ttgggcggcaacgaaagtatttatgatgcgtttaataagatgtacaagtccaataaattt
ttcaagaggatggtagatgtc
>SSO0087 Conserved hypothetical protein
ttgccaatgacgatcactatactctatttggacatctttttaatttctaaatacattatt
agatttgtggatcaaatatacttagctgtagcgttattcctatctttttggttgattatc
tatgtttttagaagaagactagagaaatataacctaacagtctacccatttttcatatta
tggagaaaaaaatcaagggaatattggtttcctaagttctccagatccaaaggctataga
gcttatgaaaaaattgctctaccaataggtttcttacttatgatagcagggatcgttaca
atattatatataataatagaaatgctaaccatcaaaccaaatcaaactcctacaatagca
ttaaaaccaataattccaggggtgacgataagcatctctcagttaccctacatattacta
gctattggagtttcagtagcgatacatgaaattttccacgcattgtccgccacatcaaat
aatgtaaaagttaaaaatggaggagttctattacttggaatattccctggagcattcgta
gaaccagatgaagatgattttaataaatctacaagtaatgcaaaacttaaaataatcgct
gcaggaatagtaattaacctagtcttagcactaattgcacttccattatcctttgaactt
ccatatttaccttcagcactctcgcaagggataataatagaaggtgtgcttaataataca
ccagcagccaacgcatcacttcataccggagatataatatattccataaatggttatcgt
ttaacgacattatctcagcttcatgaacttctttacaactacagcactatcactataact
ctgaaacatcctaatgggagtttaagtaatgtaagtgttaacattcctaatcatttctta
ggagtttatgtcacatactatattccagattatatagctgcaattttaatgttcttcaca
tggttatttatagtgaattttagcttagctgtattcaatgccgctccactaataataact
gatggtggaaaactcctaactgaattattaaagagaatgctaggcgagagcaacggcgaa
aaaatttcatattacttgcagtcactattccttttgatctttatattcgcaatatttcta
tctaatcgtcctctagga
>SSO0090 (lysS) Lysyl-tRNA synthetase (EC: 6.1.1.6)
ttgttgatgaattgggacgaaagaagagtaaaaatcgttgaagaattaagaaaaaatggc
attgagccatatcctcataaatacgaagtaactcatctgattaaagatattaagctaatt
gccaaatcacaaggtaataaatcccatgagccgttcatgtttaacatatctacagcagga
cgcgtcgctaatataagaaggcatggaaaggcatcctttgtagatatatttgatgaaggt
gagaaattgcaattatatatgagagttgacgaacttaaagaaaaatatgataaattcttt
atatatgttggaagaggggatataataggtgtaaaaggtgatttgttttatacgatgaaa
ggtgagttaagcctccttgtaaaggattaccaactactatcgaaagcccttatagaacct
ccagattggtcaaagctttccccagaatttagatatgcgcatagatatgtggatttcctc
tataacgataatgcgaggaaggctatggaaataaggtatacaattataagagaaattagg
gagtttctttattccaaaggctttattgaagttgaaacgccaatagttcaaccagtatat
ggtggggcattagcgaaaccttttaaaacacatgtaaattacttaaatgaagattggtac
ttaagaatagcattagaattatacctaaaaaggtatataataggtggatttaacaaagtt
ttcgagataggtaaggtatttagaaatgaagatatcgatgtaactcataatcctgagttt
actctcttagagctctattgggcatacgccgattacaacgatataatgaatttaactgaa
gatctacttaagagtgtagtcaagaaggttacaaatagtacaaaaatagtatatggaaag
tacgaaatagactttgaaggtccgttcaagagaattagtatgtatgattctttatctgaa
attttaggtaaggatgttgaaagtatgagtgacaatgagcttaaggagttaatgaaaaaa
tacaatctaactccaagaggaaaccagtatgttagagggttgatgatagagaaattgttc
gataaactagtcacacccaccttaactaacccaaccttcattactgattacccaatagag
actacaccactttgtaaaccacataggaataaaccgggactagtcgaaagatttgagatg
ttcatagctggtatggaggttgcaaacgcatacacggagttgaacgaccctatattgcaa
gataaattatttagagaagaacaagagatgttcagaagaggagacgaggaggctcatcct
tacgataaggattttgtaagagccttaagttatggaatgccacccactggaggtttaggt
attggtatagacagaatagttatgttagtaacaaataattacagtatcaaagaagttatt
cctttccccatgataagtagtaaggttatcctagaggacgat
>SSO0091 (rpl7AE) LSU ribosomal protein L7AE
atgaacgcgatgtcaaaagctagttatgttaagtttgaagtaccacaagacctagcagat
aaagtattagaagcagtaagaaaagctaaggaaagcggaaagataaagaagggtaccaat
gagacaacaaaggctgtagaaaggggtcaagctaaattagtaattattgctgaagatgta
caaccagaggaaatagttgcacacctaccactgttatgcgatgagaaaaaaataccatat
gtttatgtttcctctaaaaaagccttaggagaagcttgtggtttacaagtagccacagca
tctgcagctatcttagagcctggcgaagctaaggatctagttgatgaaataattaagaga
gtaaacgagattaaaggtaaaacttcaagt
>SSO0093 (gltX) Glutamyl-tRNA synthetase (EC: 6.1.1.17)
ttgatggaattaaatgaattacgagaaactatttataaatatgctcttcaaaatgcggta
aagcataatgggaaagccgaaacgggtccagtgatgagtaagattatagcggagaggccg
gaattaagatcaaatgctagagaaattgtaaagattatcaaggagatcatagaacaagtt
aactcattaactttagagcagcagttaactgaaattaaagcaaagtatccagagttatta
gaagagaagaagcatgaagaaaaaagaaaagtgttgccacctcttcctaatgttaaagga
caagtagtaactagatttgcccctaatccggatggtcctcttcatttaggtaacgcaagg
tctgcgattctatcttacgaatacgctaaaatgtataacggtaagttcatactgaggttt
gatgatacagatcctaaggttaaaaggccaattctagatgcatatgattggattaaggag
gatctaaaatggctgggaattaaatgggaacaagaactttacgcttcggaaaggctcgag
ttatactataagtacgctcggtatttgatagaaaaaggatatgcgtatgttgatacatgt
gatagtagtattttcaggaagtttagggatagtagaggtaaaatgaaagagccagaatgt
ttacataggagctcttcaccagagagtaatctggagctgtttgaaaaaatgctaggagga
aagtttaaagaaggagaagctgtggttaggttaaagaccgatctatcggatccagatcca
tctcaaatagattgggtaatgcttagaataattgatactgctaaaaatcctcatccacga
gtagggagcaagtattgggtatggcctacctataactttgcttctataatagatgatcat
gaacttggaattactcatgtactgagagctaaggagcatatgtcaaatacagaaaagcag
agatacatttctgagtacatgggatgggaatttccagaggtcttacagtttggaagacta
agacttgaaggttttatgatgagtaagtcgaaaataagaggaatgttagagaagggtacc
aatagggatgatcctagattgccaactttagctggactcagaagaagaggaatcttacca
gatacaattaaagacgtaataattgatgtcggagtaaaggtaactgatgctactataagt
tttgagaacattgccgcaattaataggaaaaaactagatccggtagctaaaagaataatg
tttgtaaaagatgcagaagaatttagcgtcgagctacctgaatcactaaatgctaaaata
cctttaattccctctaaacaagaaatgaatagaactattattgtcaatccaggagataaa
attttgatagaatctaacgatgcagaagataatagtatactaaggttaatggaattatgc
aatgttaaagttgataagcataatcgtaagctcatatttcacagcaaaacgttagacgag
gctaagaaagtcaatgcaaagatagttcaatgggtaaaatcaaatgaaaaagtaccagta
atggtagagaaagcggaaagagatgagataaaaatgataaatggttatgctgaaaaaata
gcagcagatttggagatagacgaaattgtacaattttaccgatttggatttgtaagagta
gataggaaagatgagaatatgctacgtgttgtattctcacacgac
>SSO0094 Conserved hypothetical protein
atgataaaattagttttagtggatttagatggaacgctgactgaagatagggaatctact
cgaatagacttagatgccatttacgcaataaggctcttacaaaaaagcgggatcaaagta
agtttagttagcggaaattcctatccaattctaagaggactttacacatatctttattta
gacggtggttttgttgcagaaaacggatgtatagtattttacaaagaaaagtatagaatg
tgtaggcaaatggagcagagcctagtagatgaattcaaatctttattcaagttaagggat
acatggcaaaatgaatatagggaatgtgatttcggttttgttcctgcaaaaataactgat
gagatgataaattgggctaaagaaaggaatctttacattaaaagtagtggatatgcggtt
catattgcatataatccagcggggaaaagaataggagtagagaagttgcttcaattactt
ggtctaaagaaagaagacgtagcggctattggcgattcatcaactgacatagaactattt
caacaagttggatttaaggttgcggtaggaaatgctgatgatgaactgaaagatatagcc
gattatataacaagtaataaaagtggaaaaggtgtaagggaatttgtggataaattacta
aaaggggagtttgatggaattaaa
>SSO0095 Conserved hypothetical protein
atgaagaaagtttatgatgagatccatgcgtatattgaacttgacgatagagaggccaag
ataattgatatgccagaatttcagcgcctacgaagaataaaacaaacaagtttagcatat
ctggtataccctggggctactcataccaggttcagtcactctttagggacattttatctt
actacaattttaggtgagaaatttagacagctaggaataataactgacgaagagtcaact
tacctaaaattatctgcactgctccatgatataggtcaatttccttttagtcatagccta
gagcctttatatttagaaaagggattatcaaataaggatttaaggtatatgataatttcc
aaatcgcctaattttagggaattttttgataatgaatcaattgactatagtaagattata
gaaattttgaacggaaactcaatgatgtcatctatagtaaatagtgacgtagatgttgat
aggatggactatctggtaagggactctagacatactggagtgcaactaggcaatattgat
ttatatagattattggataccatcttctatggaaataataacgaaattgttgttcaagat
aaaggtatatatagtttagagaactttttcatatccaggcttcacatgtatcaagctgta
tattatcataagaccataataggttatgaactgatgctgagagaaattttcagaactatt
tacgattgctgtgattcgtcaatcttaagcgtagaaaatataagaggtcttgtctatgat
tcctcaatatcctattgggatgatgaatgggttttcatgattctttacacatatctctat
tcctctaactctcccctttatttaaagcagaaaataagaaatttcttggatagaagaggt
cctaaagtggtttatgaagagatttcctacgataacgagatgaaaggaggagatattaaa
attaaggagatagtagatcgtttagagagaaatcagattccgaggagttcaatatatccc
attgaggaaaaaataaaaatactgaataaggataaaataaatataatttcaaagaataat
gagatgaatataatccggtataagtccactttaattaaccatataccagagactttaact
ataagaagaatttatgtagatcatgaatacgctaaaaaagctagagatgtagttcca
>SSO0097 Conserved hypothetical protein
atgagtttaattgctttagcacaaacatctttaaatcaagcaaactctctttactacatt
ctaacatacgtgttgttctttgttttattgttcctattgtatttgccaggtgttaacaca
aggctgaccgtatccatgttagctagaggcatagagggacaattaagtatgattgaaaaa
tacttgaatgagtccaaaagtaaaatggaacaacttttaaaagaaagaggtgttcaagat
ccaaagccatttatcgaaagaatatctgaaatgtttataatagatccagtaaatgtagaa
ccgacggacataattagtaggatgagattattacttagaagtggagaagataagataagg
gatcttataactcttatggttccgaatatagataatgttaatagaagtaaattggaagta
tctgcagaagtagtaaattcgctaaacctaatatacaaagtagtgagacattatttgatt
ttagctaaaaagctaaatagtgctattcttctttatcagttacaatttgttgttccacaa
cttgttaagatctctgaagcatactctaaggctatgaacactttcatacgaggaatacca
gtgggcgattcgctaggtcctttggtagcagcttatctatttatgaaagctgataaaaaa
tggaatcctagtagagatactgtagcaggagaggttgaattagaaggtagaaaattaatc
gtcgtaaaagctgagggtcccatggctacagtagggaggccaggtgaagcagtagagaat
gtggttgaggaatataaaggtaaagtcacgagaattataaccatagatgctgcgttaaaa
ttagaaggtgaaaatactggggctatagctgaaggtactggagtcgctatgggtgatcct
ggtcctgaaaagataagcatagagagagtagccgtaaaatacaacataccgatagatgcg
gtaatagtaaagatgagcatggaagaagcgattacagaaatgaggaaagaaatttaccaa
gctgcgccaaaggcattagaattagtaaagaagataattctggaaagaactaagcctgga
gatatagtagtagtagtaggtgtaggaaatactgcaggggtggctcaa
>SSO0098 Methionine aminopeptidase 2 (EC: 3.4.11.18)
atgactgaggatgaactcaataagcttttattagcaggtaagattgcagctaaggctaga
gatgaagtttcattagacgttaaagctagtgctaaggttttagatatttgtgaagaggtt
gaaagtataataatcgaaaataaagcgtttccatcatttccatgtaatatatcaattaat
tcggaagctgctcattatagtccaactataaatgatgaaaagagaattccagaaggtgct
gtagttaagttagatttaggagctcatattgatggttttattagcgatactgcaattact
attagtttagactctaggtatcaaagactattagatgcatctaaaactgctcttgaggct
gcaattactaattttaaagctggattaagtataggtgagattggtagggttattgaaaag
gtgatacgagctcagggatataagccgataaggaacttaggaggtcatcttataagacgc
tatgaacttcacgctggtgtgtttatacccaatgtttacgagagaggattaggcgttata
caatctgattctgtttacgcgatagaaccatttgccactgatggtggcggagaggtagta
gaaggtaagtctattacaatatattccttaaaaaatcctaatataaaaggtctttcttca
agagagaatgagcttatagattttatatatacccgttttaattatttaccgttttcagag
agatggcttaaggaattttctactaatgttgacgaattaagaaataatataaaaaattta
gttaaaaaaggtgcattaagaggatatccgatcttaattgagatcaagaaaggcgtagtt
tctcagttcgagcacaccgttatagttaagggtgattcaattatagtgtctacaaagtct
ctt
>SSO0099 Conserved hypothetical protein
atggcacagttaagatggttaggccatgctgcaaccttgttgacattcggtaataagaat
gtaataatagatccaatgattaaggacaatccattaagcccagtaaaactagactatttt
aaaaataacttagatatcattattgtaactcatgaccactatgatcacttaggagatacc
gtagagttattaagaatgaatcccaaagcaaaactctttgcaacttacgatctagaagca
catttagcggagacttataaaatatcagaggagagcattataccagccaatgtaggggga
ttcgtagaagttgatggaataaagctggcgttaactaaagcagttcattcaagtacacat
agtgacccaactggtgcaatagtatctgctgaaggaattaccgtataccatgcaggggat
actggattatttgaagatatgaagttaattggagaagtatttaagcctgactacgcacta
ttacctataggcggaagatttacgatggatccttatcaagcgtcaataagcgtagagttg
attaagcctaagaaaggtgctataccaatacactataatacatgggatctgataaaagtt
gacgtaaatgattttgtaaaactagttaagaacaaaggatataatcccatagtattacaa
ccaggccaaactataacgttg
>SSO0100 (pheS) Phenylalanyl-tRNA synthetase alpha subunit (EC: 6.1.1.20)
gtgatatcaatgttaagtgagaacgaagctaagatactattttttttgaaagatcttaaa
aaaacaaattcagtggaacttgcaataaaaatgggcattccagaaagctcggtcttaagt
ttaattgagttactaagggaaaagggttatgtaaaaacagaggtaaaatctgaaaaacat
tatgtattaactgaagaggggaggaaaagaaaagaaagtggactcccagaagatatttta
ataaatacgttgaatggacaagaaaaagatctaaacgagataaaaaacattcttaataag
gactttaacatcgcaattagttgggcaaagagaaaaggattaatagatataaaagaagga
aaagtgatacctaaagtaaaaacttatatgtcatctgaatatcttgctctttcaaatctt
gaaagagctgatagtaatacaataaatttgcttaaaaaaagaggtcttatagaagaaaag
gaaaggaaaattgtaagtgtagagttaataaaagaacctaaagagtctgagataggtatt
tcaaatctgaatagagaattgataattagtggtgagtggaagaagtacaagcttaagaag
tacaatgtagaagcctttcctccatattatactattagtaaaaaacattattttagagag
tttttagaaaaagtcaaggatattatgattagcttaggatttaaagagattaatacaggg
tacattgaaatggaattttataattttgatcttttgtttcaacctcaagaccaccctgcc
agagagattcacgatagcttttcagtagaaggttcaggaaaaatagaagacaaagatttg
ctaaataatgtaaaggaaattcatgagaaattctggaagtatgaatggaaacaagatatt
acactaaggctaatgctgagaagccagactactgctacaactgcgagagtcctagcatca
agacctaaggctcctcaaaaagtcttcactttaggtaaggtcttcagaccagacgcaata
gatgcaactcatttgatagaatttcaccaattagatggtgtaattatagacaataatttc
acgtttaaggagttattaggtgttctgaaggaaatattctataggttaggaattaaggaa
gttaaatttaaaccagcatacttccccttcacggaacctagcgtagaagcttacgggtat
ctggaaaaattaggctgggtagagatgtgcggggctggactgttgagaccagaaatacta
agttcagttggaatcgatagtacagctggagcttggggaattggaattgaaagacttgct
atgagctttctcaatattagtgatattagattactatattctaacaatatagagtatata
agagatactaaagtgaaaatagag
>SSO0101 (pheT) Phenylalanyl-tRNA synthetase beta subunit (EC: 6.1.1.20)
atggtaactatagtattaaataaatataaattattaaataaaataggcataggtcaacag
aaactagaggatttattgtttaacttaaaatcagagataaaaccagttgacgaaagtaat
attgaaatagagataaatgctgaccgattagatctactctcctctgatgggatagctaga
gcgattaaaggcttgttagaaaaagagctaggcgaagcaaagtatgatattacggatact
gaatataagttaatagttgataatgtaagaacgagaccttacgcgttggctgctgtaatc
tataatgctaaaatagaccttcaagaactaatacagtttcaagaaaaacttcatagtacc
atagggagaaagagaaaaaaggtagctataggcattcacgatctaaagaaaatagattca
aagaggatagaatatagggaagttcctctttcctataaatttattccattatatgaaaag
gaagaacttacaattagcgaggtcttggaaaagactgagcaggggaaactttatggaaat
atttcgatatctaatggagtatcaccagcaatagttcaagaagatggagaagtactaagc
atacctccaataatcaactctgataagacaaaattggacgagagcacaaaagatctcttc
atcgacgttactggaacttcctttgaagcagttgcgcaaaccctagatataatagtttca
aatctagcagaagctggagggacgataggaagagtaaaagtaataaaaactgataattcc
ttccaacaatcttcgcccttactcatacataaaattcagaatgttagagaggaatatgca
aataaaattttaggaatcaaaatcagtgaagaagagatatgtaaacatataacgagaatg
agaatgaattgtaacgtagaaaatggaatcataagagttacagtacctcaatatagggta
gatataataaatgaaatcgatatagtagaggatattgcaatgagtattggatataataat
ctagaaccctctaagtatatttcgacaaactatggttcttatgattacttaacattactg
gaaaggaaaatgagggaattaagcatcggagcagggtttgtagaggtatttaactttgtg
ctaattaaaaatgaaaagatacttgatagtaagtatgtgaaaattctcaaccctatttct
gaggaatataatgcagtaaggaattcgctaattccaatattattagattttctatctaaa
aatcagcatgcgaaattcccaattagaatttttgagaccggagacgtggtaatttatgat
tcttcgacagatactggatttagaaatgataaaagggctgcatatgcaataatggacaat
aaggtaagttatgaagacgtgcaagcacctatccattacattttgaaaacattaggcata
gaagtaaattataaggaagaaaataatgacattttcattgaaggacgttcagcatcaata
gtgtatgaaaacgagaaaataggggtaataggtgaaattaatcctgacgtattaataaga
tttggtattgaatatcctacagtaatcgccgaactgtatatcacggagatagctaaaaaa
cttaacaagaga
>SSO0102 Esterase, tropinesterase related protein
gtgctaattcaccatttagctggtagttataagagctggaaattcgttattccaaagctc
tcattagataacaccgtggttgcgtatgatctgagagggcatggtagatcttcaactcct
aattcaccttataatattgaagatcattccaatgacttgagaaggttattagttcagcta
ggtatagaaaaaccagtgttgattggacactcaataggttctttgattgcaatagattat
gctttgaaatatccaatagagaaattagtgttgattggagctctatatagagcgccatca
tcagaagtttatgaaaagtatgtaagaattgcagtgaattttggaatgagagcattagca
gaatatagaagattccacaaagagtttactgaaacattagccagcaactatcaagcgtgg
aactctcttttagaagtatatgaggaaactacgccaataggttataaaaacgcagtggaa
ggattattaaaagcgaaagattattcagatgaacttatgggaataaatgctaagaccctt
atagtatatgggacttatgacggattaatagtaaatctaaacgtatttaagaacaacatg
aaaaacgtagaaataaaaactatagatggctacggtcactttcttaatttcgagaaccca
ttattattatcggagatcataaagaatttctta
>SSO0103 (cinA) Competence damage protein
ttggtttcgatagttaatatttttatggattactggttcgcggaaatcataactataggt
aatgaggtattaagtggaaaaactgtaaatacgaatgcttcgcatatcggtcgcagactc
acatcactgggattcactgtgagaagaataactgcagttatggatgaggtagatgagatt
gcatcggcttttagggaagcaatagatagaaagccaagagttatcgtatcttctggaggt
cttgggcctacgtgggatgacaagacagcagaaggcttagcaaaagcgttaggagttaat
ttggagttaaataagacagcctttgatatgattctggaaaaatatatgaccagaaagatt
cctattacggaagagagaaagaaaatggcttatatgccttatggagctatacctgttgaa
aataatgagggaatagctcctggaatatatgtttatcataataacattgatatattagcg
acaccgggggtgcccagagaaatggagaatgtgttagagaattttataaacaaaatgcta
agaaataggtctaacttgaaatatctagaggatttcatatacgttgagaacgtgatggaa
tcttccttagcaccatatgttaaggaactcgtgaaaaagtatgatatttatataaaaacg
catccaaaaagttatgagatgtcgcatcctattctagaaattcaaatagcgggaagtggt
aagcaagaggaggaaattaaagtgaaaatagagaaagttaagttcgaattattagatgct
ataaagaaattaaacggaatcataagaaattcttta
>SSO0104 (aspB-1) Aspartate aminotransferase (EC: 2.6.1.1)
atgtttgagagatttttatccaccgaaactaagtatttacgtacctcagaaataagagat
ctactaaaactaacggaaggtaagaatgtaattagccttgcgggaggtttacctgatcct
cagacttttccagtagaagaaattaaaaaaatagcagatgacatcttattgaatagtgct
gataaggcattacaatatactgcaactgctggtatatctgaatttagaagagaattggtg
aacttatctagattaaggggaattagtggaatagatgaaagaaacgtctttgttacagta
ggaagtcaagaagcacttttcatgatatttaatatattactagatccgggagacaatgta
gtagtcgaggcgccaacttatttagcagctttaaatgccatgagaactagaaagccaaat
ttcatatcgataacagtaacggaaatgggcccagatctagatgaattggagagaaaaata
aaagatgcccatagcaatgggaagaaggttaaactgatgtatgtgattccaacagcccag
aatccggcgggtactacgatgaatacagaggataggaaaagacttttagagattgcatcg
aaatatgatttcttaatttttgaggatgatgcttatgggttcttagtattcgagggagaa
agtccaccaccaattaaagccttcgataaagaaggaagagtaatttatactagcacattt
agtaaaatacttgcacccggtttaaggttaggatgggtaattgctcatgaagatttcata
aaggaaatggaactatataaacaaaatgttgatttgcatacaccttcattatcacaatat
attgcaatggaggctataaggaggggtataattcaaaataatttacctaagataaggaga
gtgtataaggaaaaaagagatgtaatgctagaggctattgaaacttatttccctaatgat
gccagatggactaaaccagttggtggaatgtttgtttttgcttggttgccacaaaaaata
gatactactaagatgttagaaaaagccttacaaaggggtgtagcttatgtaccaggttct
agtttctatgctgactatagtggaaagaatactatgaggatcaactttagttttcctaag
aaagaagaattaatagagggaattaagaggctaggagatacgataaagcatgagctctct
act
>SSO0106 Hypothetical protein
atgaaagcagtagtattcaatttaggtattacaataagtgacgtgccagaaaaacaagtt
aatagagattatgtattattaaagccaaaaagagtgctagtaaatggattagaaaactca
atatatgtcggattattgtgggtggatccaactagaatactcggttcaactggaataggt
agaattgaaggtgtgggattagatattgacaagagtttagaaggaaaactagttctcgtt
ttgccatattcacagacatatggcggaattggaaccgaaatagacggtattcttgcagaa
aaagcttctgtacccttagacagtatagtaatccttccccaatatggttttaatgaaaaa
tatatactttatccatatgtaagttttgcactccaactacccaaatatatacacagtggt
aataccttaataataggtagtgggctttatgggataatctctgcactctatttaaaggat
atggtaagtaaagtcgctgtatatagggaagatgggattaacccaaaaatagtaggggta
gaagagattcggcacttttcacaagagtgggacaatataataattacgacctttaggtct
tggattagagcttttatagatgacatttctaaatcaaatactaagatcgtaatgcctaaa
ctaatgaacacatggccggtagtttcatctactaaaacagtctttattcctcctaaagag
gttgatggtgttctcgaatttatagacaaaaaaattaatgataagttatttaatgaatta
gtatcattttccaatgatcttttagtttcttttccatcaccgaaagctggtgtagtaata
aacgctgaagagatttttaag
>SSO0107 Conserved hypothetical protein
atggaaaaggcaattcataatctaggtaaagatgctagactacatattattcatatcctc
ttgcaaaataggagtaaaaaagaacttgctgacgagctgggtataactcctgcagcaatt
actaagtacttaaagggaattacacatccaagtgatgaaataattgaaaaatgtattgaa
attgccagtgaagacgaagaatatcatgagataatcaaagtgatcgttagtgatataaca
gaggccttgatggaacttctcagagaaataggcatagaaaaaatgattgataacgaggat
atacagaaacttaaaaaactacttgataaagcatttgataaaatgctatcaacttctcct
agcttcgta
>SSO0108 Hypothetical protein
atgagttcagttacagaggataatttaaaaccaaacattgtactcctttcaacttctgat
cttgaacaagaaataaggcaattaacggaagaactaaaaaatgtgaaagataataacaat
gaagagcataaaaaactctatgccttagttgataatataactagaactttaaattggatc
aatatagcaaaatctcaaggcatatggaagtcaaaaacttgtaaacatgcaataaacttt
gtatgtcaagcttggaatataagtgatgaaagtaagcttgggattcccagtgacgtaata
gtaataaacgatgatggtactaagagagttgttgtttccaaattctccgaaatttgcatt
gtctgtccgctatacgaagctaggagaagt
>SSO0109 Conserved hypothetical protein
atggtgaaggaaatctacagagagaggataaaagtacttactgatatatggagtttacta
atagaaagctgggaatcattgagtcgtgaagatgttattgaaattatgaaaaatgcctat
gtcaagaaaaacattaaaccgtttagagggtttaatgcagacgggttatatgagaaagag
ctagtaagcttgtttgtcgtaggaaaatatggactaggtcttttcgaagacaataaagaa
atatttgataaattactatctaaggaggaatactatgatgagatctcaaagctaataatt
agtggaaatgttaatgaagcctttgaagagtctggcagtaacaaagaggtactggctaga
gcattaagaacaatattcaccaagacagtgttttcttttgaatccgaagataaactatat
aaatcacttaaaaatctaaatatttccgacaaagatgagataaaacatacctcaagaagt
ttttcaagattctatactgccttcaagcttgcagaaagtatagctgagggcattgttagg
gataggttaacttatatcgctactaaaaaggctatagcaatatcaataggtattgaatat
cctttaccgaaagctgattacgtggcgctaatagctaaagaggtatttaacgtaaataag
aaggtattgaataaggttttgggtgtaaaggta
>SSO0110 Conserved hypothetical protein
atgcagaatctctcgcctacgcaaagggaaatattgttagcacttactgatctatataat
aggcaaaaaagaatgataaaaagtaaggaagtagctgacattataggaaaagatgaggga
acagtaaggaacattatactaagcttaaaagtattaggcctagttgaatcgaaacccgga
cctaatggaggttacatgccaacactaaaagcatatgaaattattaataatcctacacta
actccaattttggataaactaaatctctataaagggatgatagaaactgatataaaagta
gaaaatattgaaataattgatattactaacccttcagcgaatagggttctcttaaaggta
gagggagatctaaggaaattaaagataggagatgctgtacggttaggtcctacaccctat
agtaggctggttatagaaggattgatattacacttagatgaaaatagtaaagaaatcgta
gtagacgtgaaaagaatgataagtatccctaaggaaaaagtcaaaaatcttatctctaag
aaactcatagcgttaaaaccagaaactagcttaagagaagcctccatgatattctataag
gaagcaataagaggtgcgcctgttatcaaccaagacgaaaaagttgtagggattcttact
actgcagatataattaaagccttctttgaaggaaactatacagctaaagtatcagactat
atgaagaccaatgtaatcagtataaatgaaaatgaagacttgctagatgcaattaggaaa
atgataatttataatgtcggtagattgttggtacttgatagtaataataaagctgttggt
attgtaaccagaaccgatattttaagatcaattgctggtctagaaggtttgtggacaact
>SSO0111 Hypothetical protein
gtggacaacttgaaagagaaatgtggaattatttgtaataacactttctatgagttaaaa
aatataagtcgtacagaatacgaatttatttgcgatccgtctgatttttacactacagta
aaaggcaaatgtagtgatgatatacaagcaatagtgcacacccacgaagaaagttgcgaa
cccagttacaaagatattatgtcaatgaaaatatggaacattccttggattattatatct
aaaaagtgtataaaaagtatactatatttaaacggaagtatactcgagctcgatattcac
tcccttctgtctcaagaactctaccactctctcatgaagcttcttcag
>SSO0112 ATP-dependent helicase
ttgagcaatacttacttctactctgatgaagaaatatacaatttactcagaccatatgta
gccaaatggtttaggcagaaatataccacgtttactcctcctcaaagggcagctataccg
ttaataaagcagaactacaacgtattagtatcgagtcctacaggaagtggaaaaacttta
gctgcatttctaggaattttagattcgttatttgagttaggtgataacaatgagttagaa
gataaggtttatgcgatttacatttctccgttaagggcgttaaataacgacatgcaaaga
aacctattagaacctcttaatgagttaaggcaagtaaactcaaaattaccagatgttaga
gttggaataagaactagcgataccacaccctatgaaaagcagaaaatgctaaagaaaccg
cctcatattttaataacaacgccagagtcttttggaatatctataacttcacctaagttt
agtcagaaattaaccgatgtgaaatggattatagttgatgaaattcatgaactagctaac
agtaaaaggggagcttatctttccgctatgttagaactatttagaaatctaattactaag
aaagaatttgtgagaataggcttaagtgcaactgtatcgcctctcgaagaagtggcgcaa
tttctcgtgggcaaagatcgtgaatataggatagtcgatgctagatttgtaaagcctgtt
gatattaaagtaatttcccctgttaaagatttagttcactcttctgaaagtgaggtagac
aagggaatatataagaccatcttgaacgaagtaaagaaacataggactactcttattttt
acaaatactagacacgctacagagagagttgcatataagttaagaaagttagctgaaaat
gaaaaggtctttgatgtagatgcgatagaagctcatcatagcagtcttagcagagatgtg
agattagatgtggaagagaagcttaaaaagggaattttaaaagttgttgtatcgtcaact
agtctagaattagggatagatataggttacattgacctagttatcctactaagtagtcct
aagagtgtaagtaggttattacaaaggatagggagggcgggtcatcatataagaagcatt
agcaaagggagagtgattgttgttgacagagatgatttagttgagtgttcagtgttagct
aagttagctagagataggaagatcgatagtatccacattcctaaaaaccccttagacgtc
ttatcacagataatagtatctgctagtttaatttctcccatagatagggatgatttgttt
aaaattttaaggcgatcttataatttttcagatcttagcgaatctgactattctttagta
ttaagatatcttagtggggatttctttggagtcgagttaaagaatgtctacgcaaaaata
agaataaaagaagaaaagataatttatcccaagaaaggtagtagattaatattttatacg
aatagtggtacaattccggatgaggctatgataagtgtagttacagaaaacaatagatat
gttggtaatctagaagaggaattcgttgaaatattatcacctggagatatcttcgtatta
agtgggagaacttatgaatttattggaagcaagggttcgaaagtaattgtaaaggaggct
atgggtcaaaggccaacggttccaagctggttttcagaaatgttaccattggcctacgag
tcagctctagagattggcaagtttagaagagagatagcagagatgattaagaaaggagta
acacataacgagataatagaaagcatctctaaggaatatgaaattgacaaacacgcttcc
atgtcaatatacacctatattttagagcaataccttttcacaaacggaaaagttccttct
gacaatctaattttaatagaaatttacgatgatgaagaaggaattagaaattatatattc
cacgcattgtacggaagaagagcgttggatgctctttctagggcttttgcatacgtagtt
agtgaggaattagatacagatgttagagtttctgttactgacaatggatttgcacttagt
gtaaaacgagacgttccatttgattataacatcaagagtctgtttgaaaagattacccca
gataatgtctatgatattgttacaagggctgttatgaggacagaaatgctaaagagaaga
tttagacactgcgcagagaggtcgtttatgatattacgcagatataaaggaagagagacc
aatctagagaggagagaattaaattcggagatactgttaaaggctataagagaaattgga
aatttcccagtaatgaaggagactattagagagattttagaagaccatatggatatacta
agagctaaggagattctgaaaaaaattgctagtcaagaaataaaagttgatgtgtttggg
cccacaaatattcccagtccgttttcccatagtataattcttaaagggcattcagatgta
gtactagcagaagatagaagggaactactgaagaagcttcatgagagagtggtagagttc
ttgagacagaagggagtgaatatcgagctcgagtatacttccgtt
>SSO0114 Conserved hypothetical protein
atgatacttaatatattacttaacttggcaatatttataataccttctctggcagtttgg
aatcagatcattttatatatattcggtaagagtggtgatatagcgaatttgattttactt
aataacgagagtaatctacctaaattatcaattatagtaccaacaaagggtgaacgaata
gaagtaatccaaggattaattgataatatacatgaagcaatatgggatagaaacaaatta
gaaataataattgtatcagatgacgagcaagaatattttgataaattattatcgacatta
attattcctccagacttagatgtaagaatatttagaagagaaaagaagcttggatataaa
agtggtgccttagcgtttggtctacagaaaagcactggtgatttaattttaacattagat
gtagatgccaggattgaaaaagattcgttaataaaagcttacaatcacatggtgaattta
ggctgtgatgcaatcactatggaatggcatggctattctaatattagcacgtctttagca
aaagcgttaatggtatcaacagtacttactagtaaatctatattaagaggaagagataaa
ttaggactaaaagtattgccaataggatgtgggacgatctataagcgtagtgcattggag
gcggtaaacggatgggattacaaaatgattcaggatgattatgagctgggagctagactt
ataaataaaggatttaaggtttgcgcatcttcctcccctgtttatgttgaagttccagac
aatttaatagcgttttatgtgcagcaaactagatgggcaatggggacgatggaagttctt
tactggagatttaaatatattattagcagcgatataaaactttggcaaaaattagagatt
atagcttatctttctcaatacattccaattatactaacatttataagtgcaattattttt
gcaatagctggttttgtaggtataaggcttagtatgaatttgccaatgtttattatatgg
gccataacactatcaatctatgcttcaatttttgtcaatagcgcaaagaagtcagggata
gatactgtgacagctataaaagccttgggaaggttgtctgcatatactgttggaatttcg
ccatttttgcttattggtacaattaacgcatttaagaagactagaacgtatattgttact
cctaaaggcaagaaggctaaaagtaatataggctatccaatcttagcctttggtgtattt
ttcattctatcagctttcctttatatgtttagaggcgacttcctaacctttatttggcta
gcttactattcgatagctttcctctacacctttatagcatatattaaaggatta
>SSO0115 Hypothetical protein
gtgagtactattcgcatagagatggagaagcttggagatctaatacctcatgaggatata
ttaatagataaagttgtcaatatctcttttgaagttcagaaaataagggctataaaacca
ataatagtagatgaaaacacacatgtcatcttagatggtcatcatagattcactgcagct
ttacgtctttcattaccaaaaataccggtgatttacgtaaactataactctacttctatt
agtgttaatgtatggtataggagattttcaaagccctatattgtaaagagcgtattatca
gcaatttactctaatggtaaaatatgtgccaaattcgactctatccgcatttgtgatgat
gatttatacagactctattggaaactagaaaaggtagaaagttttctgcattcgataggt
ataaatgtggaaaaagacattgttggccatttagaaccgccttcaatatataaagaagac
gttataagtattgccaataggggtttaagatttccccctaagactacaagacacgtatat
gaatttattattccccaaaaggcaatatcaatagatgatact
>SSO0116 (ntH-1) DNA endonuclease III, probable (EC: 4.2.99.18)
atgaagtgcactgctgaaacgattttccataaactttctgctacctatattataaaagag
gaggattttattgcgtattatgtctggcttaagaccaaagattgttttaaagtacttgta
gcaactattttatctcaaaattctacagataaatcagccattaaagcctatctagagtta
gaaagaaaagttggtgttactccagagaaattatctaacgccaatttggctgacatagaa
agcgcgttaaagatttccggtctttatagaactaaggctaaaagattaaaggaaatttca
aggataattcttgagaggtataatggattaatagatagtttgttaaatactagcaatgcg
agagatgaattattaaaacttgagggaattggagagaagactgcggatgtagtgctattg
acttgttatggatattatggatataaggtctttccggttgatacgcacataactagagtc
agcaaaaggttagggatagtccccactaacgctaaatatagtttaatttcatctacttta
aaagaacttttttcagcctatgatctcctccatcttcatcacatgttaattgcacatggt
agacaaacttgtaaggctaggaaacctttatgtaattcttgtataattaaagaatgttgt
gagtactattcgcatagagatggagaagcttggagatctaatacctca
>SSO0117 Hypothetical protein
gtgatgtggttgaaagctatttcatctattttttctacactaattgttgttatgataaca
ctctcactcatcgttccattatatttattttttacgcaaacttatacaaatagttctatc
caagcaaatagcgcatacgataattatctaaccaacgttaacgttaaggttagcctgata
tatttaggaaattcggtaaatgagacattcgtgtataattatggaagtgttccaattaca
atagaaaaggttataattaataatatttcgtacaatgtgaaatatgaaatgctacctgat
agcttagttcccctaagctcaataataaataataatatattcattgagggaaactctgta
atcattctacagattaatggaaactactattatttcaactctggaccggat
>SSO0118 Hypothetical protein
ttgctacaactaatgatgaaaggagggtataaattaaaaaagagaaaagggctttcatcg
attttaggtacagtaatagtattagcaataaccctagtgctgggtggtctactttatgcg
tactctaatggtctatttagttcattaacacaaaatgcgagtcttcagactcaagtaagt
atttatgtcaatcccaatactggtcaagcatatatccaatattatatttccaataccggc
agcacacagatatatctatctagtattcaaattcttaatggtactaggaatattataata
ccactcaataacaatctcttacagcctggtcaaacagttcaaaacataacatcaattaac
ggcaaaataactgctgggcagtactacactgttgaaattgctggtaatttacccaatgga
aaaccatatagtgtggttcagaacgtgctggcttcaatagcg
>SSO0119 Conserved hypothetical protein
gtgataaagttgaaactaaagctatttaaaaaaatgaatttatttgaattaatgaataca
agaataaatgaaaatatcaaatattatggtgatgatatggaaagactccgtaaagaatat
attgtgatgttgtttttaatgccgctaatatctagtatctctattatcttatatttgaaa
attagtccatattttttactgttaaatataatgaatgtttttatttatttctttcctata
cttattactcaaattagaaaggatgaacaaagaaagcttatagaaaacgagatgcccgtt
ttcttactattcgcttatgttaatagccttttaggaagaaatctatataaaacgtttgaa
gaaataaggaattctaaggtttttaaaggtttgagaagagaggccatgttgcttgttaaa
gaggtcgaagttttaggaaaatcatctttttcggcaatggaaagcagagccaaggctcat
agaggagacttcttaggtaagatttatacggtatacacaagtggtgagtcaataggtatt
tcaatgcccgagagattgaaagaccttttaaatgaaactattgatggcttgaattcaaat
tttcaaggttatgttgaaaaagtaaatgaattagttgagattttgttcatgctatttctt
attactccgatgattttattagcatttcagtatatttcctcatccataaatattttcgaa
cttatatttcctcttttgctattccctatcattttcttttatatttcacttatacagcct
aatataggatatgatataaaaatcgatataaaagaggttaaaaactcgctctacatatta
cctattccctttatactcgtgttcctctttcaccttagcctagagtatgaaatcttagta
ttttattcgatatttataatgttctccttctttatctatcgtaaaatatcagttgctgac
gcaatcttgaataatttaccatatatattatcagatattgcagattatttaaaaataggt
tatagtataaaaagtgcaatattgaaacttaacgtagataatacgcactttaggatgttc
ttaggagaactcgctgcaaagatcaggaaaaacgaagcgatatctaatgtaagaactaat
atctggattgtgaatgctatcttagaactcatagaaaatattgacaaaaaaggttttgca
gacacctatactttcaaagatttatccttaattctctataattatacttctttgcgaaaa
aaagtattacaaaatcttcgtctattcagcattctagctactataacacctattgtattc
tattttgcactagggataatgagtaagattagggcagttggcaacttagatctaattatc
gtgttgtatacaatggcacttagtataatttatgctaaggtatcccgatttaccgttttt
aattttccattacttgttttagctctaatgaacctaataatagtattactattcggaaac
gttatcttaacctttatc
>SSO0120 (gspE-1) Type II secretion system protein, virB homolog
gtgagtatattttttctgaacaatggtatcatgaatattctccaagagtattctgttcta
aatgctaaagtcatcatatatgaggaaaatgggataggttattataaagtaaatgaacct
aacctagatcagaatgaaattgagatactcaattctatattagaatatatctactctact
cctagtgtacctaatatagaagagacagtagttaagatactgaaaaataagggtattagt
gatcaagggattatcgaaaaaataatttattatttgagaaaaagaataggttatgacgag
ttaactgtacccttagctgacccttatgttgaagaaatagaatgtaaaggattctcatac
cctgtcactgtagttcataggattgttacaagattcccgagattatatactaatataatc
ttggagcaagaagatcacgtactaaaggttattgaaaaactcgctaataaggcagataaa
ccggttagtattgctaaaccataccttgaattttccctgcctgagggtcatagagttgca
gctacagtatctcgtgaggtttcattacctggttccacatttgatataaggaaattccca
ctaaagccaataagtcctatatcactgattaaaaacgaatcgataagttcgctaatgtta
gcctatatttggtttttattagattataagccgttctttttgatcataggttctacagga
tctggaaagactactttacttaattcaattctaagtatgattaatcctttctttaaggta
attaccatagaggatactccagaaataaacataattcatgataactggataaggtttttt
gccagacaatcaatttcctctcaatttgaagtatcgttaatggatttagctaaactatca
ttaagatatagaccggattatctagttataggggagattcggggtaaggaaatagaggca
ctagttcatgcatctgcttctgggcatggctcgttggctacatttcatgcaggaaatcca
catgaagcattgactagattgcttagccttctaaataaggatgttgctaaattattttta
caaaatctgtggggtattatagttttaggaacgctaagggatcgtaatggaaatataagg
cgtataataaggtcgatttatgaaatagtctatactagaggtaaactaagatttaggcca
gtattaagatggtctttttcctctaacacattcatgcctaacaatattgatgatttaatt
aaaaggtcctataggatcagttatatatcaaagacatatgaaataccaatttcagaaata
accaaggagattagtaatagagttaaaactcttaataattttgtgagtaataatatttta
gatctagaagagttcagtgtttatttaaagaaaataagtcaaggtgataaagttgaaact
aaagctatt
>SSO0121 Hypothetical protein
atgattaaagaatgtatgacaattccagattttatactatatcagaaattaggtttaaat
tttattcctaacctcaactgctggcttgaatcaaagaacgagaattctgtccaattgaaa
tgtaatgttttgcgccagccctctgttaatattagcgagtttgggattaagataagcgat
gacaaatggattttcagaaaaggtaatattgttgttatgattgaggatggtaaggaaacg
ataatcagaaaggatgaagatgagtatgtagtagactatattatgtataatgatagtgaa
atttacccaatatatcttaagggaagaaaatataacttaaacggagaggagtatgagaaa
tacttatcttatctagatagaaaaatcttggtgggaaagcgcaacctaatcataatattg
ggaaacaaacaattaaatatagatcgtggagagaggatttatctttcaaggtcttttatt
tctgtaatatatgatagtggtactaaggttatcgacagagagggtaatatatcatatttt
aattttaaaggcgattatctaggttttattcagtcttatggtattatatataggtcaagt
gatgggttaatagtctcttctaagaagggaaatattggaatatgtgttgacgaatcatat
ctaattggagagttttctggaggattactaattttatgtggcgaaagcttaaagcagtac
tataatactggttggagggagatcgagagaaatatagattcagagttatttgttaactcc
aatagaaacttttttggagttctaaaaaaaggcaagctttacatttttgacagtaatttt
agtaagttgtctacatttgacgatgtgaattctttcaatttcgactctaaaaggatttat
ctattttctaatgacggaactgttggtttagctaagttggaggagaactacaggccgatt
aaaattataaatgtaaataatagtgttcaaagcccaattatattacaagtcgatgaaaat
tatttccataattttagtataaaaaatggtaagatgatagatattaaggtagttgaagat
aaaaagaaaatcgtgataatagagcctttcgaatatcgtaaaaattctctcgaaatttct
gctggaaatatattcttctcttttctagatgctattccttatacctctcaacttccaaaa
atcgaattctcgagtgcaaagatacttgcagcagatgaagggggaaatttaattacaagt
ccagataagaatgcattattaatttttaatattaaatattctattccgaccagatctcaa
ataacctttaccatcgaagctttaaatcagacattcaagtttcttgctagagaaaatagt
ggtaagaaattactgaaaataccattaagtattaacaatttaaagcttttagatgttcca
gtgaatgtttacgctcatgttgatgatcgactaattgcgtcattagaatttttagcacca
ataaaaatagtaagaaaagagactactttaaatcaaaataagattactattataaataat
agcgttaagaaagaaattgtcgtaataaaaaatgggatttttgagtggaaacagttattc
gaatatcctttagaatacaaaggaatactgtttggaaaagaaggtgaaaaaatagaagtt
gacggtgaaaagattgttgtaagagaaggatataatttggttaggattgttaaagataat
gctaattatgctagagagtacttagtgatcggtattaaaaaccccatcaagtcagttaat
gctgagttgaaagagaatcagataacagtaaaattagatatggaaactaatattcctttt
gaaatattttatgggcctcactcatttaggggtatatctaaagaagagactcagattact
tttccgatagaacctatatacaattcaataaaaattagggcctatacgcatggtttcaca
tatgagtctcaatacgaatttgttgatactattaagttatcaatcttgatggctttaagt
gaagcaaaggctataaaagaagttttaagtaatttcggtattgtg
>SSO0122 (sun-2) Sun (fmu) protein
ttgaaggacatagtaaagtttttgtctactgtgttatattacgtagaacagaagaattat
cctttagcgatagcatttaaacgagcatatctgcataataagccaaggaagatagattct
aaccttttatatgaatatagtaaaagactaatattatcgtattatgcactacctcaaagc
aaaaggtcggcaaaggtaagatattggcttaaaaatagggaaaatattgaaattaaattt
cctaaatggatggaggataaattgtttacattattagatgttaacgctcttaaaagaaaa
ttaactgaaagatggatatgggcacgtataaacttgcttaagactgatattgataaagtt
tatagaatgttagagagtcaaaatatagagtttgagcccgataaggatttttattatatg
atcaagataaatagatcttcagtaagactatcttctttaagtatagtaaaagactttaaa
ttgatacttcatgataaagctagttctatagtggtagaagcacttaagccggagattagt
gaaaaattagttgatctctcttcagcacctggaattaaagcttctctatatatgatgcta
acagaaaatagggctgaaactttcctagccgatgttgacttaaagaggttatcgaaagag
tataatttgctaaaacgatgtggagtagatttgcgtaaggttcacataatatatcaagat
tcaacaaaaaatagcatcataaaatcagacaagatactattagacgcgccgtgttcttcc
tctggaatgataaataacgatccttcaattttattgaaattacgtaatggcgagaaaata
gagaaattcactaaattacaaaaatccctactaaatgaggctttaaagattaagtccaac
aaacttgtgtatgcggtatgttcattgtttccagaggagggtgaaaaagtaatagaagat
tattatgaaatagctgaaaaaccattttctaattatcaatctggctattccttattcaag
tcagggaagagatctaacagaaccttccctcatattgattccactgagggattctttata
tcaaccttgaatttaactaaatta
>SSO0123 Hypothetical protein
gtgaggttaagtctaggatatgtgaaagagaaggagttagaaattatagcccccttattg
aataatgaaactaatagaaatattgagtttaatctgatacgtgttaaggaagatgaattg
aaatttaaacttaaagaattagatttggcttttatacctttacctttaacacttttttat
gaaaatataagatttataagtaatggtgcatttgtagctaataaaattggattaaagatt
ataaatagtagattttctaaattgtgtatcaatagttccaactcaacggagtattattta
tttaaaacacttacaaattataaaaatccattagagatagttagaagtgaagtatgtaat
gatgctgatgtattaataagttatgaggattatgacatttctttggacgaactttggaga
aaaaattgtggcgatcttcctttagttataagcctaattggttctttacgtctagatgag
caaaccctatctaaagtcaaggtagttattagagaggcagcgtctctacaagagtcaagg
ggaagaatctcacactatagtaaagagttaggtcttaaaggaagacaagcgatagaatgt
tttttccaactctgtttaaaaagaggtttatgtaggagttcaatctcacctcaaattcta
>SSO0124 Conserved hypothetical protein
atggaagccaaaaaaatcctgatcgtaggtgccggatacgcaggacttaacgcctactat
gaactaggtaaacatctagataaaacactgatagccgataaagctcaatttatattttac
actgcgtatctccaaaaactcatcttcaataaaagtattcaatatgcgaccaatataaaa
ccaacaattataaataaggtaaaggaaattgatttagaaagaaaaatagtgaaaatcgaa
aatggcacagaaattcaagggcacaaattaatcctagctttaggctgtaaaagggaatca
caattagatatcataagaaagataatagaaaaggatagagtaagtataagtgtagaaaac
tatctagatgagtatctgggtattcaactagctttttatctgagaaagttaaacaaagaa
gtctcatactatggcccagtcttaaaatggttaggggaaaaagtaagtagtaaagttctt
gaattcttagagaagaatggaataagactttcagaaaaatctgatgatattattcctgct
tgtgaacctaatgaagtaattggagatttcctacctgtaaatgataaattagaatacaag
aatggtgtctttgtaatcggagatatgataaagaattacccaaaattaggggaattggca
atgagagaaggtgtatatgtaggtagattattatctaaaaagattaatgaaagctttagg
cctatttttatcaatattattgatactggcaaaggagaggccatacatataaggtcgaat
attttgtggaatggaaattttgaaagtgttaaagtatcaaaaataagagtaataatgaaa
aggtttattgaaaggtattatattatcagaaagggaaaaatgggtgtgctttacaaatta
>SSO0125 (ubiA-1) 4-hydroxybenzoate octaprenyltransferase (EC: 2.5.1.-)
gtgagctgggatcctggcggattaaacaagaacacaagaaataaactttacattattttg
cgattcttaaggatagagcaaactttctttagtttgcctatggcctatttaggcgctttt
gttgcgattaaaggaattccaccaattccaacgttaatattgatttttttggctttattc
tttttaagaactgctggaatgactaatgataatttagcagatatagagatagatgctaag
aatcctagaactaaaaataggcctttagtaactggtgcaattaaaataagggaagcaagg
actatgatcgtcgcttccttgattttattctttattacttcatattttgttaatatctgg
gcgttcattctagctcctattgtagcgttaataataatgtcatacccctatatgaaaaga
tatactgcttttgctaattatcatttggcatcaatccaaggattagccgtatttagtggt
gcagtggctgtattgggtttgtactataattctttagatcaaatcctcttgagagttcca
tggttttttgtaattgggacaattttgtgggctgtgggtttcgatctctataatcatata
cctgatgctgaattcgacaaaaagatgggcttacacagttttgctgtggtgttaggaaga
tgggccctaacatttgccggacttaaccaattattctccgtagtgctagatcttctgggt
gacttttactatggattaggtccaatagccatatttgcaacggttcttcatggtctcata
atggcatatgcgtattatttagcatcacagaaaaatgattttggtagagcattttattat
aatatatactcgtctattgtgttaggcttaggggttgacatagatgtcatcctaggtatt
ccattt
>SSO0127 (leuA-1) 2-isopropylmalate synthase, putative (EC: 4.1.3.-)
atggcactaaaaatgaaatatgattttctattattatcattaaagcttttaaacctcccc
attatttttcacctatgttcggtgtccaagaaatctgttgaggttctagatacaacatta
agagatggttcacaaggagcaaatatatcttttactctaaatgataagattaagatagca
ttactcttagatgagcttggagtagactatatcgaagggggatggccaggatctaaccct
aaggatgaggagttctttagagagataaagaaatacagactatctaaggctaaaatagct
gcttttgggagtaccaaaagaaaggatgttagtgtaaaggaagatattagcttaaatagt
atagtgaaagcggatgtggacgttgctgtgatatttggtaagtcttggtcactgcatgct
accgaagtccttaaggtaactaaacaagacaatttagatatagtatatgatagtattaat
tatttgaaatcgcatggacttaaggtaatatttgatgcagagcacttctatcaaggcttt
aaagaggatccggaatatgcactagaggtagtaaaaactgcagagtccgctggggcagat
gtaattgctttagctgatacaaatggtggaactccaccgtttgaggtttatgagataacc
aagaaagttagggaagttctacaggttaagttaggaattcacgctcataatgacatagga
tgtgcagttgctaactctctaatggctataaaggcgggagctagacatgttcaaggaaca
atcaacgggattggcgagagaactggcaatgctgacctaatacagataataccaacgcta
atattaaaaatgggattaaatgcattaaatggtcaagagagtttaaggaaattgagagag
gtttcaaggatagtatatgaaatattaggattacctcctaatccttaccaaccttatgtt
ggtgataatgcttttgcgcacaaagctggtgttcatgtagatgctgtaatgaaggtacct
agagcatatgaacacgttgatccttcattagtgggtaacgataggaagtttgtaatttca
gaattgtctggaactgctaatctggtctcatatttacaaggcttaggaatagcggttgat
aagaaagatgaaaggcttaaaaaggctttaaataagattaaggaactagaggctagagga
tatagttttgatgttggaccggcttccgcaatactaataacattaaaggagttgaacatt
tataagaactatataaatctagaatattggaaggtaataaatgaaaataatggtctttct
atagggattgttaaagttaattctcagcttgaagttgctgagggcgtaggtccagttaat
gcgatagatagagcattaagaatggcacttcagagagtatatccagaaataggtgaagtt
aagctaatagattatagggtaatattgcctagtgagattaagaatactgaaagcgttgtt
agagttaccatagaatttactgataataaaatgaattggagaactgaaggagtatctaag
agtgtagttgaagcttcggttatggcattagtagatgggcttgattattatctacaatta
aagaagacattaaaaacagctgtagacaattatatcgtg
>SSO0128 Iron (III) ABC transporter, periplasmic-binding protein, putative
atgagtgtaagagtttataatccattacaagatgattatataaaaattcaaaggccaata
accaaaatagttagtctagatcctgcttctacggagataatattccttttaggcttagga
gaaaaggttaaggccacagatgcctttagttatagaccggaagatgcgagaagaacatta
aaaataggtagttatactcacgttaatgtcgatattttaaagcaaatcaatccagacata
atattcactactgcaggagcgcagaaggaattgacgagaaaattaattggtttaggtttt
aacgtatatcccttaccagtccccactaacattgcaagcattttaaataacgttttactc
attggaaacgttttaggagtctatgaaaaagctagagaattatattatagtctttataac
gttatagatggacttagagctaggtgttataagaaaaagataaaggtctatattgaactt
gatctaggtggacctataacagtaggttttccaactcatatcagtgatggaatttcactg
ttaggtagtactaatatttttgacgatatttccgaagcctatttcacgcccaaagatgag
gaaatcttaaagagagatccagatattataatttatgaaccaaaaaggcttacagattac
gaaaaagagagattttattcgattttacgaaaaagagacctatttcaactactaaataag
cgtctgattttcactaaaggtgactatttagctcatatgggacctagtttcataactgat
gtattgatttggcttaaatcagttcttttttctcagcct
>SSO0129 (cbiG) Cobalamin biosynthesis protein G
ttgtatgtatcaaggattctagttaacggtgttaataaagatctggtgaagcaaataaag
ggattgttcagtgaacttggatattggatcgtctataatgaccctgatattataatttct
gttaattctatcaataataccataaggaagtattttgcaaagtttcataataaaattata
ataaacgttgtaccagacggcagttctgtaattccgttgacaaaagaacattcaggtggt
tccttaatatccagttttttagctgactccttaggtgcgaatttagtcttaacaacatct
accggagttaagggattatatagtgtagaagagtttagctggcttaatgggttttctatt
tatggctatgatcgcaagattgtgaactccctaaataagaaactggtaactgaaggaaag
gttaatgtctacgtggactcttataagggcaattatatattatatgatggatactcatta
gttgaccataagacaaaagcggatttaataatttctgaaaatgttgatagtatggaagat
aagagcagtaatagactatacttaataccttctggaatttacattggtataaggtatcta
gaatctactcccctagatgttcttgtttattccttaaggatgaccttaaaatcactttat
attctaaacgatagaatagattatatagtagttccttcttcattaaaaaacgataagaaa
ttacatcaaattacgaaatactattactctaatattatatacggctctgacgttgatgag
agaagttcttgtgaggcattgcttaaagaattaaaagttaaggttttactaaaggatgtg
cgaagagcattcggagttataacttgccttggagttaaa
>SSO0131 Conserved hypothetical protein
gtgatcgttatatattatatccaaattttcctttccatcataatgcttattcatacttct
attctagatcttaaatatagagaggttgatccaaaaatatggatttattactctcctctt
tgtttatttataatttttagttttcacaatttgtttcttcctatatatttatactcgttc
ataattacgaatctcctattcttaattttgtataagctttccctactaggtggtgctgat
ctatttttaaacgttatacttagtcttgccaacgcttcggttatttccctagttcctagt
cgttttttagttataggtctagagcctttagttatagtactatattcatcaataataatt
cttatatttagtttaataaattttgttaaacagtataaatatgttagaaatcttcccttt
tctaagaaaattcttttggcattatctgctaagagaatcaagataagggactttattaac
tcgaagtttttatttcctttaactgaagtaaaggaagatggttcaataatgttgagagac
tatttttcagtagaggaagacgataagtattggcgagagctttattcaaaattagtcaat
gaaggtaaaatttcagcagatacgtacatatgggtagcttggggtatcccagtaattcct
tttatgttagcagggtatataatgtcgctgattataggctttccaatt
>SSO0132 Hypothetical protein
gtgggggatcttcctcccggatcttacttggctgacctgatcatgggagaccataccatt
acagtaaagttgttagtactggaatataaagatagcaggctcaacttttacaccacggac
ctgaacatggaggacgagatgatcgaggttacctggaagatcaggtgggagatagagaag
ttgcatagggacgtgaaggccttggacatgcaggactcctccttcctcaagaggcaaagg
tttcacggttacctgctcctcttcgtgatggtggtcaacgcggtaagggacctgatcggg
tcccttaagctgaagagcgtggaggagctcctcaagttcattgaaaatcatttaggaggt
gcaccgggtctgatgaaaatgtttaagctacgt
>SSO0133 First ORF in transposon ISC1212
atggtaaaggcaatttcaactgaaaaggacctcttgctcaaggtagataaatccttccct
tgggaaacgtttaggagtaagcttaagtccctttactccaagaagcccaagtggaacgtc
atctcactcctcaaagtcctcctaatcaagctcattttcgacatctcctggaataacttg
gagggagaaattagggacagtaagaggtttatggacttcttgggcgggaaaattccacca
aagagcacagtattctccttctacaagaaacttcaacaaacagttattcaagaaggcgag
acgatgagaacaacactaatggatgagttaaacaaggctttggacaaggtgatcagcgag
tatagggaaaagggctttgaacttgaagttgggagagaaaaaacgataggttctaggact
accaca
>SSO0134 Second ORF in transposon ISC1212
atggggttcaatgacgtttttctcctcatgggttatactacttccaagctcaagaacttc
acagcctttaggaagtataagggtagttggggtaggaagcacggtaagtcctacttcggg
tttaaggtctgtaaccttgtggaaaggaggactaatttcgttaggggcttcaaggttgga
ttggctaatttgagtgatctagccttttcatttgataacgttaagttaatggctgatagg
gcttggatttccaggaaggacgtcttagttaagggtgttggtagtgctagacttccggtt
gagggtagtggtgttaagattagggaaggtaaggcttcgtctacaaccttaaggggagtg
gttatggaggtattcttccttaacctctatcgtgatctcgaaattctttcgacgaggatt
aggacgaaggtactcgttaat
>SSO0137 Partial transposase ISC1359
atgaaacatgagaatacaactaaaccggcgaagttcaaccgggacttcgccaggtccgcc
ctcaagataatttactcggtcctcactaaaatacttttccctgaggaactcctcagtgcc
ttgcttaaggcaagtgggagctacttgagcaggttgggaaaagatgggagaagagcgttg
agaaagttgaacgcggttcaagttgaggacgtgagggatgcgttgaggaagatggggagg
atgacgttaaggggagtcagggacaggagggtagcagtggacttccatgccatacctcaa
taccacgctgacaagagtttcttgagtaggataaagccaactaaggggacgtcgtgggga
ctggttcaagctgcgatcttcctcctggggaggacgaggagcttcttggacgtgatccca
gtgaccgtgaagaacgtagctgaaggtttcaaggcggtgatggaggtaattgtgaaggag
ttggaggaggacaagctgaggctcgtcatagtcttcgcggacagggagttcgcggtgaac
gaagtgattagatacctcttggagttgggcttggacttcgtcatatctgccaaggcccag
atgtacaagaagtacaaggggatgttgcaagatgtggatgtgagttttggcggagttaga
tatactggatttctctgcgtgagacatgggagtggagcttatctcattatcctgaggaag
gaagacggcaagattattgccttcctcgtgaggaaggagatggatctttatgatgccata
gtccttgccgagatgtacagggagaggtgggggatagagaacgccttccgctctcttgag
gagtttagggtcaggactaggacttgtgacgtgacgttgtccgatttgagcaaaattaaa
agccattataattacaacgtctcatattatactattcttcattatattcaagta
>SSO0138 Hypothetical protein
gtgattttatggcaaaaattaaggagttgccaaagtttaaaaagaaatccggaaaaccat
aatacgggtgaaaaagtgaatgggaaaaaaagcggtaggagtatgggattaacccgcgct
tttaaatgtgaaaatataattttacgggaaagaaaaggacggtattatgtctataaattg
gaaacgataaacggtgaggtaaaggaaacttatgttggtcctttagctgacgtggttgaa
acatacgaaaaattgaaagatagcagtgggggtgtgggggtatcccccacatgggcccgc
tgggacttgaacccaggatcttcgccgtgtgagggcgacgtcctaaccaagctagacgac
gggcccttttac
>SSO0140 Primase (Carboxy-end fragment) (EC: 2.7.7.-)
ttgagtaaaattggtgaaacaccactggacatggggttaaaagatgcgattataggaatt
ttcatatggaataaggaaaagggaatctttgaaccttttgagaacagactgaggaaaaaa
gcacgtgcgttacttgaatattatactgatttagctaatgatgagctaaagccgtatgtg
ataagcaaaacaattatcgataatgtagtagatgagatcaaagataagacattaataccg
ttaccaaacgaaccattacgcgtggcgtttcccaattgcacattagagtggaagatatcg
cacgggcgatatgtaccatcttttgttcttgctgaggaaagaacaccagaacatttcgca
tttcattatattccgcataagattcacctggaagagttggtcaaaattaatgaagaagtt
cttagcgcacgtgatataccaatagatttgatagaagatttagcacggcggttgtgtccg
aaaagcctggaagtgttcaaacagtgggcgaatgagaaatgggttacattgtttgaaatt
ataggttatacattatttccaaagatagagtttagaaaagcctttatgattttaggacca
agaggcaccggcaaatccactttcatcaatctaataaagaagttactagggcgtggtaat
gtagtgaatattccactacatatattatttggagataaaaatcgattcgtgttagctgaa
ttataccataagttggttaatgctgtaagcgaaacaaaggagtacaacctagacgatatg
gatactcttaaggtactaacgggcggtgatcggatcacggcggatgtaaagttcaaagac
cctataactttcactccttacgcaaagttagttattgcatcaaataagccaccaacaata
agagataaaaacgacatggcattttggcacagatggttgattatcgaatttcctaaccaa
tttgaagacaacacggcgtggggggataaaacattcactgaagatgagttagagggtatt
ctaacggtttcaattttggcatttagtagagtgttgttacatgggaagtttgactttgag
cagacagaggaagaggttagaggaatatggctttcaacaattgattatgtgtacaagttt
gtgaaagagaagctaaagcacggtgaaattatgataactaaaaacgctgatgattatgtt
agagtcaaagaattgtacagaatgtatctggagtattgttctacgaatggctataatgcc
acaacgtataaaggtttcgtgagaagactcagggactatttcaacttaactgtagtaatg
aaaaacgtagaaggaaagagattcagagcagtagtaggtatcaaaattaacacagtacaa
acaaatgaaaccacgggtggtgattatggggaattccttaactacatcttgaagaacaat
cacatgattaaggaattcgctgatctggtcagggatttcggaagtactgaaaaggctaat
gtgtttatagatttctgcacgaagaagaacatgtgttttagccgtggtatagatgcatgg
gaaatatctatccaaccacgggggtttagtttttta
>SSO0141 Transposase ISC1439
atgcaaaccatgatattacccaaaacggagctgaagtccctcgctataactttagcaaca
aacaatattaacgttatctctcaagatctagacccggaaatagtgaaagcagcaccatcc
ttgctaaccggaaacagaggaaaatactacttgaaggtagtaagacgaggcgagaaagta
attagtaaaggtcagagaaccttcaagttctacccaatctacagagaagtaaagggagag
accaacgtagtcgctgtagatgagaccggattaaccgtgggagaaaaggaacaagaaaaa
gcagagggctttctactctacaactggaagagaaaaggagtaaagatgagatccttggac
ctcgtatatcccttaaggttacccctcctagtggaggtagcagatttgagaagcgacagt
ccatcacagttcctactcaggagcgtgagggaagtaagccaatacatggaaatagattac
gttgtagctgacgccggattcttgaacctaggggtcatcaaggaaatgcccgtgaagacc
attgtgagaggaaagtcgaacttgaagggattcaaggaactatctaacgttccattagtt
gagaagagatatgaggttaaggacaaggtttacgttgcgtatagggtcttggaatttgaa
gggctttattattacgatgtggtttacgttaaggggaagccgaggcacttcatgttcgta
acgaacttcgagggagatccctatgaactggctgaactctataggttgaggtggcaagtt
gaggagggttttaaggttaggaaggcaaggataaggtatgttaggaagttgagtaataag
atcttcttgttcctctattacacggttctggattctgcgtggaatctagtgaatcatctt
ctctttaacttcaagtccacgtgtaagaaggttttgtccttcgattcattcgtcaagctt
ctc
>SSO0142 Primase (Amino-end Fragment) (EC: 2.7.7.-)
atggacaaaatagagtgggctaaatggtttattgacacgctaggttttgcggtaatccca
attgacagagatacaaaaaagccgaccataccaaattggcaacagtatagcacgcgtgct
ttgactgatgaagagaaagagaaatttccaaagatgatcgaagaggggtataactacggg
atcccgggacaaatgttagataagaatcgtgcactagtgattttggattttgaggataag
gaacttctcaaagcctggataggtgaaagtgagctaaacaaattatgccaaaacacacta
tgcgtgaccacgccacataacggtttacacatttatgcgataacagaagaattcccggaa
tacaagtttaatccagcgtttcttagggaaaataaaaacgtaatggatttgcaaagtcta
aaatcatatgtggtagcccccggttcttgtattaaccataagttctgtgattcggcaaaa
tgcccgtggaaaggacaagattatgttacatgttattacgcagatatcacgccggagaga
gctaaaataaatgagatacatctgaaaggctttctaaagtatctggtagagaaagggaag
aaattaggaataacacccgcgagtggattgttagaatggttaggcggtaacaagaaaagt
gatactgaagaagattttgagaaactaaaggaagagatgaggaaatatgatagatataga
ggaaaaacgttagacgcgataagagatgaattatgtaaggcaatcaaaaagaagattgaa
catgctgaagaaaaagcgaaagaaacgctaaatattgctaaaggcgtgctttgcgataaa
aagacatacgcggatataggaatagatagaagtagaggggattggcatttactgaacttt
ttgttaagccacggggcaacagatctagacgtagtaatgcaattactaccagaggatagt
aaggtctttgaacctaaatgggataaatatacgtttcacacggtggccaaaatatgggaa
agagtgaagccgtggttaacggagttcagaaatggcgacaagaagacagaacttaagcta
aggggggctttaataatatctaatctcttaaggaaaaaatacgtaatcagaactttctat
caagacatggggcagtggtgtttcaccaaattatttcatttgaaagatataatattagtc
ctttcaaaaagagat
>SSO0143 SSV1 integrase fragment homolog (orf D-335)
ttgaacccaggatcttcgccgtgtgagggctctaaaaagggagttgaaaggtgcaaaatg
actcttgttgccattttacgacagtatagtgctgactacgcccaagaattttacgactat
ttgctgaatgaaaggaaaattggcaataaaacggcaaaagagtatgttagtgcggtaaat
agaccgtacaaagagaccgataaatcgcaaaaggcataccgcatttttgcaaagttctta
gaatcacgcggtgtaatttcttctgaagaaatggaaaagattttacgcgtcataaaggtg
aagagaagtaatgctgatttatacattcctacggaagaggggattaggaaaacgctgaag
ttggcgaaagagtacagtgaaaatgtatatttcgtctataggatagcgttggagagcggt
gccaggttgaatgaaattttgaaagtattgaaaaagcctgagaaagatgtatgcgatagt
gctgatgatagtaatggtagaattagaagtaatggtagtgctgatggtggtatcagttta
tgttattatccccttagttggattagggggagtaaaggatctttttacgtttttcacttt
tccccacttcgaaaggtaacaataggtgaaggtgctatagctggctttgagagaagaagg
gacggtgctgtggcaataaagtatgttagaaagttcgtagcatctaaaatggctgagttg
ggaataccgttagacgtgatcgattttatacaaggtaggaaacctactcgcgtgctaacg
caacattatatttcgcttttcggaatagcgaaagaacattatcgcaaatatgcggaatgg
ttaagtaagagtggggtgttaagtgatgat
>SSO0144 (arsB) Arsenite transport protein
atgctaataagtgcactaatagtcatggtaataacatactgccttataatttctagaagt
attacgaaaattccaccttgggcttctatgttttttggtggtatccttatggtaattcta
ggtataatatctccagaagaagctttacaatcaataaatttagatgtaatattatttctc
attaccctttttacatttgcatcagcgttagaggtttctggatttttgaaattccttgca
tataagattatagaaaaattcaaggaacctaggaaagttctcttctatattcttttatat
tctggtctattatcaaatttagttaccaacgatggagtatcagcaagctggactccagtc
atcttagaattaagcaggatgataggcgtttctgaggttccttttctttatgcattagct
gttggtgttactattgggagcgttataatgcctactggcaatcctcaaaatttactcata
gctttagaatctggaataaaaaaccctttcattacatttacaatatatttgaccttaccc
tcaataattagcttaataattgcttattttatactctttcgtctattcagaaaatccttg
tctttaccaagtggaattaatataaaaaaagaagaagaggaaaaggttgatttcgataga
agacttggatatctgacattaaccttattagtagttaccataatattatttttttcctta
agtttctttaaaatagatattttactgggttctttagttacttcatctatcttactgctt
ttaacggaaaagaggagggatattgtaagaagaatggactggccaactatactatttttt
atcggattgttcatatttactgatggagtattaaaatctgggattatacagtatttatct
aattttcttccccctccagatagtgtggctagtataatgattgtaagtattttactgagc
caagtattaagtaatgtaccattggttgcaatatacataccgatcatgatctctcatagt
ggtattacagtggtggattggctagcgttagctgcgggtagtactatagcgggtaacttc
accatattaggcgcagcaagtaacgtaataatttctgaagcttctgagagcagaggtgga
aaaggatttaatttcgtagaatttatgaaatatactattccgattctaataccaaatgca
ataatcatttatttgtttttagtattattcagg
>SSO0147 Hypothetical protein
atgattgtcgtaataggtgcagggatatctggattattattaagtaaaagagttaaagct
gatttaatattggaagagcaacctgttattggtggcgtcttcgcttctgataacgtgttc
ggaaaagatttaccttacgtgttaccaataataaatgaccctgcgaaactaccaaacata
gaatttaactatctagaatacgatttgaaattatctcatagaaaatacgattattttgaa
gataaaatttgcaaatactgcgataagttacctacatggttaaatttcggtttgatgaga
aaactatacgtaatagagaatataacagcttttatagataatttatctaaaaatgtaagg
ataattaaggaatatccgataaggatagacgataagaaaatcataaccaacaagggaaat
atgtataagtacaccagagtatataatacggcatccttaaaaaaaatgtataaattacta
ggagtagatagctcaaatctaaagcataaggcagcgttaactttgctaatattaacaagg
aagacaaataataaaaactggaatgtttacttaagcggagacactgcggattctttctca
gtagtaattaagctagataatatcattaaagatctcgatttatattatgtttactcattc
atggatataactcaaaagagtattgatatagatagagtaatgctagatttaaaaagaaga
caaataatctctcttgatgaaataatagcctttagaagtaaattaatatcagaagctctg
ttatttggcgagattaatcataagattacactaaacatggtaaactgtggaagactaggt
gagtggaaaaattatgacgttattgaaactatatcaagaattcagaattgc
>SSO0149 Conserved hypothetical protein
ttggtgaagaagaaagtgaagaggagtaagatattaatagtaggaggatttacgatagac
gagatacaaggaaagataagaccaggaggaccattaatatattcatcattaggcgtaatg
agaggtggtggtataccaaaactatatggattaataggtagagattttgactttgagata
gattttatatctgatttagagaagcaactgatatatgatgaatatacaattaggtttaag
attgacttaactaatgaagggagaaaattaatcttacttaagaagcctaaaaataggata
aaagtgattagtgacaacacagttgatggaatcctagtaaatccagtatgcaaagaagtt
gacaatatgagtattcaaagcccaattccaatagcagtagatattcaaggtttcgttagg
aattgtatagagtatgaggaaattaggtatgaaatgggttttagatttccattcaatagt
aattacatggttatgcatggtaatagggaagaacttgaatcttctaaattagaattaagt
gatctattcaaagtaggttttaaggaaataatagtttcagatggacataacggatttaat
gtttatactaatatgctcgcaaaatatacctacagacctagtaaaataggcaaaaacgaa
atagggacaggagactttttgctaggagcgtatttcgcgttaagattaggtggacttgaa
attatcgaggcagctaccattgcaggtaaactcactgaggaatttagcaattctgaattc
ttgata
>SSO0150 Hypothetical protein
atggtagttcggaaagaatgggtacttaatattatatatttaatctacataactatacta
tcaatgtcaacgagatggctacctaagtggaaagctatagagattgattataataataag
aaagtcacagtttgctatgatgaagttaccagactttacgtttgtcctatatgctcaccg
aattgtgccaaaggtgtatcgaccgattatagtacatattttttcaatttagaagatttg
aaaagacatttggacgcccacaaatacggcttatggctacagaaaaagacgagaactgaa
gaggaagaagaggaacctaagctatcaattggtgaagaagaaagtgaagaggag
>SSO0151 (hpS-1) D-arabino 3-hexulose 6-phosphate formaldehyde lyase
ttgtcatcttctctcgatgactatcctctttctttaaagacaatgtacgatatagctgag
tttatactcagagcggctaaagcaataaaaccagaacaaacaattaagatggtaaatgaa
ttagaaaatttctataaaaataaccgaaatggaaaggtattggtaatgggggctgggaga
agcggactagtaggaagagcttttgctatgaggttacttcatttaggttttaactcctat
gttctaggagaaaccatagtacctgctattggaaagaacgatatagtagttgctatttca
ggttctggtagaactaaactaattctgacagctgcagaagcggcaaaagaagccggagct
aaattaatatcaataacaagttatttcgatagtcccctagcaaaaatatctgatgtggta
atcgaaattccaggtaggacaaaatactcaaagaatgaggactatttcgctagacaaata
cttggaataactgagccgttagcaccattaggtacactatttgaggatactacgcaaatt
ttcttagatggtattgtagcagagctcatgataaggttgaagaagactgaagaagatttg
aggttaattcatgcaaatattgaacta
>SSO0152 Hypothetical protein
atgggtatagaaaactttaccgcaaagatcgttggattatcaatagtatcgctgcttgta
gtattaatgtttttatacaagttaatatacataataccacttatttttatagtattactt
gtatttcagagtgagaagaagatttttgcttttctatcaaagaatacaaaacaaatacaa
ccgtatagtattgaagatggagtattctacaatgaaaagaacgctagtgcggttttaata
atagatgatatacaaatggattataaagattttacaaattctaacctaagatcatttata
tcatctttccataaaattttagatatagcaaaggatattaatatagtattaaagagagag
agcttagataaaaacgtatacatagaatcactttcacagaaaatacaagcacttagaata
atgattgatagcgatccttcaaatgagaaagctaaaagaaagctcgagctgatggaaact
ataatatcaagaatcgaatccggcgagaatccatttagatatgaaatgtacattatcatt
aactctagagataaaaattctgcgttatctactgcatccatgatcagacaaggactagaa
ggtcttggcataaaaactcggctagccacattacatgaaatacagaagttagtaagggat
ttttttcattcaaaattaaatcttaacaagattgcattacctactcagattccatatcta
acaccgatatccgtagagaaaaaacccaaaagtagtattataattgatggagtactacta
ggaaaagatataaataataatggattagtattttggaatataaccaaaagccagaacagt
catctattaattgttggacctactggttcaggtaagaccgagtttttaatctggctttcc
acaatactaaatctgatctatggaggcaccgtaatcctatttgacgtaaaaggggatata
aaatataggctttctatgtataaagtgccatttcagttaataaatccgttattttatagg
ctaggacttcttgatgagtatgatatcccaattaggattaagttacttcaaatcgagaaa
atacttcttaattctttcagattaagcaagtttaactcctccattttatacaattatcta
aatagattaatagatattagctacttaaaatatagaattaaatggaaagatttagagaaa
tacttaagtgaaatagatgatgtacaactaaagtactatctaagcaaattaataaacatc
ttatcctcaatggaagattcggaattaccacctttattacatggagttaatgagaatgag
attaatctgatagatctcactctaattaagagtgaagaaataaaaagactcataatatat
acacttatacaggaattatataataaattttcattagaaaaaatatatgataaaccaaga
gtattcttagtgttagacgaagcatggactattttaaaaaacgaatcggaagattatcca
attgtggcagacttgataaaaagaggaagaggatatggaatttccattataatggcgaca
caaaatttagaagatctaggtgacctagccaatatatatttagataacataggagtatca
gtatttatgaataatggagataaaaaattctgggaggagataaggagattcgttaatgtt
gataacgatacgttatctaataatttgatattcatgaatagaggagaggccctcgtaaga
tttttaggagatcctaggccagtaattataaaattaaataccttagccggtagctcgttc
>SSO0154 Hypothetical protein
gtgatgagtgttaacactgatgaactaaaaaaattccttgagagtaagattacaagctta
agaaaggaattggaattttatgagtttctattgagtattatagaatccggttatatacct
accataaaaggtaataaaggtagcatagaatatataaagaataagaagggtgaaattcta
gccgagatttattttactccacctgtagcaaaatttgttattaaaaacaaaatcacgtta
agcaagtcatatttttcagccttaagtaaaattctagaatcagagaaggaattaaataaa
atagattatactattgaaatggataaaaacgatatacgagagatagttctaaagaatgta
aatagcgatataatctataacaaaataaaaacaggtatacaagctattttagaacgagct
accggc
>SSO0155 (argC) N-acetyl-gamma-glutamyl-phosphate reductase (EC: 1.2.1.38)
atgaaagataaagttagagttgccgtagttggaggttcaggatatacgggcggagaatta
ctaagaatattagttacacatccgaagacagaaatatcagtcataacttctagagaatat
gcgggaaaaccagtatcattgatacatccgaatttaagaggactaatatctcttaatttt
acaaatttctcaatagataagatctcagacaaagctgacgcaatttttcttgctctacct
catggagtatcgttaaattacgcgcctaaattactagatttaggattgacagtcgtggat
ttaagtgcagattttagactcaaaaatccagaactttataaaatatggtacaattatgaa
catccttatccagatctattagacaaggcggtatatgggctaccagagttacattacgag
gaattaaaaaatgctaaacttatagcatccccaggctgtaatgcaactgcaactatacta
gcgttagccccaattgtggcaacaaaaataactgacgagaaaaagttcatcagcgacgta
aaagtaggcagtagcgaaggaggagcaaaaccatcagaaggtagccatcatccagagaga
caaaatgcaattagaccttatgaagctgaagggcatagacacgcagcagaggctgaacaa
gaactgtctagaatagctaaagcaaatataagcgtgagtattgtccctcatgcagtgagt
agcatcagaggagccttagcgtctgcacatacgtggttaactaatgaactagaagagatt
gaaatatggaaaaaaatagctgagttttataggggtaagagattcattagaataattagg
ggaaacatacacccatatcctgatccaaaattcgttatcggaagcaactttgctgatata
ggattcgctgtagaaaagagaatttcaagactaacaacgttctccgctatagataattta
atgaaaggcgctgctggccaagctgtccaagctttcaatatttctatgggatttaacgaa
gatgacggattaaaactagtacccttgaggcctgcc
>SSO0156 (argB) Acetylglutamate kinase (EC: 2.7.2.8)
atgatagtagttaaaataggtggaagagtagttaagaattcattagataagataatttta
gatatattaaatataaatgacaaggtaatcttggtgcatggaggaggagacatcgtaaca
gactacactaaaagattaggaattgaaccagttttcgtaacatcaccagaaggtataaga
agcagatacactacaaaagaagaattagaagtttacattatggcaatgagccttataaat
aaatcaattacttcaaaattgtgcagcttaggtaaaaacgctataggaattactggcgtc
gatgggggtttactgctggcagaaagaaagaaaagaatagtcgttatagacgaaagagga
aagaaaaggataattgagggtggatatacggggaaagtaaaagaagtgaggagtgaaatt
ataaatcatttagttaaattgtttgatataatagtagtatcacctatagcgttagatgtt
gaagagagaactccactaaatattgacggagatcaagccgcatttgctataagtaaagct
ttgagagcaaacgtgttaatacttctttcagatgttgaaggggtattagtagaaggaaaa
gtaattaacaggcttactcctagcgaggcgaaagagctttcgaaaaaaataggacctgga
atgaatagaaagttactaatggctgccgaaagtgttgagaacggcgttaataaagtaata
atagggtctggagttaaagatagaccaattatcaatgcattagaactcaatgggacggtg
atagcgaatggg
>SSO0157 Transcriptional regulator
atgggtaatgcaaatattgatgaaagtgatttaaaaatattagagattctgaaaaagaac
gccagaacaccttacacattgatagccaaggagcttaaggtaagcgaagccgcaatacga
aaaagaatagagaaattaatacggcaaggtataattaagagatttactatagaatatgag
ctagaaaatgagattagagcaatagttatggttcaatctacgccacaaataccgacacca
gaaatatctaaaaagatagcaaaaattccaggagttgaagtagtatatgaaactactgga
gattatgatattctagtaatagttagagggacaaacattacatcaatcaataggacaata
gatgagattagaagcattcaaggtgttgtgggaacaaatagtactattatccttagaacc
tggttc
>SSO0159 (rimK-1) Ribosomal protein S6 modification protein
ttggggagagtgaaaataggaattctatatgacatgcccagatgggaggaaaaaaacctt
attgaagaggggaaaaaattaggttatcaagttgctactatatatagtaaggattttgtc
cttttttcaaatgattttactatcgataatgatacagatctttttatccaaagaaacgta
tcacataacagagcccttattacttcatttttagtagaacaagttggctatcctgtaata
aatgaccacacgactttaattagatgtgaaaacaaaatttttactacctatattttagct
agacataatataccaacacctaaaactttcatagcattcgataagacaaatgcaatagaa
tattcaaaaaagctaggctatccagtagttataaagcctgttgaaggaagttggggaaga
atggtagctaaagctgataacttagacgtactatatagctatctagagtatcaagagttt
agcacgcaaaaatataaggatatatattatatacaagaattcgttaacaaaccaaataga
gatataaggatattcgtaataggagacgagacgccagttggaatttacagagttaacgaa
aacaattggagaaccaatactgcattaggtgcaaaggcctatcctcttaaaatagatgag
gaactcagagaactcgcattaaaagtaaaggacataatagggggtttctttttaggaata
gacatttttgaagataaggatcgtggatacctcgtagatgaagttaatggagtaccagaa
tacaaaaatactgtaagagtaaacaattttaatgtatcaaaattccttttagaaaaggca
gcggaatgggtgaaaaaa
>SSO0160 (argD) Acetylornithine aminotransferase (EC: 2.6.1.11)
atgggtgaaaaaatgataaagttattaaaattctatcaagacagaggaattaaaattatt
aaaggagaagggcaatacgtctgggatgaaaagaacaataaatatttggatatgcacgcg
gggcatggagtagcctttcttggtcatagaaataaagttattattgatcatttgaaaaag
caaatggaggaaatctctactctttccttagcttttgatacaccaatacgagaagagatg
ataaaagaactagatgagttaaaaccagaggacttagataatttattccttttgaatagt
ggatctgaagcagtagagttggcattaaaaattgctagaaaaattaccaaaagaagaaaa
attgttgcatttaaaaactccttccatggaagaagtatgggtgccctatcagtaacttgg
aataagaaatatagagaaccttttgaaccattaatcggcccagtagaattcttagaatat
aataatgtagattctctaaagagtattacggaagatacggctgcagtaatagtagaacca
gtacaaggtgaagggggtgtaataccagctaagaaagagtttgtaaagagtttaagagaa
gttacggaaaaggttaacgctctgttaattatagatgaagtccaaacgggattcggtaga
actggtaaaatatgggcataccaacattttgatataaaaccagatatactaacagcaggc
aaagctattggtggaggtttcccagtaagtgcagtatttttaccaaattggataagtgag
aaaatagaggaaggtgatcatggttctacctatgggggaaatccattagcagccgctgca
gttactgcagcatgtaaagttgcaaagtccgagaagattgcagaacaagctcaaaagaaa
ggagaactatttatgagaattctaaaagagaaattagaagatttcaaaatagttagagaa
ataaggggacttggattaatgataggaatagatttaaaggtcaatccttcgattgctata
aaagtcttacaagatgagaaggtattatcattaaaagcaggacttacaacaataagattc
ctacctccgtatttaataactcaatcagatatggagtgggcttcagatgctacaagaaaa
ggaattagtgaaacagaaagcaaaagagttgcttct
>SSO0162 Conserved hypothetical protein
atgctacaagaaaaggaattagtgaaacagaaagcaaaagagttgcttcttgatctttta
tcaatatacacaccgtcaaagagtgaagcaaacgctacaaaattctttgagaaaatttcc
aaggacttaaaccttaaacttgagattctaccagactcaaattcatttatactaggagaa
ggagatatactgttagcgtctcacgtagatactgtttatgggtatattgaaccaaagata
gaaaacgaactaatctatgggagaggcgcagtagacgccaaaggtccattaataagtatg
ataatagctacatggctacttaatgagaaaggaataaaagttagggtaagcggattagca
gatgaggaaagtacgagtataggagctaaagaacttatagcgaaaaattacaattttaaa
tatataattgtgggagaaccatcgaatgctactgatatagtagtagagtacagaggatca
atacaactagatataatgtgtgaaggtactccggaacactcttcgtcagctaagaacaat
ctgatcgtggacatttctaaaaagataattgaagtttataaacagcctgaaaactacgat
aaaccatcaatagtaccaacaataatccgtgcaggagagtcttataatgtcacaccagca
aaattatatctacatttggatataagatatgcaataaataataagagagaagatttaatc
aaagagatcaccgacaaatttccagaatgtaatcttaaaatagttgatgaaacgccgcca
gtaaaagtaagtataaataatccagtagtaaagtccttagctagggcgttattaaaacaa
aatataaagccaagactggttaaaaaagcaggaacaagtgacatgaatatattgcagagg
ataacaacaaatatagcaacatatggtcctggaaattctatgctagaacatactactcaa
gaaaaaattagcttggatgaaatatatataggagtaaaaacttatatgttggcaatagaa
gagctatggcaaaagatc
>SSO0163 Undecaprenyl diphosphate synthase (EC: 2.5.1.31)
atggcaaaagatctaactagaggccttctctttaagcctatttataaactgtatgagtta
gtattatggaatcagattcgtaatggtccattgccagatcacgtgggaattataccagat
ggaaatagaagatgggctagagataataatctttcgcttaatgacgcctatttctatggt
tataaaaaattgaaagaggtcttaatatggttgctagaacttggtataaaaaatataaca
gtttttgtgctatctacagaaaattgtgacaagagaaaacaaaatgagctatcaataata
acaacatatattaagagaggtatacaagatttactagaagatcccatcgtagataagtat
gaagttaaagtaagtgcaataggtaaactagataaattaccaaaagatcttattgattat
ctaaacagagtagtagagaaaacctcaaactatgataaaagaaaacttacgttagctatt
tgctatggaggtagacaagaaatattagatgcagtcgttagacttctggatgattataga
aatggaaaaattgtcaaaagtgagataaatgaagaaacgtttagaaaatatttttatgat
agtgaattacaagatattgatctagtaattagaacttcgggtgaagtgagaattagtaac
tttttactttggcacgtggcatactctgagttattcttctgtgaggcgtattggccagaa
tttagaaaaatcgatctatggagagcaataaggtcgtttcaaaaaagaaaacgtaacttt
ggggcc
>SSO0164 (rps8E) LSU ribosomal protein S8E
atgggattttaccaaggtccagataataggaaaattaccggtggtttaaaaggaaagcac
agagataagagaaaatatgaaattggaaatccacctacattcacaacactatcagcagaa
gatataagaataaaagataggacactcggtggaaactttaaagttagattaaaatacacc
acaactgcaaatgtgttagacccagctacaaatactgcaaaaaaagttaagattcttgag
atcttagaaacaccagcaaacaaagaattggctagaagaggaataataataagaggagct
aaaattaggactgaggcaggattagctgtagttacgtctagaccaggacaagatggagta
ataaatgcggtgctcttaaagaatgagtctcagagatct
>SSO0165 Hypothetical protein
atgagtctcagagatcttaaagaagaaaacagaatagttatctggccttcatattttttc
tcaccaactaggtctaagggaagacggctggctaggataccgtataaaataaaaaccgaa
gaattagtttcaacacttagggaacttggtctagatccgatagttatagaaaataaaaaa
tatcctagagatagaaagattaattttttgatagcggtaaagaaagttaaaagtaaaaat
tacacgttaaaaataatacacaacgcacttatgggaacgagacaaactaatcctaataaa
agtaat
>SSO0166 (galE-2) UDP-glucose 4-epimerase (EC: 5.1.3.2)
atgtacatagttacaggtggtgctggttacataggtggacatctagtcgattatttaatt
tcaaaaaatttagaagtaatagttattgatgatttatcttatggcaaatacagaaatgag
aaggctaaatttgtaatgtttgacttacgtcaaaacatgggagaactagtagagaaacta
gaaaaaaatccgataatttaccatttagctgcaaatccagacgtaagaacgtctatgata
aatgtggaggagcatttcgaaagggatgtcaaagtcacgttaaatgtaatggaactagca
aggagagtagatgcagaaaaagtaatctttacctcatcatctactgtctatggagagaca
agtaagattccaactccagaatcagaagaacttaagccaatttccaattacggattattt
aaactattatgtgagaatatagtaaaatattacgcagagcaatatggcataaaaagtatc
agcacaagattagcaaacataactggtggcagagtaagccatggagtagtaattgacttt
ataaaaaagcttaaagataatccaaatttactagagatcttaggaaatggaaaacaaaga
aaaagttatctgtatatcgatgatttaatagaggcgttcgtaatgttagagaaaaaagta
aaccggatttatgacgtttttaacataggtaataatgattcaattactgtagacgagatt
gctaagattgttatagatgaaatgaaattaagtccaagaatcacttataagaatccgaca
gctgatggaagagggtggccaggagacgtaagattaatgttattagatatctcaaaaata
tcaagggaagtaggctggtcacccaaaatgagttccagagaagtgattagacaagccgta
aaagatttgttatatggttacaagtcagtctat
>SSO0167 Methyl coenzyme M reductase system, component A2 homolog
atgcttatcattagtcctaaatatttaaacggaaagatagagatcgagaaaggagaaaga
gtaggtttagtaggtaaaaatggaagcggaaaaactacattaatactatccgccttatgc
ctagatcagactacttccaacgttacagttgatgacttggatttctgtaaggagaaagat
tattcaaagatctcggcagttttacaagatgtttcttctcaaatattggcttctacgcta
aaagatgaaatcgaattgatgaaaagattccatagtgtagatgataaaatagctagaaat
ttaatgggtcattactatgaagttgagttcaataagttgtccgatggatataaaaagagg
tacgctattgcttcggttctagcttcaaaccctgaatatatcctacttgatgaaccattc
gcaaacttagatgataaaggagtaaagtctgttagtacaatagttcctaagaatagttta
attgcagaacaccgaattgaagaattacgcaaattagtagatagggtttatatgattaga
aataataaagaaataaatgagatatcaaaggagaaattgtttgatatagagttcttaagg
aaagaagggttaagaggatttagtttacccaagatcaatagtgaattaggtaatgaaata
ttaaatgtaaatatcgataattttacgataaaaataagagaaggagaaattttgtgctta
ctaggcagaaacggaagcggtaaaactactattctcagaaaactatctaagaagattttc
gtgatttttcaagaagtagatttacaatttttttattttaccgtaagagagattgtaaga
agtaaacgtgttttatctttatttaagttggaaaatttggcagacaaaagtccatatgct
ctaagttttggtcaaaagatgaggattttgatagcgtcagctttttcttcagattctagg
gtaataggcttagacgagcctagtgtaggaatggatggagaagcgttactttcgttttac
gaaatggtaaagatgctaaaggaacagaaacggggtttaattctggctactcatgataag
gatataataagtctatgtgacacacgtatagtcatagat
>SSO0168 Hypothetical protein
atgaaggtaaaatttctctatatcctacttttttcggttataatgtatattaatagtata
tttttcaatttttttgtgccatttctggtcacattagccatactatatagaagaatatgg
attattgtaatagaagttttaatcggtattctatcttttcttatattgagttttcttggt
aaaatttttgtttatgagtatacgcttagagctttctcaattatcaacgtttttctgatt
tcaagtgaatacactgataagtcttcaataattgacttatttggttcaaagggggttcct
ctcgtaattgctcttacatattatcctagattttatgaaatgatccagaaagttgtgttt
tatgcacgaataagaaatataaacttattaaatttaaacagattattacttccaataata
gtagaaacagtgaaaattgctgataacttgtatgttgcatataccgttaagctgtttggt
aaatataattacaagagaaatttaaaaccttcaagtggggatttaatacttctacttata
ggtgtggttacgttatgcttatcattagtcctaaatatt
>SSO0169 Hypothetical protein
atgaacgataagtcttcaagtcaaatttcaatcagaagggctgtaatttacgcagcagtt
ttctcaatagcgtcttatgctgttgctgcgggattagcattatctactggtctttttgct
gtaaacatatttgctgatccaatactgaatctcactgttcctctaatactcctttccatt
ggtatacaagtcattaacagaaaactgggccctattttcataggattaattagcgctggc
ttatatgcagttagcttcttaccgtttatcgcaatacctttgattattatagcactgatt
gtagaaggtgtaacaagagttatgggttataggtctttaaaagcagtaattacgtatacc
gccattgcaggaggtctagagggtgtgttaagtactttgcttgctctatatatggtgaaa
gtccctgcacctgtaataacttcagcatatatttggactggagtagcagttggaatgttt
gctgaaagcgcactaatgggtttgatatcgttctatatcgtatcgtatttaattagagct
ggggttattaaa
>SSO0170 (ilvB-1) Acetolactate synthase large subunit homolog (EC: 4.1.3.18)
ttgacacccgttatttcgcgggttcgaatcccgcccccggcttttagaagagatttaaaa
agtagttccaattataatgttagtatgagccagcccaaaagaaaagaggagactgtaggc
gtagaaatgaaaggcgaagaagcccttgcatacgttttaaatgatattggcttaactaag
gtatttacaacttactccctaccaaatattgttaaggaaatgttaaagaagtacaatatt
gaagttgatttttctatttcagtaaaagacgcaagctggctagcttatgcttatgcaatg
gaaaataattcagtagggactataattcagataccgggctcgaagttaactgatgcagta
gatgttatagctcaagcctatatggagtcagttccccttcttataatatctagcgtaaga
tcacataaagacacaggaagggccagaattggtgaatttagaacgatcgatgatttatca
aacattttatctccaataattaagactaaagaaagagttatcagtatagaagaaataact
gttacaatagagaaagcctataaggaagcagttagtaatagaccaagaccttcttatgtt
gaaatatctgaagacttattcagggcaaaagcttatccgttatccactgcggggcaaaag
ccagagaagaggactccagataagaatagtgtagccaaagtagctgaacttttaactaat
gctaaattaccagttataattgcgggatatggagtagttttaagcgacgcagaagacatg
ttagtcgaactggctgaattaatagattcaccagtagttactacatttaaggctaaaggt
tcaataccatctaaccataaattatttgctggagaaggattaggtgcctttagcactagt
gccgcaaactatctaattgagaatgctgatgtaatactagcgttaggcactaggtttact
cagttaagtacagctggctggtcattaaagtataaaggcatcctagtgcataacaatgtt
gatggtgaggatataggcaaagttttcatgcctcatgttccaatagtagctgataccggg
ttattcttaagagaactattaactcaattaaaggctaagataaaggagaagataaataga
ggggctagtgatattatttataaaactcaacgtcaagcatacccaattacatctcataat
gatatatggcctatagatgtggtgaaaatgctaagcagtataggtggctttgagaaagtc
tatgtggatatttcggctacaacaatagatttagttagattaccgataaatgctaagaag
acgtggtatactgcagaatctttactagagagaggtatcgcggtaggtggtattatagct
tctaaatacgttgcatatggaattactgatatagagggaatattacctcatttatcatta
ctaaaatataagatggataagattaaaggaaagttaattatattaaatgatgggggcgca
aattacattgaagtttctaactctgatttacctactattgctagatcacagactagtttc
aatgccaattttgatgagattgcagaaaaagccttaggtggtgtaactgttaatacatta
actgagttagaagaggctttgaaatctgtcgataagaaaatcataaatgtaaagattgat
cctaacttcgagtcggtaatactttcaagaatt
>SSO0171 Conserved hypothetical protein
gtgcatatgttgataccttttagcaaggtaggagaagttcttcatgaattgcaagatctt
acaaaattcataataattggggataccatagtcgatatcactctaaagagaaaaggaact
gagagcgatgtagacttatttgcgcttgatataagcgtactagtagatgatgataaaatt
agaaactttgcttatgagagaggatgggactatggtagaacgccaattgatactccaaga
ctattagctccaattgatgatgaccagctacagatagatttatacgaaaatatacaagat
ttcttcgttccaaaagaaatcctagagagtgcaataaatataaaaataggaggttatgag
tttaaaagtataaggttagaagattacattttactcaaagctaatgcttttagagaagaa
gatgaagatgaactaaaaaccttattgtatctacttggagaaggtaagatcagcatcgat
aaagagtatttaaaagaacatattcaagcatttgaggaaaatagtgaaagtataaaggaa
cgtttatcatctattggaataaaaatt
>SSO0172 Conserved hypothetical protein
atgaagatgaagatccccctagattatgtttgcgttagaagtggacttctctgcaataga
tgtcagtctcttatagatagcggtgaggtatttgaatatgaagttgagataataaaaata
ttattagatctagaggaaacacagtttaaggagcttaaggattctacatatcataaagct
tacaaagtagatgatctactaatattattagttacaagtggacaagagatgactcaacaa
aaatggattaaaatagcaagaatcttacaagagaaattaaacataaaggttagagtctta
gaaaaaactaacagtataaagaatagtgcagtccaattactctcaccagccagagtactt
ggcgtaaatactgtatggatgccagatggttctgtgcagtacgtaattcgtgtatctaga
tcagaaaggagattgttaccagctgaagcacaacttttagagtcagcactaactaaaata
cattcaacaccggttagaataagggtagag
>SSO0173 (aspS) Aspartyl-tRNA synthetase (EC: 6.1.1.12)
ttgtttaggacacatctagtctcagaattaaatcctaaattagatggatcagaagtaaag
gtagcaggatgggttcataatgtaaggaatttaggtggaaagatatttattttattaaga
gacaagagtggaataggacaaatagtagttgaaaaaggtaataatgcatatgataaagtc
ataaatataggattggaatcgactatcgttgtaaatggtgtagttaaagctgatgcgaga
gcccctaatggggttgaagtacacgcaaaagatatagaaatactgtcgtatgcaaggtct
ccattaccgttagatgtgacgggcaaggttaaggctgatatagatactagacttagggaa
agattactagatttaagaagattggagatgcaagcagtgttaaaaatacaatcggtagct
gtgaaatcatttagggaaacattatataaacatggatttgtagaagtctttactccaaag
ataattgctagtgcaacggaaggaggagcccaattatttccagtattatactttggaaaa
gaggcatttttagctcagagtccgcaattatacaaggaattattagcaggtgctatagaa
agagtatttgaaatagctcctgcatggagagcagaagagtcagacacaccatatcatctc
tcagagttcattagcatggacgtagaaatggcctttgccgattacaacgatataatggct
ttaatagaacaaataatttataacatgataaatgatgtaaagagagaatgtgaaaatgaa
ttaaagatattgaattatactccacctaatgttagaatacctataaagaaagtctcttac
tcagatgcaatagagcttctgaaaagtaaaggtgttaatattaaatttggcgatgatata
ggaacgcctgaactgagggtattatataatgaattaaaggaagatctttacttcgtaact
gattggccttggctaagtagaccattttatacaaagcagaaaaaagataatccgcagcta
agcgagagctttgatttaattttcagatggttagagattgtttctggaagttcaagaaat
cacgttaaagaagtcctagagaactcacttaaagtaagaggactaaatccagaaagtttt
gaattcttcctaaaatggtttgactatgggatgccaccacacgccggttttggaatggga
ttagcaagagtaatgttaatgttaactggtcttcagagcgtgaaggaagtagtaccattc
cctagagataagaagagactaacacca
>SSO0174 Conserved hypothetical protein
gtgactcctcatgaaatagacattgcgttaggtatggaaaaatattattatgaagactgg
aacgagttagacggaacaattgaaagaccaaacgggtttaaagttatagaagagattgac
tttaagccagctcaagattggaaaggcgagacaaaaggtaaatatgcggtattcttactt
acaaaatggggaatagatcatttttccgctatatccgaagttcagaaagtactacattct
aaagtaaattatataggtattaaggatgctaatgcgataacatctcagttagtatatata
ccgttaaacgaaaaacaagaactgattgagaaatatcaatcaaggagttttattctaaag
ttcctcggattttcttcaaaaaaactaaatcatactggaaatatatttgaaatatccctc
tcaatatccgacttcgatatagtcatagagagaatagaacaaattaagaaaaatccatat
ctcccagcttttataggctatcaacgttttggtacccggaggcctattacacatttaata
gggaaatatcttttgagaagagactgggagaaggcattttatctgattttgacatatcct
tttctttccgagtcaaaagaaaccattgacataagaaagttaataatggaaggcgatttt
aaagaagcagttagatcgattccgtccaagtttaagcaagagaaattgttactgaagaac
tatatgagatttaattcttattatctagcccttaaaagtagtttcattccaatctcgtta
tatttagacgcatatcaaagttatttatttaatctgtatttatccagaaagctagacgaa
tataagaaccttaatgataaggttaacttgcttataagaatacctatctattttaataac
tgtgatgatgtttgcaaggaaatttatctggatgagggaatagaacgaaattttttcaaa
ttacaagaattcaaaatctccctaagagacctcgtgaggaaggcgtttatgaatataaga
gatttaaaagttaacgaggaaactaaaacaatatcttttgtattagaaagaggaatgtac
gctacaatattacttagggaaatcttaagaggagatccaagaaaattcact
>SSO0175 Conserved hypothetical protein
atgattaagatggttattgtcgtaaggagtgatattaaaatgggtaaaggtaagatagca
gctcaagttgctcatgcagcagtaactttagtggtaagtattattaactctaataactta
cgttggaaagagtggctaaatgagtggttacatcaaggacaaccaaagataattgttaag
gtaaattcattagacgaaattatttcaagagctaaaaaagccgaaacaatgaatttacca
ttctctataattgaagatgcaggaaagactcaattagaacccggcactataacgtgttta
ggtatcgggcctgcaccagaaaatttagtagattctatcacgggtgatctaaaattactg
>SSO0176 AAA family ATPase
ttgagcgctagttctggagaggaacagaagccgcaaagaaaggagttaatacttagagta
atggaagcaagacaaaaagatgtcgggagagggaaagtaagaattgatattgatttactc
tcacaaattgatgtaagcccgggtgatgtagtcgaaattgaaggaaccagaaagaccgct
gcgcttgcatggcctttgtcgccagaagatacaacaactggagaaaaagacataataaga
atggatggaattactaggaaaaacgctggtgtctcgattggagataaggttatagtacgg
aaagcaattgtaaaaccagccagcacagtaaaattagcaccatctaacttctcaattacc
gtagatccaggtttcatcagttatgttaagaaacgattaaaagaattccccctagttgaa
ggggatacagtattaattccagttctaggacaagctataccgtttactgtggttcaagtc
aaacctgcaggtatagttctagtaaatgacgatacaataataagcatatctgataagcca
gtagaaccttccagatatcccagagttacctatgaagatataggtggaatgaaaaatatt
atagaaaaagttagagagttagtagaactacccttaagacatccagaactgttcaagaga
ttaggaatagaaccgcctaagggcatactactatatggcccacctggagttggaaagacg
ttactcgctaaagctatagctaacgagactgatgcctacttcacttcaattaatggacca
gaaataatgagtaaattctatggggaaagtgagcaaagattaagagaaatatttgaagat
gccaaaaaacatgctcctgcgataatattcgtagatgaaatagacgcaatagcaccgaaa
agagacgaagtaataggagaagtagaaagaagagttgttgcacagttactcaccctaatg
gatggacttgaaaatagaggaaacgtgatagttatagcagctaccaatagacctagtgct
gttgatccagcattaagaagaccgggaagatttgatagggaaatagaaataccattacca
gataagcaaggaagattagaaatattacaaatccacacaaggaatatgccattatctaag
gatgttgacctagaaaagcttgcagatatgacacacggatatactggtgctgatttgtct
gcattagtaagagaagctgcaatgaattccttaagaagatatttaccaaagatagatttg
aaccaagataagatacctccagagatattagagtctatggaagttaagatggaggatttc
ataaatgcattcaaggaaatagtaccgagtggcttaagggaaatttacatagaagttcct
gaggttaaatggacagatataggtggacttgaagaaataaaagaagagctaaaagaagta
gttgaatatcccttgaaatactcagagctataccaaaactctggtatagagccacctaag
ggtatattgttatttggtccacccggaactggaaagacaatgctagcgaaggctgtggcg
actgaaagcggagcaaatttcatagcagtgagagggccagaaatattatccaaatgggta
ggtgaaagtgaaaaagcagttagagaaatatttagaaaagctagaatgtatgctccagct
gtaatattctttgacgaaatagattcaatagcgccaataaggggaatttcttatgattcc
ggagtaacagagagaatagtaaatcagctattagcggaaatggatggaatagaaaaatta
gagaatgtggtagttatagctgcaactaatagaccagatatcttagatccagcattgcta
agacccggtaggtttgagaaattaatctatgtacccccaccagataagagggcaaggaca
gaaatattaaaggtgcatactaggaacatagcgctaggtgaggatatcagcttagaggac
gtagctgaaaagactgaaggctacaccggagctgacttagcagcgttagtaagagaagct
acaatgagagctataagagagagcatgaaaatatgtatagataagactaacgagaattgt
aaacctacagatgctgaatgcagagataagactatgaaagaatgtatgaaggttaacggg
gttaaggtttccctaagacatttcgaagaggctatgaggaaagttaaaccatcagttaca
caagatatgttgcaattctatcaaaattgggtggaaaaagctaggcaacaattgccaaaa
actactgttaaaccaagtacatatgcg
>SSO0179 (rad2) DNA repair endo/exonuclease FEN-1 (RAD2)
atggattcacaggggagagtaactagtcatctaagtggattattttatagaacgataaat
atcctagaagaaggtgtcataccaatctacgtctttgatggtaaaccgccagagcaaaaa
agtgaagagttagaaagaaggagaaaggcaaaagaagaagctgagagaaagttagaaaga
gccaaaagcgaagggaagatagaggagctaaggaaatattcacaagctatacttagatta
tcaaatatcatggtagaagaaagtaaaaaattgttgagagctatgggaatacctatagtt
caagcaccttctgaaggagaggctgaggctgcatatctgaataaattaggattaagctgg
gcagcagcaagtcaagattatgatgcgatacttttcggagctaaaaggctagtaagaaat
ttgacaattacagggaaaagaaagcttcctaacaaggacgtatatgtggagataaaacca
gaattaatagaaacggaaatcttacttaaaaaattaggaataacaagggaacaactaatt
gatataggcatattaattggaacagactataatcctgatggaataaggggcataggacca
gaaagagcactaaagataataaaaaaatacggcaagatagaaaaagcaatggaatatggt
gaaatttcaaaaaaggatattaatttcaatatcgatgaaattagaggtttatttttgaat
ccacaagtagttaaaccagaggaagctttagatttgaatgaacctaacggagaagatata
attaatatcttagtatatgaacataacttcagtgaagaaagagtgaagaatggaattgaa
agattaactaaagcaataaaagaagctaaaggagcgtctagacaaacaggattggacaga
tggttt
>SSO0180 Glutamyl-tRNA reductase (EC: 1.2.1.-)
atgagcaaggatgaagagttactacaaaattattgttcgattttatttacatacaaaact
ataggaataagtaaccttcacttatattactttagggaaacggaaataaaatcgttaaaa
caattaatcaatgctgaatttgctattctacaaacttgtaatagagttgaaatatatcta
tattcagatactaatacattaaaggaggttaataaaataatccaatatttgaataacata
cataatgaacctatcggaaatcaagctagggtactctgtggtaaagatgctgcaaaacac
ttatttttggtagctagtggagctgattcactatctattggagaatacgaaatcttatct
caaataagatctactattgatatgtttaaaaaattaggcttcagcggaaaatatttacaa
atatttttcgaaagagcaattaaagtaggcagaaaagttagagaagagactagtatttct
aaggggaaagttggtatatattctcttgctattgatgaggctaaaaaacgattcaatgat
ttttatgatagaagaatattagtaataggagctggcgaaatggcgcagaaaataactagt
atgctccacaatgaaggagccaaagatgttacaataatgaatagaacaatagaaaaggca
aaacaacttgcactaaagttcggctataactacgaaaaattagatttagacaagttaggt
aacttcgatgtcgcttttatatcaatttatcatgagaatcttagacttgagaacaaatgg
aatacattaattgttgatataactgtcccgcccctatttactgggaataacgtaattaca
ctagaagaattagaaagaatatcaaacctcaacttcaaagctagagaagaggaattagct
aaaattaataaattggtagaggatggaataaatgaattactatatgattacaaaaaagaa
atctatacggaattcatgtcaaaaataatgaaaaggatagaaactataagagaaaacgag
attctaagagcgtataaagaacttgagaaacttggaataaacgaccaacaagcgaaggaa
atactagatttgatgactagatcaatcattaaaaagtcattccaaccccttttcgataat
ataagatcactaatatttaacggagaaaattcgataaactacattaactttctaattgat
atttttaaagatggtaacatttccggttttgagaccgagaagattaaggaaaagcaagtt
agtgagagatctagtatc
>SSO0181 Delta-aminolevulinic acid dehydratase (EC: 4.2.1.24)
ttgatatttttaaagatggtaacatttccggttttgagaccgagaagattaaggaaaagc
aagttagtgagagatctagtatctgaaacatctatttcacaaaacgatttagtacttcca
gtatttataaaggaaaacataaatgagccagagcaaattgcttcgatgccaggtatatat
agatatccgccaaatgataagttaatcaactatctacaagatagttacgaaaacggaatt
cgaagtgtaatattgtttggaattccttcttataaagacgatatagcatcttcagcctat
gataaaaatggtataatacagagagcggttagaataataaaggatagttttaaggataag
attatagtaatcacagatgagtgtactgatgagtatatggctaatggtcattgtggtctt
gttaaatatactaacgggtgttatgtggtagataatgatgaaagtctaaagattcatgct
aagattgcattaagtcaagctgaagctggtgcagacgttatagctccatccagcatgatg
gatggagtagttagggctataagagatgcgctagatagtgccggctacattgatacatta
atattgtcatatagtgtaaagtacgcttcagtaatgtatggtccctttagggatgcagcg
tactctaaacccgcatttggagatagaaggggatatcagatggaccctagaaatgcattt
gaggcaataaaagaagcgagactagatatagaggaaggtgctgatattttgatggttaaa
cctgcccatacatatttagatgtaataagattagtgaaagaccactttccagaatatccg
ctagctgcatatcatgttagtggtgaatatagtatgataaaggcagctgcaattaatgga
tggatagacgaaaagactgcagtcttagaaattactactgcaataaaaagggcaggggct
gatttaatcattacttattatgctaacgatattgctagatggataaaggacggtgtacca
ttt
>SSO0182 (hemL) Glutamate-1-semialdehyde aminotransferase (EC: 5.4.3.8)
atggataaaggacggtgtaccattttgaatagcgaggaactatgggctcaagctaagcaa
ttatttgctggaggagtaaatagtccagttagagcagcagtaaagccattccccttttat
gtagaaaggggaaaaggagcttatatttacacggtcgatggtaaaaagttcattgattat
gtattaggttatgggcctctaattttaggtcactccccagaatccgtaaagagaagaata
gttgagcaattagaaagaggttggcttttcggaactcctagtgaattagaaatagaatta
gctagaaaaataaggtcacatataccatcagcgcagaaaataagatttgtaaatagtgga
actgaggctacaatggcagctataagattagctagaggctatacaaaaagaagcaaaata
ttgaagtttagcggaaattaccatggagctcacgattacgcacttgtggaagcaggaagc
gctgctacagaatataacgttgcaacttctgatggtgtaccaatggaaataatgaagacc
gtagaaatatgcgaatttaacgatcttgattgcgtagataaaaaattgagaaacgaggat
atagctacagtaatcttagaacccgttatgggcaatgctggggtaatcttacctgaaaag
gactttttatttggattaagagaactcacaaaaacctacaactctctattgatcttcgat
gaagttataactggttttagaatcagcataggtggggcacaatcttactatcaaatttat
ccagacataacaacactaggtaaaataataggtggtggtttccctatcggtgcagtagca
ggaaaagcagagattattgataactttactccagctggtaaagtatttaatgctggcaca
tttaacgctaacccaatatctatgattgctggaattgctacaatagaagaacttgaaaaa
gaatacccatatattatcgcaaaccaagccgccaagaccctagtggaggaattagaaagg
ttgctaaaaacaaaacatacaataaaccatgttgggagtatgtttcagatattcttcgga
atagatgaggttagaaattactcagatgctaaaagagctgataaagagtactacataaag
tttcatgaaagactgttaaaggagggagttttcattccgccaagtcaatatgagacaatt
tttacttcagctgcccataaagatgatgtaattgctgacactatagataagcttatgaaa
gtaataggcgaactaaat
>SSO0183 Porphobilinogen deaminase (EC: 4.3.1.8)
ttgaaaatactaatagctgcaagaggaagtaaactaagtagagtacaagtagatatggta
ggtgaaaaattaagaaaaattggaatagaatatgatgtaatagatataaaaacaaaagct
gacttgttttctactgaaccattaagtaaattaggtaaaggagtttttgaaaaagaagtc
aatgaggctgtattggagggaaaagccgatgttgcagttcacagcatgaaagatatctta
tcagaaataaatcctgaactagaaatatttgcagtaatagaaagagatcctccatatgat
atattaattgcagagaaaaatttacataaattggacccaaatactacaataggtacaagt
agtataaggaggaaaaactttattaaatacatcagaccagaaataaatactaaagatatt
agaggtaatgtggacactagaataagaaaatatttgtctaaagagtatgatggtttaata
ttagctgaggcctcaataaaaaggctcaatattagtataagttatcacaggcttaatgtc
tacgatttcactccagaagctaatcaaggtattatagtagtcttaggaagaaaaaaagat
gaaaaggtaaaagaggtatttaaagaaattactcataaagatacattagatgaggcatta
gctgaaagagctacaattagtgtagtaggaggaggttgtcattctcctattggtgtgtta
ttcagaaaagaaggaaaagagttctatgggattgcaagttatagtgatgggaagaaaaaa
attaccgtttccattagcaaggcgggggatccgtatactataggatctgaattgggcttg
ctactaaaaaaggagatgaagaatgagggtattattcct
>SSO0184 Uroporphyrinogen III synthase, putative (EC: 4.2.1.75)
atgagggtattattccttaggcccgataatgaagataatgaactcaatgaaaagcttatg
atacttcggaaaaacggaattgaagttctaaacattcccatctttaaaataaaatgcgtc
tcatattcgttaccgacctatgattatgaggcactagcatttacaagcagaaattcagtc
atttgtttcaaagatcgcaccttaattaaaaacgttcataagatatacgctatcggagaa
gaaactgctgagttattaatgaaaatgtataatgtaaatccgataactccagagagattt
acgagtatagaactagctaaaagaattttggaagataaggtaaatagtatacttagcata
aggagtagaaaagcttctgaagatatgagaaatattcttaatggcaaaattaaatatgat
gagatttacgtatatgattcagaaataatcagagataatataaacgaaatatccaaaatt
ctaaccgaatgtgaagttgacgccatagcatttactagttcgttgatggctaagctaatt
ggtccttttattaggggtaagtgtaatataataatctttagcataggtccaatgacgaca
gaaactttgaaacgagttaataataaggtaaaaataatagaaagcaagacacattctatt
aaaggcattatagaaactattttagtggagatgaaacgaaatggacgagat
>SSO0185 Hypothetical protein
gtgcgtgatttgaagacattgctaatagtcattgatggtgttagttattctgtttttaat
caatttagatataatttagatactatgaataatcttattgaaaatggaagctttggtaaa
ctagaaagcgttttcccaacaataacaccagtagctttagcgtctttatttacgggatac
ttgccattaaatcatgggataacttccacaaagatcttcataaaaggtaatagcctaagt
aaacccctatcagcacatagtagcacaccattaaaggttgacccgatatggtacctttta
gcgaagaaaggatataaagtagtagtagcctcagcacctcaagccctaccagataaatgg
aaactaaaaaatcttacattatttgatccatataaatccaaaattaaagagtgtagcgat
ggggctttgctcaatatcggaaacacaacaataaacgaagttaattttgatatagagagc
aataataacgagtatactataaaaataactgatatcgagaataataccttgtcattaaag
ttaaggcaaaatgaatggacctctccacttgaggtaataatgggatgtaaaggaaaagaa
atgaagggaacatttagattaaagggattgagtaatggggtttatctcacaccagtatcg
ttcctaatccccagttggtcaaataatcaagagttacaaaatgaaatatgggagaacgtt
gttaagaaatacggaatgcttttggatggtgattatatttctctaaagtccaatataatc
ggtttcagcgaatattatgaaactctaaaatttgcatatgaatttttctataactattca
ctatacttgcttaaacgagaagaatgggattttgcaataacatacttacccatagtagat
aatatacaacaccttctttttggggtagacgattcacagtcattagattacgtgtttcaa
gtatataagatggcagataacttcgtgaaagcgcacatagaattagctgataatataatt
atttgttcagatcatggaataaataaggtaaaaaagaggctttatcttaataaattttta
gaggaactgaatgtgctaaaaacggttgacgataagaaaatagattggaagagaactaag
gcgtactacggtggtggaggaattattagaataaatctaagagaaagggagaaattcgga
atagtaggtaaaaaagagtttaataaattaattaaatatttaactattaatctagaaaga
ttagaggatccagataccggagaaagaatatttaccgtgatttattctaatgagactcca
gcaagtgatagacaaggcgatataatgatcgatggtgttaacccaaaatactctatatca
agtaatatagaaaaagacacgatatttgaaaatgtcattccttatcgtacgactacggca
gatcatggatattatagaaatgatgacattaatggaattataatattctatgggaagaat
ttcactaagaaacaagtaaacatgaagatagttgacgtaactcccacgatattgaaactt
tatggaataaattgtaaatctgatggaaaaattgtaaatgaggtcttcaaaaatggacat
gccgatagtactaag
>SSO0186 (soxA-like) Sarcosine oxidase, subunit alpha related (soxA), putative (EC: 1.5.3.1)
atgaggtcttcaaaaatggacatgccgatagtactaagtaaaaggcatagaaggcttaga
agtatgaaagattgtgagccaggtttaccatataatgagatcgtggagaacgggaaaaga
atagacttatgctatagcaaacagtataaaaaatatacgaagaaaattgagatacgagtt
ggcaccagtatcctccataataaattactgcgaatatttcctaatatagtaaaaatctat
tctaagcacttcattaatttaccagatttaataacagagaatactgagaaaagggaatta
atattcattgaattagagaatttgattataggaggaggaacttctggactaggagtccta
tcagaaataagtaaggaggagaaaacgctcctaatatcatctaatatcgaatccaatact
gatataccttacccattaccgcaaattaacaaagatgagttctctaagttattaagggat
actattaatgaaaataaagataggattttagagggaattttattaggcaaatttgatgaa
ggaataggatttcttacaaaggataagatattaatggtgagagctaaaagagtcttttta
gcaacaggcggaagatacattccaccaatatttgatggaaacgatatacccggtataata
tcaaagaatctttacctaagatatggaaatcgcattacaaaggcgattgctttaggaaat
agtgacgatataataaaagtattgtttaaagttgaaaagagggttataatcaataatggc
gtattatttttgtcaaaatattataaggaattaatagacgagctaggtgtagaaataata
aatactaacaacttgaaagtgaaaagagaaaaaggtggaatgctaaagataatcactaat
gaaagatctttcgattctaatattttagtttatgcaatagttaaacaaccgaaaatagac
cattcatataatattgggataccatataattttagtgaatatttccacatctatatgccg
atacattctatagagggaaagactaatgataacatctacatagttggaggaatgcgtgga
atctcagatgaatacacttcattcttaagcggaaaaacagctgttaatgagaaatatcta
gatgaattcataaataatttgaaagattatacgtatatttatgattattattatcaaaaa
aatcctaaggaaaatccctctccgtatatttatgggaataagggatacgtatgtgaatgt
gaagatattaccctaagcgaagtaaatagacaagtaggcagaggatttagtaaagtagaa
gaaattaaaagaactataggtttaggtacaggagagtgtcaaggaaaattatgtacgtat
tctctaggaagttttctaggtgataggcaacttataacgtttagaactcctctttataga
atggtgatt
>SSO0187 (soxB-like) Sarcosine oxidase, subunit beta (EC: 1.5.3.1)
atgataatcattgttggtgccggttcccatggtttaagtttagcatatcatttagtaaaa
aagggctatagtaaaaaagatattacactagtagaatggaaaagaatcggttatgggtcg
agcagtagaaacgcagctagatacagatatcatttttacagcaaggaaaatgtggagtac
gctataaatgcgataagttatctaaagaaacaatcaaaggaacttgagtataattcatta
ttattaagaactggatatttatgggtcattaacggagaacaagagtatagtctatttaaa
aaactagacagtttttggagctcatataatataggagggaaatttatagaatgtaaggat
aattacgcttacataaaatttgaaggacaatgctatttggcgcctcaagatggcgcattt
catcacgattatatactgtacagttactattattcgattaaggataaagtttctacaatt
tatgataaagtggtctctctaataaaagatgatagcaagataaaaggtgtaaaactaagt
agcggaaaagaactatatggggacaaggttatagttactgcaggagcttggagcggcgaa
gtgctatccagtattggtatagaggtacctatatttccagagaagaaagagatatatatc
acggaacctttaagatatttcctcgaacctttaattatagactctaagcttcaaatctat
ttctcacagacattgaaaggagagataataggtggaatagaagataaaagggaatacaaa
tttgaggagttcacaatatccatatctaatgcgataaaatttctcaaaggtataagagaa
ttaataaagggaatagatgggataggaatattaagaggttggtcagggtattatgaaatg
actccagatagttctcaaatcatgggatattctaatgattggccagaaggtttatttatt
gatgcaggttatagtggtcatggcatgatgtttgccccttactctgggaaaataatggct
gatctaatcgcagacaattacaagaataaattcatagatattttctcgccatccagattt
aagttaaataagctaattaacgagacactagtaatt
>SSO0188 Conserved hypothetical protein
gtgcagagtcttgtaaagatacttcctaatggggctattttaattggtaaaagatttact
atagatggacatcatgaacgcccatttagggttgtgacgcattttcatgctgatcatata
acgggtcttgagaaaagtatttcaatttctgatggtataatcgcaacacccattacgctg
gatatattaagtttagactacgccataccacctagaaaagcgtttggtttaaattacgat
ataaaaatgacatttgaggatgagaatattgtgctaaagaaatcagatcatgtaataggt
tctgcccaggttctcattacacttgaaaacggtttagaaataggctacactggcgatttt
aagaatccaggtaagggcactcctatacttcatccagatattttaataattgaagccaca
tatggtagacctgatttcagaagaccatttaaagatgatgtcgagagtttatttgcagac
tatgttagagacgcacttatgtatggaccagtgagaatttatggctatcatggaaaatta
caagaggtaatgattagtttaagaaaaatgggtgtggatgctccttttatagtaggcggg
aaaatttctaagatgactaatattgcaataaagtatggttataatataagccaagttttt
gatgaaagccaaagtgaagctaaagaaataatgcgtgatagctggtatatttctttttct
cattataacgaatttaaacgaagaaacggtaaatattataatttcttgctaagtgggtgg
gaatttaagaatgtggtgaagaaaattgatgaaaaatcatatacggtatcctttagtgat
catgctgatttcgacgatcttatatattatgtagaaagaacttccgcaaaatatatcata
acagatggaggaaggagaagttatggtaaagaattagccgaatacatttccaaaaaatta
ggtaaaatagcgatcagcatgcca
>SSO0189 (lig) DNA ligase (polydeoxyribonucleotide synthase (ATP)) (EC: 6.5.1.1)
atggagtttaaagttattgccgagtactttgataaattggagaaaatatcttcgaggctt
cagcttacagctttactagctgatcttttaagtaaaagtgacaagacaattatagataaa
gtagtttatattatacaaggcaaattgtggcctgattttttaggttatccagagcttggg
atcggagagaaattcctaataaaagcaatcagtatagccacaaacacggatgaaaattca
gtagaaaatctgtataaaacgataggagatcttggagaggtggctcgaagactaaaaagt
aagcagcaaagtacaggaattttaggatttttgggtaccacaagtaaagagagcttaaca
gtggacgaagtttactctacattatctaaggtagcattaactacgggagagggtagtaga
gatttaaagataagattattagccggcttgttaaaaaaggcagatccattagaggctaag
ttcctagtcagatttgttgaaggtcggcttagagtaggtataggagatgcaacagtttta
gatgctatggcaatagcgtttggtggagggcaatcagcatcggaaataattgaaagagcc
tataatcttagggcagatctaggaaacattgcaaaaattatagtagaaaagggaattgaa
gcgctaaagactctaaagcctcaagttggaataccaattaggccaatgctagctgaaagg
ctatcaaatcctgaagaaatattaaagaaaatgggtgggaatgccatagttgattataaa
tatgatggagagagagcacaaatacacaaaaaagaagataaaattttcatattttctaga
agattagagaacattacttctcagtatccagatgtagttgattatgttagtaaatacata
gaaggtaaagaattcattatagagggagagatagtagctatagatccagaaagtggagag
atgaggccatttcaagagttaatgcacagaaagagaaagtcagatatttatgaagcaatt
aaggagtacccagttaacgtatttctcttcgatctaatgtattatgaagatgtagattat
actacaaagccattagaagctagaagaaaattgctagagagtattgtaaaaccaaatgat
tatgtaaaaatagctcatcatattcaagctaataatgtagaggatcttaaatcgttcttc
tatcgagccatatcggagggcggggagggagtgatggtgaaagcaatcggaaaagatgca
atatatcaagcgggtgctaggggttggttatggataaagcttaaacgtgattatcaaagc
gagatggctgatacagttgacttagtagtggttggcggtttctacggtaagggtaaaaga
ggcggtaagataagctcgttattaatggctgcatataatcctaagactgattcttttgaa
tccgtttgcaaggtagctagtggtttttcagatgaacagcttgatgagttacaaaagaag
ttaatggaaataaagagggacgttaagcatcctagggttaattctaagatggaaccagat
atatgggtagagccagtttatgttgcggagataattggatcagagataacgatatctcct
ttacatacttgttgtcaagacgtagtagagaaggatgctggtttatctataagatttcct
cgatttataagatggagggatgataagagtccagaagatgctacgactactgatgagata
cttgaaatgtacaataagcagcctaagaagaagatcgaatcaccagctgtagatgagagc
gtt
>SSO0190 (dcD-1) Deoxycytidine triphosphate deaminase (EC: 3.5.4.13)
ttgctggatagtccaatacatgtaggcaatgtggttttaacccttttcaactacaatatt
ttagatatgattctatctgatagggatttgaagtattatttagagaagagctggataaaa
atccagcctttaagggaggatacgataagggaaaatggagttgatttgagagtaggtaat
gaaatagctaggttcaaaaaaacggataagatctttgatcctgataatcctgatccttcg
ttcttccaaacggagaaaggagaggagtttataatccaaccttatgagcatgtactacta
acgactgaagaatatatagagttaaataatgatgtaatggctttcgtaaatctaaggtca
acatttgctagattaggtttatttatcccacctacaatagtcgatgctggatttaaagga
caagtaacaatagaagtagtgggctcatctttccctgtaaaattaaagagaagcacacgt
tttattcacttgatctttgccagaacgctcacaccagttgaatatccgtaccaaggaaaa
tatcaagggcaaaaaggcgttacattacccaaatttaactcacaaatttccagcttttac
tatcagcatcaaagtata
>SSO0191 Conserved hypothetical protein
atgaggataatttcaataaagctaacagatgaggagtataaggagttagaagaacgagcg
agaagagaaggtttcgttttattaagtgattttgttaaatcacttcttttctcttcatct
tatcctcacgggactcaagtagataatgcgcaagttgtatccagaatagaaaaaaagatg
caagacatgattaatccttttacttctcaaattgacgaaattaaacagaaagtagctatg
ttaacggaaagaatagaaatattagaggaaaaattaggcgaaagtaaagacaatatgaaa
gatattaataaaaaacagaaaaagagcttcgaatccaaatctatcaatgtgaaatctgaa
cctcaacataagaagactgcaatagatatactaagggaacaaggagtgatatacgagtct
gaactgaagttaaacaatccagatgcattttttgacaaattagaaactcagggagcaata
gtaataacaacggatccagagaggatagcgatagattctaatttctatgaggaatttaag
aagaaaattgccaatatttctacttcagatgagatagaagttcaaaaatatctgacaaaa
caagaatacaaattattccagaaactcaggcaatatagtgttatatactttgatgctgat
agtaaaagctggaaatttgtgagt
>SSO0192 Glutaredoxin related protein
atggaacaagaatatgccgaactatttagtgatgaagttaagaatgcgttacaagacgca
ttaaaagatatgaaaaatccagtagatgtttatgttttcgtagacaatacagactctaat
tgccaatattgcggtgttactactaaatttctggaattcatggctagtgctgcaccaaaa
gatagtaatggtagtttattaaaggttcatatagtggatagagcaaatgaaaatagcaga
aaaattttcgaagagtttaacgtggaaagagttcctactgtggcattttataatgggtat
attagatggactggagctcctttaggtgaggaaataagagcattagttgagactatagta
aggctttcacaaggtgaaagtggtctaagtcaagaaaccgtagaagctataaaatctaaa
ctgaatggtaaggtaaagatagaaacggtagtcacaccatcttgtccatactgtccatat
gcagcgttaatggcgcatatggttgcttttgaggcttgcagagcagggaagtgcaatgtt
atatctgaagtgatagaagcttatgaaaatcaagatattgcggagaaatatcaagtaatg
tcagtaccagctatagctataaatgaatctatagaatttataggagtaccctacgaggag
aactttataaatgcaattttagagaagcaaaagataagc
>SSO0193 Conserved hypothetical protein
atgattcaagaggaactggtacagatacaggagttaaacgaagagataggacggttacta
atagaaatagctagaaaatccattaaggaagaattcaagttagacaagttggatttgagt
aagtacgataatcccattttagataaaaaaggtctagcctttgtgacgctagagaaaatt
gcgtataatacgagttctttaagaggctgtataggctatgttgaggcagttgctcctttg
aagcagatagctgcgtctgcagccaaagctgccgctttttcagatccaagatttaatccg
ctgcaagaagatgaattagcgaatataattatcgaggttacagtgttaacaaaaccagaa
gaaataaaggtaaaagataggtgggatttacccaagattataaaagttggggaagatggt
ttaatagttgagaaagggattctccacagcggccttttattacctcaagttcctatggaa
tattgctgggatgaagaaacgttcctagcggaaacttgcattaaggcttctttagaacca
gattgttggttagatagctctgttagaattaaaagatttcatggaataatatttaaagaa
actaaaccaaatggaagtgatattattgtaataaagcctagcgatattaaatgtaagcta
aatgaattaataaataattta
>SSO0194 Conserved hypothetical protein
atgagaacaatgctaacacaaaaattcgtcgtagatagtatgcttggtaagattgcgaga
tggctgagaataatgggttatgatacactctatagcaatgatttcgaagactggaagatt
ctgaagattgctgagactcaaaaaagaataattataactagagataggggtatttactat
cgttctctaaaaagaggattaaattgtatcctactttcaccagattccaacataatacaa
gatttagcttttatcgcacttaggtctaaaatagatttatctgtaaatataaacgccact
agatgtcctcaatgtaactcagttttgagtaaactgtctgaaagtatgtggttatgccct
aaatgtaagaaagaatattggaaaggtaggcattggagaacaattgaagagataataatt
aaagctaattctgagttagtaaaattggaaactaaaaatgattcaagaggaactggtaca
gatacaggagttaaacgaagagataggacggttactaatagaaatagc
>SSO0195 Membrane conserved hypothetical protein
atgagttctcagaatataaaattacagagaaaaaacagtatgacttactttgatttaata
gcgtggattacagaaaataagaaagcgatagagggatgtataatagataacgttttcttg
atacaaaatactcaaaatacatatattttaaagttacattgcagtggaagagaccaagaa
ttaataatagaaccaagtaaacgaataaatataacaaaatacaattatccaaaaatttct
tcaacaaaaataaccgaattaagaagattaattagaggagatataattacgaatatgtat
gtattgaacaaggaaagaatattaatcctaaaactcaaaagggatgataaaaaggtaata
gtagaactactacctagaggagttttggtaatagcagataaagatggtaaaatcttgttt
gcgagtgaatataaagagtttaaagatagactcataagaataggggagatatataaacct
ccaccttcaattgaacctaatatagatgaaatagaaaaattgattaagaaaggaaacata
gcgaaaggtttaggaatcccacaagaagtagcaaactatcttagcttacaagactctaca
ccagatattaacgtaataagggaaaagataagaaatttagagatttcaataattaatgga
gagataaaaccatgtctcgtagaagatacaactgtagtacctttttatcttgacggatgc
aaagaatatcaaagatttaatgatgcaatagacgattatttctacactataactcaaaaa
gagctatctgaaaaaacttccaaaaaaatctcagaagagaagcagaagattatagccaca
attaagcaaatagaggatagtataaaggattatgaagacaaagaaaataactatagacaa
ctaggcaattttatactttcaaaggcatacgaaatagaccagttgttgttaaataataga
gcaaaaagtaaaaaggtaaagcttaatgtagatggagttgaaattgaattagatacctca
ctctcagctactaaaaacgcaatgagattttttgatgaagctaaggaatataagagaaaa
atagaaagagcccttaaaagtttagaagaactaaaagaaaaactggctaaaatagagaaa
caagaaatagagaaacaaaacgagataaaactaacgctaaggaaaaaggaatggtatgag
aaatatagatggagtatttcaagaagcggatatttaataattttaggaagagatgcaagt
caaaatgaaagtatagttaaaaaatacctaagggacaaagatatattcttgcatgcggat
attataggcgctccagccacaatcatcataacacaagataataagacaatctctgaagaa
gatatctatgatgcagcagttatggctgcgagctactcaaaggcttggaaagtaggttta
gcatctgttgacatattttgggttttaggcaatcaagtctctaaatcaccgccaagtgga
gaatacttgaataaaggttcattcatgatttatggaaaaaagaatttcataaaaaacgtc
aaactacaattagcaataggccttatactaagtgaaaacggtgtatcagtaatagtggga
agtgaggaaaccatttcggctaagactaaatactatgttgtcatagctccaggtgatgat
gataaagagagaataacccaaaaaattataaaagtgtttagtagagctttaccagaaata
aacggattgaacgcattaaaaacagagattgaagataaaattccgggaaagagcaagata
gttaagacaagtataacatataatagt
>SSO0197 Conserved hypothetical protein
atgagactttcactagcggagaaagcatcactagtgagacctttcgactatatattatta
aaaacgatatatggtcttagggataaaagtgaatttgttagttttaatgccttaaaaaag
agattagatattaaagacgatgaagaactaaagatatcactaaagaaattatctgagtta
aaacttatttctaaaaagccaacagatttatctttcaaattaacattttctggtctggat
attttgggaataaaactgctatatgtgaataaaatcttgaatagattagcagagataata
gggataggaaaagaaagcttagtatattatgggtatgatttcaacgataacaaaataata
gttaaatttcatcgagtaggcacggatagttataagaaagttaaatttagaaaaagccaa
gaaaagaaaagttggctttcaattaccgttgaaaatgctaaaagagagtttgaagctctt
acatgtttaagcaatgagggaggctatgtccctaagccactaggagtggaatataacgcc
gtagcaatggaatatatcgatgggatagagctttacaaaataccagttactaatatggat
ctaaacttagatgaaatccttgaaaaaattttacaaaccatgagaatagcttacactatt
tgtcacataacacatggagatttaagcccgtataatgtacttatagataaaaacggaaat
ccttatcttattgactggcctcaagcgacaaaatctgaggaaagattagaaaaggatcta
tcaaatcttataatattttttagaaaaaagggaatagatgtagatactcgtaagattttc
gattatgtaagaggggtatca
>SSO0198 Conserved hypothetical protein
atgaaaataatgggaattgatatagaggcgatggaaagcccatcctctaagtcacagcca
ttatattcagttattattattgacgagaacgaaaaaatagtctataaggcggaaaacgta
agtttaagtagagttattaggttatgttgggaatacagcattgatatactagcgactgac
aatatttacgaactaggagaaagtgataaagagattattaatatcgtgaaattattgccg
ccaaatactaacatagttcaagttacatatcataatggagaatttaagcaaataaaggaa
ttggctagggaaataggatacgaagtgcaaggaaaattatccccgcaaaaaactgcatat
ttagatgcattattagctttaaaaggatttggaaccagtataaaaattgaagaaaaacgt
actaaaatagtagtgtcaaggggaagagcattaggccctggtggaatgagccaaaataga
tataagagatatataaggggaacccttctcagagtagctaaggagataaaggaaaaactt
gatatgaaaggatttgattatgatatgatagtaaggagatcaagagcaggtattgaggga
gccgtattcatagtttatactcccagagagagactctacggaattataagaaaaatgaaa
ggtcatgacgtagtagtagatattaagccaatatataaaaataggattgaatttaaagac
aaaagaactgaaaggagattaattgttggaatagaccctggtatagaagttggtctatca
ataattgatatctacggtaaaccaattttattgttatcaagaagaaatattgatagagac
gaaattgtaaccttgatctctaaagaggggaaagcaataatagtagcgacagatgttaat
ccactaccagacactgtaaaaaagatcgctagtaaatttaacgccaaaatattcatcccg
gaaaaaagtctaagtatagatgaaaaacaaagacttattgacgagtactctaagttacat
aagctaaaaatagataatcctcacattagagactctttagctgcagctctaaaggcatat
aatgaaattgagaacaaattaagacaaattgagagtttcatcagtagattagatattgat
ataatggatgaaaatcgtatatacgattgcgtaatatttggtaatacggtatctgaatgc
gtagaaaaggaaattgaaaaaatcataggaaaagatgattacaggaaaatcgaggagata
caaaaggaaaacgatacaactaaaaatacaaataaactaactaagttagaagaggaaaat
agagagctaaaatcagaactaatacgttataaaaggataatttataatctcatcaatgaa
agagattcattaataaggaaaattgatgatattaaactacagattaataaggaaatagag
agagacaggaaaatttacgaactaaatctaaacctacagaatgcgtacaaggtaataagt
caacttgagaataaattaaattataatgagaaacaaattgagaaactaagggaagtgcta
tataaactgttaaatggaaaggcaatagtagttaagaaggatagtagagttggcgatata
gcatttgatggaaataacatctatattggagaggaaaaagttaacaatgagatagcggaa
tacgcagataaggagattataatattagataaacagctcttgaacgatctggaagtatta
cgtaaagaactacaaatagaaaggtctaagaatattgatataaaaagaataattgacgag
tatagaaataaaaggttaaaagagagtagctttcccttc
>SSO0199 (maT) S-adenosylmethionine synthetase (EC: 2.5.1.6)
ttgtttgaggaacctataatgagaaatataaatgtgcaattaaatcccctttcagatata
gagaaacttcaagtagaactagtagagagaaaaggattaggtcatccagattatattgcg
gatgcagttgctgaagaagctagcagaaagctttccttgtattatcttaaaaaatatggt
gtgattttacatcataatttagataagacattggtggttggaggacaagctacacctcgt
tttaaaggtggagatataatacaaccaatatatatcatagttgcgggcagagctacgact
gaggtaaaaacagaaagcgggatagaccaaatccccgtaggtactatcattatagagagc
gtaaaagagtggatcagaaataactttagatatctcgatgcggaaaggcatgttatagtt
gactataagataggcaaaggttcaagtgatttagtgggtatatttgaggcaagcaagaga
gttccactatctaatgatactagttttggagtaggttttgctccattaactaaattagaa
aaactggtttatgaaacggagaggcatttgaactcaaagcaattcaaagccaaactaccc
gaagtaggagaagatatcaaagtaatggggttaagaagagggaatgaggtagaccttacg
atagcgatggcaacaattagcgaactaatagaagacgttaaccactatattaacgtaaaa
gaacaagtaaggaatcaaattctagatctcgcatcaaagatagctccaggctacaatgta
agagtttatgttaatactggagataaaatagataagaatatactttatttaaccgtaact
ggtacttctgctgaacatggtgacgatggaatgacagggagaggaaatagaggtgttggg
ctaataacaccaatgaggcctatgtcattagaagctactgctggaaagaatcccgttaat
catgttggtaaactatataatgtcttagctaatcttatagctaataaaatagctcaagaa
gtaaaggatgtgaaattctcgcaagttcaagttctagggcaaatagggagaccaatagac
gatcctttaatagctaatgttgatgtaattacttatgatggcaaacttactgatgagact
aaaaatgaaataagcgggattgtagatgaaatgttaagttccttcaataaattaactgaa
ctaatattagaagggaaagctactctcttt
>SSO0200 Hypothetical protein
atggagctaataattgatgatccagaaaaaatctacgaaatttctaaggcgttatctaca
atgactagaataaatatactacaactagtctctataacgccgatgagcatatcagagctc
accgaaaaacttaatatgagtaagggaaacataagttctcatatttctgagcttgaaaat
ctaggtctagttgaagttgagtaccagaatggaataaaaggtataaaaaagattataaaa
gctaaatatgataaaattataatagttttaaagactagcaacagctctaatgaaccc
>SSO0201 (pyrG) CTP synthetase (UTP-ammonia lyase) (EC: 6.3.4.2)
gtgccaaacaagtacatagtcgttacaggtggagttttgtcaagtgttggtaaaggtacg
ttagttgcctctattggcatgctactcaaaagaagaggatataatgtaactgcagtaaaa
atagatccatatattaatgtcgatgcaggtacaatgaatccttatatgcatggtgaagta
tttgtaactgaggatggggccgagacagatttagatttaggtcattatgagagatttatg
gatgttaatatgacaaagtacaataatataacagcaggcaaggtatatttcgaggttata
aaaaaggaaagagaaggtaaatatctaggtcaaaccgtacaaattattccccacgttacg
gatcagataaaggatatgataagatatgcgagtaagataaataacgcagaaattacctta
gtagaaataggtggcacggtaggtgatatagaaagcttaccattcctagaagctgttagg
caacttaaactagaagaaggtgaggataatgttatttttgtgcatatagctttagtagaa
tatttgtctgtaactggagaactgaaaacgaaaccattgcagcatagtgtacaagaatta
agaagaattggaatacaaccagatttcattgtaggtagagcaacactgcccttagatgat
gaaaccagacgtaaaattgctctgtttactaacgttaaggtagatcatatagtttctagc
tacgatgtagaaacatcttatgaagtgcccattatcctagaaagccagaaattggtttct
aagatacttagtaggcttaaattagaggatagacaagtagacttgacagattggataagc
tttgtcaataatataaaaggaattaatagcaaaaagactattaatatcgcattagttgga
aaatatacaaaactaaaggatagttatattagtatcaaggaagcaatttatcatgcttca
gcctatataggagtaaggcctaaacttatatggatagaatcaactgatctagaaagtgat
accaagaatttaaatgagatcttaggaaatgtaaatggaataatagttttacctggattt
ggaagtagaggagctgaaggtaaaattaaggctataaagtacgctagagaacataatata
ccattcttgggtatatgcttcggttttcaattatctattgttgaatttgctagagatgtt
ttaggtctgagtgaagccaattcaactgaaattaatccaaatactaaagatccggttatc
acactgctagacgaacaaaaaaatgtaactcaacttggagggactatgagactaggggct
cagaagattatattaaaagaaggaacgattgcctatcaactatatggtaaaaaggtcgta
tatgaaaggcataggcatagatatgaagtaaatcctaaatatgtagatatactagaagat
gcaggattagtagtttctggtatcagtgaaaatggattggttgaaattatagaattgcca
tctaataagttcttcgtagctacccaagctcatccagaattcaagagtaggccaacgaat
ccatctccgatatatttagggttcattagagctgttgctagtctt
>SSO0202 (hpS-2) D-arabino 3-hexulose 6-phosphate formaldehyde lyase
atgagagaggtactacttgaaaaacttcgtactgaaaaatttttacagatagctttagat
tttatagatatcaatgatgcaataaaagtggttaatgaagtcaaagatctagaaaatgaa
atcattgaaataggaacaccactactaaaatcattcgggatagaaggaataagaaaaata
aaatcattagttccagataaaataattgtagctgatactaaaactgcagatgcaggagat
gttgaggttgaaatagctaaactaggcggagctcatataatgacggttttaggaataatg
gatgattcaactatttattcagctgtaaaaaaagctagggaattagatatactagtccaa
gctgacttaattaatgttaaaaacgtatatgaaagatcaaaggagcttaagcaattagga
gtagatattataggtttccatgttggtttagatgtacaaaagagtagaggcataagtgta
gctgatttaaagaatgagatacgaaaggtgtctgagctaaacttaataatatcaatagct
ggaggcttaaataaagatagaattttagaactcatagatctgccagtaagcatatatgta
gtaggaggagcgataactagaagtaaagagcctaagaacgtatctaaagagatagttaac
atattaaagggtaga
>SSO0203 Conserved hypothetical protein
ttgtcacaaccaggtcaacagaagtctaaggatgtaaagatggtatctaaacaagttata
agtacgaatataataaacgaggataaaagaaaattacagttattgtatataataagacaa
ataggaaaattaaccgaaaaatcaataataatgctgttgtacgaattgaaacaaaaaggt
attgatctaggatatcaattcaatgtaataggaaataacgtattcagtttaatggcaaaa
gaggatctaacttcgctcttatatctagggctggtagaaaatgaccccgtaactaagaag
ataagcatttcgaataacggtatagagatattagataaaactcaaatagacgacgacttc
aaaaataaactagctcaagctctaaatgaaataaaaacaaaaatactcgcttatgacgaa
gaatataacttgaagataaaaaacgagatgaaattaagaaggagg
>SSO0205 Conserved hypothetical protein
atggaaagttcatttataggaaatttagatgaatggataaagttgcaaaagaatttattg
acgactttaaaagatatggagaaaaaggagaagactgaggacatggatagattggactta
atattagcatctagaactgcattccagcatatgatgagaacattaaaggcctttgatcaa
tggctacaagatccaatggttataaagcatatgcctagagagatgttagaggatgtaaag
aataccagttgggaattgcttcagagactattagagttagatattagacatacgagccaa
tttagggaaatgatatcgaaaatgagcaaagaaggtaagctagatccattaatatggaca
agacctgtaactgaagagcatccagaaagagaaagaagaggtccattatccacgatt
>SSO0206 Conserved hypothetical protein
atgaaatataggcttatggatttgcttgcgtgccctatgtgtaaacactttccgcttaaa
cttttagttttctcagaaagggaaatagatagaaaattgagccaagaagataagaaacct
ttgtgtgaattatattgtacatataaatctgcgtttactaaggatttagattctctacct
ccttgtgaggaatgtattaggcatgaaatagaagaaggtatgctttattgtgaatcttgt
aatagatggtatccaataattgacgaaattccaagaatgttaccagataaactgagaaaa
gaagaggacgacattaaatttttggagaaatataaagacaagattccgaagtccatacta
actaatggtgttccttttcgtttaaaa
>SSO0207 (pmM) Phosphomannomutase (EC: 5.4.2.8)
atgggtaagttgtttggaactgatggaataagaggagttaccaatactgaattacaacca
gagtttgcgttaaagattggaaaagctataggaacatattttggtaaaggtgctagaatt
ctaataggtagggatgtaagagcaggaggagatatgctacttaaagctgttgagagtgga
ttgttaagtagtggtgtactggtttatgaagcagggatggctcctactccagctttccaa
tatggtgtgaaggctttaggatatgacggtggtgttataataactgccagtcataatcca
gctgaatataatggtatcaaagtcctttctccacacggtattgagatatctagagaagat
gaggataagatagaagatatatactttaatagcaggtttcatgtggtagagtggaatggt
ttagtaaacgatgtgaaaagagaagacaaggttattgagacttatttaagaggtattctc
tctcatgttgatactgaaaaaattaagagtaaaaagtataaagttctcatagatcctgct
aatagtgtaggtacattagtaacgcccattgttgcaagggagttgggatgtaaagttttt
actattaatgggaatttagatcctttattttcagctagaactcctgaacctactttcgag
agccttaccgaatccgcaaaagttgctaaacaattaggagttgatttagcagtggctcat
gatggtgatgcagatagggcaatttttatagattccatgggtagggtccaatggggtgat
aggagcggtactctattatcatattgggcctcggttaaagctccaaatttacctagacgc
atatttactgcagtttctagctctagcttggttgaggagtatctgaaaaagtataatata
gaggttaagtggactaaggtaggtagcatagatattgcgcatatgttatttaaagaaaaa
ggagtagctggatttgaggaaaatggtgggttcatgtatccccctcatcagacggtaaga
gatggcgcaatgtcgttcgccttaatgctggatatgatggcatctgagaacgaaagttct
gctgagctatttaatagactccccgtttattatttggtaaaaacgaaagttagagttacg
gaaaagagtgatataaagaagatttatgatgaagtaatgaataagtacggaaattacggg
aatactgttacaatagatggtgttaagattataggtagtgatttctggctcttggttagg
aaaagtggtacggagccgataataagaatactagttgaggcaaaagatgagaataaatct
aaagaattagctaaagaattggaaaagttagtgagtgaactagta
>SSO0209 Acetyltransferase, putative
atgacttatatattgcgacgctcccagttactgctaatagtatcttcttatcagctagtt
cattacttatgctcccaattatcttctttgaaggatgcgtcatgtatgtgtgcatatata
ttaactacattatataaagatattgatatggagctcgctgaaaaagataaaggaagagat
ttcacactaagaaacgcaagaatggatgatatagaccaaataataaaaataaataggcta
acattacctgaaaattatccatattatttttttgttgaacacttaaaggaatatggccta
gcatttttcgtagctatagttgataatagcgtagtaggatacataatgcctagaatagaa
tggggattcagcaacattaaacaattaccctcgttagtcagaaaaggacatgtggtttca
atagcagtattagaagaatatagaagaaaaggaatagctactacattattagaagcctcg
atgaagagcatgaaaaatgactataatgctgaggaaatatatttagaagtaagagtcagt
aattatcccgcaatagccctatatgagaaactgaactttaaaaaagttaaagtactaaaa
ggttattatgctgatggggaagacgcatatcttatggcaagaccactc
>SSO0210 (dfp) DNA/pantothenate metabolism flavoprotein
atgcacacatacatgacgcatccttcaaagaagataattgggagcataagtaatgaacta
gctgataagaagatactattagcagtaactgggagcgtcgcaatatataagtcattagat
ttagccagaagtttaatgaggaacggtgcagaagtgagtgtcattataagtaaagacgct
gccaagctaatttccccagagatgtttaagtgggctactggaaataatgtagttactaag
cttactggtgacttagagcatgtttcattggcagaagacaatgacgtaatgatcgtagct
ccatctactgcaaatactatggtaaagatagcttatggaatagctgatacaccaataacg
gctactgcgctgaatttcgttgggatgaaaaagcccttaattatagttccttcaatgcat
ttacaaatgtatatttcacctcaagttgcagatgcagcagataggttaaaaaggatagga
gtagaggtaatagaaccagagatagttggagatttagcacactatcctaagttagaatac
ttaaccagtagaataacctcatatgttttaagagggaaagacttatctgggtttaatata
ttagctactgctgggcctacacgtgagtatttagattctgttagatttatttcaaatcca
agtagcggaactatgggtatatctattgcgaatgaggcgtatttcagaggagctaaagtt
agagttatttgtggacctataagttctaagatagaaccttatgttaaggatatagtgtat
gtagagacaactgaggagatgctaaatgaagttgtaaaaagtatagaaaatggtaagttt
aatgttgtaattttagctggagcgcctgctgattacaagtttaaaaataaatctgacact
aaaatagacagtcatacagaaatacctaaagttgaattagaaagaacaccgaaaatttct
gaatacattaggaagtataatgtattgctagtaggtttttccgcagagactgtaaattct
gatgaagagctgattgagaaagctaaaatcaaaatgaggagacacgggtttgatttaatc
gtagctaataatgtgagaagaaaggatataggattttcgtctgaatataatgaggttata
gttatagataagaatggtgatgtaaggaaaataccaaagaattttaagacggtaatagcg
agaaagatattggatatagtaaaggagcaattaagaaga
>SSO0212 Conserved hypothetical protein
gtgacaaagatgttagagggtttattagacctttgtaatgatgtctcttacattttatct
caagcctcaataatagaatcttatatttttaaacccggtaatgcaagtagatcccaagat
cttgtaaatgtgaaatacattgatatagtgaaaagtgcattaatttcttctacgtattat
aaagaattatgcataaggggatttagagggattagtagaatttatgatacgttagtagaa
ttggtaactcgttctaataaatttggattcgaataccagttgtttggtacttatctttta
attgcgcccttcgcatatgaggctgctaagattaataatgtttttgaattgaggaaaaag
gctgctaaacttctaaggagtttaggagctctcgagactagatggtttctcgatgcatta
aaggagttaaatttgaaatatttaggtaaattaagttcaatggattatagagaaatagag
aatattgatttttttacgcttatggagttttcatcgaaatatgatatagtagcacttaat
atggttaatgattattcgataacttttgctgcatataaagttataaaggaaggtttatgt
ggacttgaaagagatgtgcaaagagcgtttttatacatactttcaaactacccggatact
ttaatttataagaagtatggagctcacgctgcattagaagcatctaaggttgctaggtta
gttttctctggcgattgcccatcttctaatgagttagaatggcttaataagtatctgatt
aacaacaattttaatccagggtcaacagccgatcttatagcctcagcgttggctatatat
tatctagatgagtggtatggtaagaaaggtaatcctcatagcgggttttcagtg
>SSO0213 Conserved hypothetical protein
atgggacgagattatttcttggatagagacattataattgataaagagggtaacgtgtat
actgttttaaccaattataatccccctggttatgtttttgcctatttaaaatatgtttat
accggcaaaggtatttggaatggatatgagaggatatttaagaagtatggtgttcataat
ctaatcaagattaatcaacggtttaattttgagagttgctatgatgcatcttttcctata
gttcttctatctaatatttctagacatttaaagcctgaagaaagattacgagagatatta
aagaagagtgtcagtgatagtataatttatgctcttatcagttttatagaagaatatgta
agagttaacgatataggtgttactggatctattttactaggtaattatcacagcaattct
gatattgatataataatatatgggcgtaagagtgcattagatttcattgaatcttttgat
ggatttgaaaaagattctgaatggattatcgaggctaatgagaattacggtataaatttc
tcaagtttactgtatgataataggagacgagggatatataggggtataaagatctctgta
ctttttgccgatgataaaccttggagatattgtaacgatatttgtaaaaaaataggtaag
gtaaaatttaaagctcatatttcgggggattacgaagctttaatttatccttctgttgca
tacgttttagataataatgaatataatgtttctaagatagtgagttatgagggtattttt
tcatcagctttatttggaaagagacaagttgaggttgagggtttattaatgagctgtgag
aaggagaacgttgtaattatcggtgacaaagatgttagagggtttattagacctttg
>SSO0214 Conserved hypothetical protein
atggcgaggcagccactgatgatttatgttggtatcgatccaggtagtgagacttatgct
ttcgcctttgttgatgaactagggaatttgatcaaatattttgaaatatgtacagatcta
gtagagaaaagctctatatttttagccaaactaatagccgattatagacctatggcagtg
gctttgccttctggtcatggtctacctttctacaatattagaaatattaacaatcgagaa
atatttatccttacgttaaaagatccattatctcatggccctttaagagatttcttacta
gcttcaaaacaatatttgtctttttataattcttttacgattccctcagttattgaacta
aatagtctacctaatgataggaaggtaaatgttattgataagggcactgcagataaggtt
gcttctacatttttctatagggtttatcttaaactagataattttattctagttgaaatg
ggaagaagatttactgcaattgttatcgttattaacggtaagatagttgatggttatggc
ggaacctatttatctggtttagatggagaaatagcttatcttcttcataaatattctagg
atagataagtcaactgtttataatgttggtaggaatttagagcttaccagaattatagtg
gaatggtatagtgataagtataagttgccgattatagtatctggatataataagaactat
ttggagattggtaagaaatatgattttaagtttaaggaagcagcagtcggtgcggcattt
atcgctaatgcgtattctggtgggcttctacgtcattatattagtatgttggatagtagt
gggactccaatctcgtttgtgaggttgaaagaatgggacgagattatttcttggatagag
acatta
>SSO0215 (rps10AB) SSU ribosomal protein S10AB
atgcctacaaaagctagaattcgattatggagtactaacgttgagaatttaaattatgtt
ataacgcaaataaggggtatcgttgagaaaacagggatagaaatgagaggtccaattcca
ttgccaactagcaaactagaagttccgattatgagacttcctcatggagaaggaaggaaa
aagtgggaaaaatgggaaatgagggtacataaaagattaatagatattgcagcagatgaa
cgtgtgatgagacagctaatgcgagtgagagtacccgaggacgtttacattgagatacaa
ttgata
>SSO0216 (tuF-1) Elongation factor 1-alpha (elongation factor tu) (EF-tu)
atgtctcaaaagcctcaccttaatttaatagtaataggtcatatcgatcatggtaaaagc
acactagtgggaagactactaatggatagaggtttcatagatgaaaaaacagtgaaggaa
gcagaagaagctgctaaaaaattaggtaaagaatctgaaaagttcgcatttctactagat
agactaaaagaagaaagagaaagaggtgtaacaataaatctaacattcatgagatttgaa
actaaaaagtacttctttacaataattgatgctcccggtcatagagacttcgtaaagaac
atgataactggtgctagccaagcagatgccgcaattctagtggtttcagctaagaagggt
gaatatgaagctggaatgagcgtagaaggacaaacaagagagcatataattctagccaag
accatgggtttagatcaattaatagttgcagtaaacaaaatggacttaacagagccacca
tatgatgaaaaacgttataaggagattgttgaccaagtcagtaaatttatgagaagttat
ggatttaatacaaataaggttagatttgtaccagtagttgcacctgcaggcgataacata
actcatagatcagaaaatatgaaatggtataacggtcctaccttagaagaatatttagat
cagttagaattaccaccaaaaccagtagataaaccattaagaattccaattcaagacgtc
tactcaatctctggagtaggtactgtaccggtaggtagagtagaaagcggagtgttaaag
gtaggtgataagatagtattcatgccagcaggcaaagtaggtgaagttaggtcaatagaa
actcaccacactaagatggataaagcggagccaggtgacaatattggatttaacgttaga
ggtgttgaaaagaaagatataaaaagaggagatgttgtaggtcatccgaataatccacct
actgttgctgatgaattcactgcaagaataatagtagtatggcatcctacggccttggca
aatggctatacaccagtgattcacgttcatactgcgagtgtggcatgcagagtttcagaa
ttagtatcaaaactagatccaagaactggtcaagaagcagaaaagaatccacagttcttg
aaacaaggagatgtagcgatagtcaaattcaaaccaattaagccactatgcgtagagaag
tataatgagttcccaccactaggcagattcgcgatgagggatatgggtaagactgttgga
gtaggaataattgttgatgtaaaaccagccaaagtagaaattaaa
>SSO0217 (rpS7AB) SSU ribosomal protein S7AB
atgtccttagagaacttacaattagacatcaaagtgtttggtaagtgggatactaaagtt
gaaatcagagatcctagcttaaagaagtacatttctctaatgccagtttatttgccacac
actgggggtaggcatgaacataggagatttggtaaggctaaagttccaatagttgaaagg
ctaataaatcaaataatgagacctggtagaaataaaggaaaaaaacacttagcatataat
attgttaaattagcattcgacataatttatttaaagactggtcaaaacccaatccaagta
ttagttagagccatagagaatagcgcacctagagaagaagttactagaattatgtacggt
ggtatagtgtattacgtcgcagtagacgtatctccacaaagaagaatagacttagcctta
aggcatatagctaccggtgctaaggatgcatcgttcaataatccaaaacctattgaggaa
gttttagcagaagaaataattgctgcagcaaacaatgactctaagagttttgcaattaaa
agaaaagaagagatagaaagaatagccttaagttcaagg
>SSO0218 Conserved hypothetical protein
gtgatgagtcttcaaccaatcaaggacgaggattatataaaagttaattctgttgacgca
ttctttatgcctcttcatggtataccaactatagtatgttatttggaagacggaagacaa
ttttatctattcagcgtacctgcagaaatcgttatagcaataaataaaacgaaagggaat
aaagaggaggagtttggcgataaaagagaaaatatatatgatatcatctcgtttatacca
gaaatcaccgaggaattttccaagcatatagaaaaagttattatagacgatatgataagg
gatacgggagtttacgtagctacagttgaatttaaatttgatggtgtaataattcagaaa
agaatgataccaagtcatgcaatatttcttgctataatttcaaataagccgattttcgtt
aagaaaggattagttgatgaacaagaaaaggaaagtagagaaggacaacaaaaattt
>SSO0219 (rpS12AB) SSU ribosomal protein S12AB
ttggaaaaggtggttaaaagcaagtcacctaaggggatatacgctgctaggaagttaaga
ctaaaaagattaaaattcagaagaagtcaaagaaagtataagacgaagatactaaagtta
aaggagaaatatgatccattaggaggagctccaatggcaagaggaatagttttagaaaaa
gtaggaatagaatcaaggcaaccaaattcggcggttagaaaatgtgtaagagttcagtta
gtaagaaatggcagagttgttactgcatttgtgcctggggacggtggagttaatttcatt
gatgaacatgatgaagttataattactggaattggaggtacattaggtagatcaatgggt
gacttacctggagtgaggtataaggttataatggtaaacggtgtatcgctagacgcgtta
tataagggtaagaagcaaaagccagtcagg
>SSO0220 (nusA) Transcription termination factor nusA homolog, putative
gtgacaagagctaatgtgagagattgtattatcgataatgaaaacaataggataatattt
ctagtagattcaaaagatatgggagtcgctataggtaagagcggtattaacgttaaaaag
ttaaagaaaattataggtaaagatatagaactagtagcttatagtgacaatttagaggaa
ttggtaaaaaatctaatgagcccagctagagttagaagtgtgaaagtagtaaatactagt
tctaaaaagtcagtatatataaatatagatcctcaagataaaggattagcaataggtaag
aatggtaggaatgtagcaagagcaaagctaattttaaagaggtatatggatattgataat
gtggtaatagtt
>SSO0221 (rpl30E) LSU ribosomal protein L30E
gtgataaaagtgtcagaacaacaagtttcatttgaaggagagttaaaatcacttttgaaa
actggtaaagttatttttggtgctaagagagcgataaaatatataaaattaagtaaagtg
aagatggtaattgttgcatcgacattaagaggagatcttaaacaagatataatgcattat
gcgaagttatctaacatacctgtatatgaatacaagggtagtggctgggatcttggaaca
ctatgcggtaaaccgtttatgatttctacaataagtattattgatgagggagattccaaa
attttagatattataaaggagagg
>SSO0223 (rpoA2) DNA-directed RNA polymerase, subunit A'' (EC: 2.7.7.6)
gtggaaggcatgattgatgagaaagataagccctatttagaggagaaagtgaagcaagct
tccaatatcctccctcaaaaaattgtagacgatttgaaaaatttgatattaaacaaggaa
ataatagtgacgagagatgagattgataaaatcttcgatttggctattaaagagtatagt
gaagggttaatagctccaggagaggctattggaattgtagccgcacagtcagtaggtgag
cccggtacccaaatgacattaaggactttccattttgcgggtataagagagttaaatgta
actttaggacttccaaggctaatagaaattgtggatgcgaagaaagttccatctactcca
atgatgactatttatttaactgatgaatacaagcgtgatagggataaagcgttagaagtc
gccagaaaattagaatatacgaaaatagaaaatgtagtgagttcaactagtatcgatata
gcctcaatgtccattattctccaactcgataatgaaatgttaaaagataaaggcgttact
gtagatgatgttaaaaaagctataggtagattgaaattaggagattttatgatagaagaa
tctgaggatagtacattaaacataaatttcgctaatatagatagtatagctgcgctattt
aaactaagggataagatacttaataccaaaataaagggaataaagggtataaaacgtgct
atagtccagaaaaagggcgatgagtatatcattttaaccgatggttcaaatttatctggt
gttcttagtgtaaaaggagttgacgtagctaaagtagagactaataatatccgtgagatt
gaggaagtatttggaatagaagcggcaagggaaattataattagggagattagtaaagta
ttagcagaacaaggattggatgttgatataaggcatatattattaattgcggacgtgatg
acgagaacgggtattgtaaggcagataggtagacatggtgtaactggagagaagaatagt
gtattagcaagagctgcatttgaagttactgtaaaacatcttttagatgctgcggctaga
ggagatgtagaagaatttaaaggtgtagtagaaaacattataattggtcatccaattaaa
ctaggtactggaatggttgaattaacaatgaggccgatattaagg
>SSO0225 (rpoA1) DNA-directed RNA polymerase, subunit A' (EC: 2.7.7.6)
atgagtgaaaagaatataaaaggaataaagtttggaatactttctcctgacgaaataaga
aaaatgtcagtgactgcaataataacaccagacgtttatgatgaagacggtactccaata
gaaggaagcgtgatggatcctaggttaggtgttatagaacctggacagaaatgtccaact
tgtggtaacactttaggcaactgccctgggcactttgggcatatagaattagttagacca
gtaattcatgtaggtcttgtaaagcatatatatgagtttctaaaagccacatgtagaaga
tgtggtagggttaaaatttctgaagatgaaatagagaaatattctagaatatataatgca
ataaagaaaagatggccatcagcagctaggaggttaactgagtacgtaaagaagactgca
atgaaagctcaagtttgtccacactgtaatgaaaagcagtacaagataaagttggagaaa
ccatataatttctatgaggagaggaaagaaggtgtagctaaattaactccttccgacata
agagaaagattggaaaaaataccagattccgatgttgaaatactaggttatgatcctaca
accagtaggccagaatggatgatattaactgttcttccggttcctccaattacaattaga
ccttctattatgatagagagcggtataagagctgaagatgacttaactcataagttagtt
gatatagttagaattaatgaacgattgaaagagagtatagatgcgggagctccacagcta
ataatagaagatttatgggaccttttacagtatcatgttgcgacttactttgataacgag
attccgggattgcctccctctaaacatagatcagggagaccattaagaacattagcacag
agattaaaggggaaggaaggtagatttagaggtaatttatctggtaaaagagttgacttc
tcatctagaacagtcatatccccagaccctaatattagcatagacgaagtaggggttcca
gaaattatagctaaaacacttacagttccggaaagaataaccccatggaatatagaaaaa
ttaaggcagttcgttataaatggacccgataaatggcctggtgccaattacgtaattaga
ccagacggtagaagaattgatttaaggtatgttaaagataggaaggaactcgcatcaact
ttagctcctggatatataatcgagcgtcatctaattgatggagatatagtattatttaat
agacaaccttctcttcacagaatttcaatgatggctcatagggttagagtactaaaaggg
cttacatttaggttgaacttgctcgtatgtcctccatataacgccgatttcgatggggac
gaaatgaacttgcatgttccacagtcagaagaagcaatagctgaagccaaggagataatg
cttgtacataaaaacataataaccccaagatacggtggccctattataggagctgctcaa
gattatataagtggtgcttatctactaacagtaaaaactacgttattaactaaagaagaa
gcccagcaaatattgggtgtggcagacgttaaaattgatcttggggaaccggcaatttta
gcacctagggagtattacactggtaaacaagtaataagtgcttttctccctaaagatttt
aatttccacggtcaagctaacgttagtagtggccctaggctgtgcaagaacgaagattgt
ccacacgattcgtatgtagtgattaagaacggaatactattagaaggtgtatttgataaa
aaggctataggaaaccagcaaccagaaagtatcctccattggctgattaaggagtattct
gatgaatatggtaagtggttaatggataacctatttagagtatttattagatttgtcgaa
ttgcaagggtttacaatgagacttgaagatgtatctttaggagatgatgtaaagaaagaa
atttacaacgaaatagatagggctaaagtagaagtcgataatctaatacagaagtataaa
aatggagagttagaaccaataccgggaagaactttagaagagagcttagagaattacatt
cttgatacattagataagttaagaagtactgctggtgatatagcaagtaaatatttagat
ccgtttaatttcgcctatgtaatggcaaggactggagccaggggtagcgtattaaatata
acgcagatggctgctatgttaggtcaacaatcagttagaggggaaagaataaaaagaggg
tatatgactagaacattacctcactttaaaccttatgacatctcaccagaagctagaggt
ttcatttattcttcatttagaactggtctgaagccaaccgaattattcttccatgcagct
ggaggtagggaaggtctagtagatactgcagtgcgaacctcacagagtggttatatgcaa
agaagattaataaacgccttatcggacttaagggctgagtatgatgggactgtaagaagc
ttatatggcgaagttgttcaagtagcgtatggtgatgatggtgtatttcccatgtattca
gctcatggtaaaacggtagatgtaaatagaatctttgagagagtcgtggggtggaaggca
>SSO0227 (rpoB1) DNA-directed RNA polymerase, subunit B' (EC: 2.7.7.6)
ttgctgtacggaataaatgagaggattgtagaaaaaacactttatgaaatgggagtagtt
ccagtggaggaggtcataagaagagtaacggaaggcggagaggatcagaatgagtatctg
aaatggtctaaggttatactcaatggaagattaataggctattatcaagatggtggagaa
ttagctaataagataagagaaagaaggagaaaaggagaaattagtgatgaagtaaacgta
ggccatatagtgacagattttattaatgaggttcatgttaattgtgattctggaagagtt
agaagaccacttataattgtttctaacggtaacccgttggtaactattgaagacattgaa
aagttagaatcaggtgctattacatttgacgatcttgttagacaaggaaagatagagtat
ctagatgcagaagaagaggagaacgcttatgttgctttagaacctaatgacttaactcca
gatcatactcatttagaaatatggtctccagctattttaggcataacagcgtctataata
ccatatccagagcataatcaatcacctagaaatacataccaatcagctatggcgaaacaa
gctctaggtctatatgcagcaaattatcaattacgtacggacacgagagcacatttactt
cattatccacaaagacctctagttcaaactagggcattagatattataggatatacaaat
aggccggccggaaataatgctatattagccgtaatgtcatttactggctacaatatggaa
gattcaataattatgaatagatcctccgtggagaggggaatgtatagatctacatttttt
aggctttactcaacggaagaggtaaaataccctggaggtcaagaagataaaatagtaatg
ccagaagctggtgttagaggatataagggcaaagaatattacagacttctagaggataac
ggagtagtctctccagaggtcgaagtgaagggaggagatgttttaataggtaaagttagc
cctccaagattcttacaagaatttaaagaattatctccagagcaagctaagcgtgacacc
tcaatagttacaagacatggtgaaatgggtatagtggatttagttctaattaccgaaact
gctgagggtaataagctagttaaggtaagagtaagagatcttaggataccaacaattggc
gataaattcgccagtagacatggacaaaaaggcgttataggtatgctcataccacaagtt
gacatgccatataccgttaaaggcgttgtgccagatataatattaaatcctcatgcattg
ccatctagaatgacgttaggacaaattatggaaggaatagctggtaaatatgcagcatta
tccggaaatattgtagatgctacacctttctacaagacacctatagaacaattacaaaat
gagattttgagatacggttatctaccagatgctactgaagtagtgtatgatggacgtact
ggacagaaaattaaatctagaatatactttggagtagtctattatcagaaattgcatcac
atggtagcagataagcttcatgctagagctaggggtccagtccaaattttaactagacaa
ccaacagaaggaagagctagagaaggtggtttaagatttggagaaatggagagagattgc
ttaattggttttggtactgcaatgcttcttaaagacaggttattggataactctgatagg
acaatgatttacgtttgtgatcagtgtggttatataggctggtacgataagaataagaat
aaatatgtatgcccaatacatggtgataagagtaacttgttcccagttactgtatcttac
gcatttaagcttttaattcaagaactaatgagtatgattatctcacctaggttagttttg
gaggataaagttggattaagtggaggt
>SSO0228 (infB) Translation initiation factor IF2 homolog
atgaaaattagcaactctgagagaaggcttaggcaacctatagtagtagtattaggccat
gtagatcatggaaaaactacactacttgataaaataaggggtacaacagtagttaaaaag
gaacctggagaaatgacacaagaggtaggagctagtttcgttccaagttatataattgaa
aaattagcagaacctcttaagaaggtaatacccataaaacttcagataccaggattattg
tttattgacacgccaggtcatgaatatttttcaaacttgagaagaagaggtggaagcgta
gcagatattgcgatcctagttgttgatataactgaaggcctacagaagcaatcaatagaa
tcaatacaaatactaagagaaagaaaagttccatttctcatagctgctaataaaatagat
aaaatacccggatggaaatcaaataatgacataccgtttttagcatcaatcgagaaacag
aggaatgatgtgaaagtttatctagacaacttagtctataatttagtttctcaattagca
aacttaggctttagctcagaacgttatgatagaataaaggatttcactaaaacagtagca
atagttccggtttctgcaaagaccggtgaaggcgttgcagatcttttagcattactagct
ggattaacccaaaggtacttagagactagattaaaatttgcagagggtccagcaaaggga
gttatattagaagtaaaagaagatccagggttaggacacaccatagatgttataatttat
gatggagtgcttaagaaaaatgatactataatattaggaggcattaacggcattattata
actaaagttagaggaatatttgtacctagaccattacaagatatgaaattaagcaagtat
gatctaacgccaatagatgaagtatatgcagcagctggagtgaagatatctgcacccaat
ttagaggaagcattagctggatcaccaatttatgtggtagaagacgagtctaaggttgag
cgatataaacaacagatagaagaggaaattaaagaagttagactctacagcgatattgac
ggaataatactcaaggcagatagtttaggaacattagaagccttagttagtgctctgcag
cgtgaagggattccaataaggctagcggacatagggccgatttcgaaaagagatgttata
gaagcgagtatagtagctcaaagatcaaaagaatatggaattattgctgcttttagagta
aagttattacaaggaattgatactagtggaataaaaatattgtataacgaaataatttat
caattaatcgaagatatcaagaagcatattaatgatgtcagggaagcggaaaaaaggcgc
acgtttgacacattaatattgccagggaaaataaagatcttgccgggttatgtatttaga
cgcagtgacccagtagtagtaggtattgaggttataggaggcattataagacctaagtat
ccgttaattaaggaagatggaaggagagtcggtgaggtactacaaatccaggataataag
aaaagtctagaaagagccactaaaggaatggaagttgcaatatcaattaaaggcaatata
atgattgggagacatgtaaatgaaggggatgttttatacacagacgtacctaaagaagac
ctcgagatattagtcaacaagtatccaagttctattacagatgatatgagggaagtaata
aaagaaataataagaataaagagaaaagaagatcctttatatggattaggattacagatc
>SSO0230 (ndk) Nucleoside diphosphate kinase (NDP kinase) (EC: 2.7.4.6)
atggttgcacaaagaacatttgtaatgataaagccagatggagttaagaggggattaata
ggcgagataattagtagatttgagaaaaggggattaaaaattgtatctcttaaaatggtg
aaaatgtcaagggacacagctgaaaaattgtatgaggagcacaaaggaaaaagtttcttt
gaagaacttgtaaattacgtgacctctggtccagtagtatgcatggtgatagaaggcgat
gacgtagtgcaagtgataaggcgaatgattggtaatacagatcctaaagaggcacctcct
ggcactataagaggagattatgcgttatctaagtcagaaaacgtcattcatgcatctgat
tctattgaaaaagctcagcgagagatgtcgttattcttcgataaatcagatctg
>SSO0231 (upP) Uracil phosphoribosyltransferase (EC: 2.4.2.9)
atgccattatacgtaatcgataaaccaataacattacatatattaacacaacttagggat
aaatataccgatcaaattaactttaggaaaaatttggtaagattagggagaatattaggc
tacgaaatatcaaatacattagattatgaaatagtagaagttgaaacaccactaggtgtg
aaaactaaaggggtagacataacagacctaaacaacatagtcattataaacatattaagg
gctgcagtacccttagttgagggtttacttaaagcatttcctaaagcgagacaaggtgtg
ataggggcaagtagagtagaagttgatgggaaagaagtaccaaaagatatggacgtttat
atatattacaaaaaaataccagatataagagctaaagttgataatgtaataattgcagat
cctatgattgcaacagcaagtactatgttaaaggtacttgaagaagttgtgaaagctaat
cctaaaagaatatatattgtatcaataatttcttcagaatatggggtcaacaaaattctc
tctaaatatccatttatttatcttttcacagtcgcaattgatcctgaacttaataataaa
ggttatattttgcctggtctcggagacgctggagatagagcatttggg
>SSO0232 (gatB-1) Glutamyl-tRNA -Gln amidotransferase, subunit B (EC: 6.3.5.-)
ttgaaaactaaactattctgttcatgtccatcggattatactggaaaagacccgaataca
gtaacttgtcccgtatgtttaggattacctggggctattcccgtattaaatgaaaatgca
gtaaaatacggtatcttaactgcattagcccttaactgtcaaattgctgaaaaattgatt
ttcgatagaaaacactatttttatccagatatgtctaaaaattatcagatatctcagtat
gatggaccaggtagtatggccatagccaaagacggttatatcaaattaaatgataaaatc
ataagaattagaagaataaatatagaagaagatccggcaaagatagtctaccctactggt
tctatactaactagcaaatatacgttactagactataatagatctggtacaccattgtta
gaaattgtaacagaaccagatctaaggtctgctaaagaagccagattcttcctagaaaaa
ttaaggtcaatcctagaacatttaggtgtatgtgattgtggtattgaaggtgcaatgaaa
gctgatgtaaatatatcagtaaaaggaggagagagagtggaagttaagaatgtgggttct
cctaaagacgttgaggatgctataaattatgaaattgcaagacagagagctagtatacta
caaggtatcaagatagaaagagagactagacattgggataacgaaaggagagttacagta
cctttacgaactaaagagactgaggaggattatagatattttccagatccagatttaccg
ccatactcaataacaccagagcttatcgagaagtttaaacgtgaaatgccagagttacca
gaccagagagcggagagatttgtaaaacaatacaacgttactccatatcaagctcaagtt
ttagttaatgaaaaagcgttagcagatttatttgaagaaatcacaaacaactataaaaac
tatgccaaagtcgcaaatctgctaattaacgattacatgagatggcttaacgaaaataat
atcacagtaacacaaagtaaagccaaagctaatcatatcattgaactatttgaatactta
gattctggcttaatatcaataaaaatagtaaaagaactactacctgaaatgatcttaact
ggaaaaactccgggacaactaattaaggaaaagggtatgacaaacatcaaagatgagaac
tacttagaaaggattatagatgaagtattaaatgaagagaaagaggctgtagagaaagct
aagagagatccaaaagttgtaaattatttagtaggtatggtaatgaagaagacggggaaa
agagctgaccctcaaatgacagttgaaataataaaaaagaagctaggtttaact
>SSO0233 Conserved hypothetical protein
atggagatttttatgttacagagtaatcaaataaaggaaaaagaattacggcttaggcta
tttagtgtagatatcttaaaagaattgaaaaacatttatacttacaaagaattgtccaaa
ttcttcaatattcaagaaagtttgatatgtagatacgttaacgggagaacaatacctagc
gagagacaagctttagaaatcgttacaaggataaagaataaggaatttctatataacttc
tttataagaaaaataagagtttatgaagatgatttcatagatgtatctaatttgctattt
tatcctaacttactaaaaacatttctagaattatatttaattaaattaaataaagttagt
gatgtaacaaaaatagtaggcattgcctcaaacggaatcccatttgctacaatagtagct
tcaatattagaaaaaccactcataatatcgaaaaaacataaggactctactcagatacaa
tatattgaggagaatatcagagaaagtaatggcgtaatttcaacactttacataaggggt
gattatatttcaaaaaaggataagatacttatagttgatgatgtaattagaagtggaaaa
accctactttcactttacaacttgataggtaaagcgaatgcaagtgtagtaggggctctt
ataatagcaactaatactgatacttggaaggataaattcataaacaaagatataaatctt
atggtgctttttaaagta
>SSO0234 Hypothetical protein
atgagtatagctaaaattcaaagaaatgtttacgtcataggtggtaagttaatagacgat
aatgataccaatgcatatctagtttatgatgacgaaaaaaattattatacacttattgac
actacaactggtgctaacattcgatacgtaatagagagccttttagagatcttaaaggga
aaggataaactaaagtacgtcatattaacaagctgtaagtttgaaaatagtggtggatta
tactatatttataatttatttaaaccaattacaatagcacattttccagattctataatg
atcagaaaaggtgagtgcgaaaatagattatataccccatccccaatatcattagaaatt
aagcagaaacaatatattttggataatcttttaatactccttagtaaaaatatcactaat
ggaaatatagtggtaaaatataatgatgtcttgttttctggaagtaatacaaagatcaca
caatattctaaatacataaaatatatttgcgatgtaaacaaatgtagatcagtgagtgat
>SSO0235 Conserved hypothetical protein
atggctcagatagtaaatactgaaaggcattccagacttttgcctgcaccgtcaagtttc
gaggaaggagtagtcaaatttggagataaagaaattaatataggaggacccttaccaaca
ttagctaaagatgagaaattagttagagtaactcattcactatgtccagcatgctatagg
ctattaccagctactatatttgaaaaagaagggaaattgttcataagaaaaatatgccca
gaacacggagaatttgaggacttatattacgcagattctagtctatactataagtttgac
tattgggagtatgaaggaaaaggacctaaagtcccctatgttgacttgaaatctccctgc
ccttataactgtggattatgcccgatgcatcatcaacactcagcattagttaatttagtg
ataacaaatagatgtgacttatcttgttggtattgtttcttctatgctgaaaaggcagga
tatgtttatgaacctacgttagagcaaattaagtttatggtagatcaactaaagaaacaa
gatattacgcttgttatccaagtgactggaggagagcctacattaagggaggacataata
gaaataataaagatgcttagagaaaatggtgtaaaacatattcaattaaatagttgggga
ggcacttttgctaaactgtatttagaagatcccgataaggcaattaaatacgctagagct
cttagagaggctggagtaaatactgtatacatgagttttgacggtacaactagaaaaact
aatcctaagaatcattgggaaattccctacacgttagaagtattcagaagagcaggaatg
acaagtgttgtgctagttcctactgtaataaagacagttaatgacaatgatctagggaat
atagttaagtttgcagcatataatatggatgtagttagatcagtaaacttccagccagtg
agcttaaccggaatgatgaaaaggaatatgagagctaaattcagaatcacgatacccgaa
gttataaagaacatagaagaacaaactgatggtgagataactaaggatagttggtatcca
ataggtacttctgttgtcttctcaaggctagttgaagctttaactggtaaggagcaattc
gaaatggctaatcatccttcttgtggagctggaacatatgtatatgtagaatggaggaat
cacgaacctcacttcataccaatttcgaagtttattgatttagaaggtttgctagaatat
cttaaagagaaagaagaagagttaagggaaggcgctaataaggtatgggttgcaagtaaa
gtattgtatagtataaggaagttcatagataaagagcaaggacctaaggactttgatgta
tataagatgctctataacataataattcatcataactacgaagcacttggagagtggcac
tatagaacattattcttaggaagtatgcacttcatggacttatataattacgatgtacaa
agagtgatgagatgtgatattcactatgttgttccggatggtagagtaattccattctgt
acctataatgtattaaacgatttgtatagagataaagtattaagagaatatcaaataccc
cttgataaatggactaaggaacatggagagaactcattgggcgatgctataaagtataaa
cgtattgcttcaaccttagagaattccgagatctataagaacacttacaaatccttccaa
cagatg
>SSO0237 (thiL) Thiamine monophosphate kinase, putative (EC: 2.7.4.16)
ttgataagtaacttgtattttgtgaaactaaaaaacataggcgagcacgagtttattaag
agatatattaagaattatatggacattaaattattagatgatgtattcatcaatgaaaaa
agaggatataaggtggatggatttaagctgtcgtacgcttttccatttatgtcactctac
gatattggatggaaggcaatttcagcctctaccagtgacattatagcgaagggagttaaa
cctgaattctatttaatttcattgggcttacctcctgatttcgatgtgaataaagcagag
gaacttattggcggtatatctgatgctattcattattatggaggaaggtatgtaggagga
gatttaaatgattccgattctaatggctgggttgatgtttttgtagaaggagaagtttta
tgtgatattagtgataaagttattgatgatggtgatcttttagtaattggtgactatatt
ggttataccactaatgtttttatttcttatataaacaattttaatatacaaatcttgcca
gaatcgttacttaaagtaaaacatcctatcgttaaaaagtcattactattttttatgaaa
aaatactgcaagttcattaaatattctactgatattagtgacggtcttatggtatcttta
tataaaatagttgataatttcaacttagggataaatattaccgaaattccaatagataaa
aatgtcttcaactcgttaaagcttcgcttaaatttaactgaactcgatattttaaaatac
gctggagaagagtttttgcctttacttattatagacaaaaattccccagtgaaggaaatg
ctagctgaacttcaatatctagcgtttaatccattaattatcggacaagttattcatgaa
aatagattaataacatataaaaataccgtgattaaaaatactggatgggataatttcatc
ggttggtat
>SSO0239 Conserved hypothetical protein
atggctaattgtaaagtatgttcaacatttattaacttatactgtaatctcacaacaatg
ataatcgcaacaatcggtagtcattctgcattacagatcttacatggagccaagaaggaa
ggttttcaaactatggtaataactgataataaaagagaaaatttctacaaaaattttagt
tttattgataacatttatgcatatgctagcctagatgaagcagtatctataattaatggt
attaaggattatggtatattaatcccacatggaagtttagtagaatacctaggcaaggaa
agagtagataaaattgagacaaaaatttttggaaacaagaaaatattcgagtgggaagca
gatcagaaaaagaaaatggaactacttagaaagtcaaacataaagattccagagatattt
gaaagaccagaagatgtggatagattagtaatcgtaaagcttaacggagctaaagggggt
aagggatacttcctagctaggaataaaagtgaagtaaaagaaggaattcaaaagctcatt
gagagtaaaatgataagagacgaaaatgaagtaataatccaagagtatgtcgtaggagtt
ccgatgtattttcaatttttctatagtgacattataaatagaacagaaatcttcggaata
gatataagatacgaaactaacatagatggacttagaaggcttccttttgagtatatgaaa
gaacttaagataaaccctacgtttgtagttgttggcaatattccagctgtagctagagag
agcttactaccagttgctttagagtacgctaataacttcgttagaactactaaggaatta
gtacctccagggatgataggaccattttgtttagagtcaataataactgataattcagat
atagttgttttcgagttctctggaagaatagttgctggaactaacttatacgtaaatggg
agtccatatagttggctttactgggatgagcccatgagtataggaagaaggatcgcaaga
gaaatcagagtcgcaaacgaaaaagataagttaagcctcgtggtgagc
>SSO0240 (purB) Adenylosuccinate lyase (adenylosuccinase)(ASL) (EC: 4.3.2.2)
gtgagattacagtataagttaataaatgttgaacatactttacaattagccatggaggat
agtatatgtcctttagaatggagatacggtagtaatgagatgagaaagtttttcagtaga
gaagaaatcttgaaaaggagaattcaagtagaaatagcgttattaaaagcattaaccaaa
tatggtttagtaaaagaggaagacgttcaaaaagttgagaaagcttcattaacaataaga
ccagaggaagtagatgaacttgaatcaaaaattggtcatgatgtaatggctatggtagtc
ttaatggcagaaagaagtggagattctggaagatacgttcattttggggcaacaagttat
gatattgtagatacagcttatgcgttagtatttagagacgcaataagattagtaaagaca
aaagtagtagaaatattggaaatgatggttagtttagcaattaagtataaagatttagca
atggtaggaagaactcatgggcagcatgcattgcctataacattaggctttaaaattgca
aattatatctatgaattttctagatcactagagaggttaaatgaggttgagaaaagaata
gtaaaaggtaaaatggcaggtgcagttggcacgatggcagcttggggcaatatagggtta
gaaatagaagagaatgttatgaaatttttaggattaagacctcatgagatttcaactcaa
gttgctccacgagacgcatttgcagaattaacttctgatcttgcaattttggcatctcaa
tgtgatcgattcgcattagaagttagggaactaatgagaccggaaataaatgaaataagt
gaaggcgtagaaggtcgtgtaggaagtagtactatgcctcagaaggaaaatccagtcacg
tcagaaaagattgggggtttagcaaaagttttacgctctcttgtcgtagcgtcactagaa
aatattccattatggcacgaaagagatctgactaacagttcgtcagagaggataataata
tcacatgaatttctagttattgacgaaatattagatagtatgataagtcttttgaggaat
ttaagggttaacttcgagaatattgaaaagaatttgaacttaactaaaggacaaataatg
gcagaaagtctgatgataaacttaaccttaaagggcatgaaaaggcatgaagctcatcaa
tacgttaacaaactgacgtcaaaagtaagacaaactggaaaaacgttattagaggtttgc
ctagaggatagtttaattttaagttatttctctaagcaagaacttgagaacgtacttaat
cctaaaaactacttgggttcctatgataaattaatagagagagctattagctatgcaaaa
ggcgtaatcaaaggttcagaaatacgagaagctcaagataga
>SSO0241 Conserved hypothetical protein
atgaatgttaagatagctgcattagctagtcattctgcacttgacgtcttcgatggagct
aaagatgaaggttttcaaacaatagggctgtgtaaaaagggaagagaaagaccttatttg
gaatttaaagcaatcatggataaatgcataattttggaagatttcaaagaaataatctca
gataaggtacaaagtatactactcagcgaaaatgccataattgttcctaataggagctta
gcggtttatgtaggttatgatggaatagaaaaaatgaaaacgaaagtcttcggcaataga
tatatgttacgatgggaagaaaggataggtgagaaaaattattataaaatactaaatgag
gcgaagatctctatacccaaattattcaaaccagaagagattgatagaccagtaatagtt
aaactacctgaggccaaaaggaaagttgagagaggattctttttcgctgtaaacaaggaa
gatttcgaagctaaactcaacgaattattgagaaataacgtaatagataatgaaggttta
aaaaatatggtaatagaggaatttgtgtttggagctcactttaatcttaactacttctac
agcccaatatttaatagattagaattaataagcgtggatagaagaattcaaagtgactgg
gatagcttatatagattgcctgctgacattcaaataaaattaggtaggataccaaaacta
atagaggttggccatgagccagtaacaataagagaaagcttgttggaaaaagtctttgag
ataggatataggtttgtagacgccacacaaaaacttgagccccctgggataataggaccc
tttactctacaagttatggtgaccccagatttggatcttgtcgtatacgatgttgcccca
agaattggaggtggtacaaatgtatatatgggaactgggagtcaatactctaaattttac
ttcggaaagccaataagtttaggaagaagaatagcattagagataaagcatgctataata
aataatcttaccgaaaaaatactaact
>SSO0242 (purA) Adenylosuccinate synthase (IMP--aspartate ligase) (EC: 6.3.4.4)
atgctagaattaattattggaggattttttggtgatgaaggaaagggaaaagtagcggca
tatttgggtattaaagatagaccaaaattaagcgtgaggacgggatctattaatgccggg
cataccgttacatattcagggaggatatggaagctaaggatcatcccatctgcatttata
aataaatctaccgaattagctctaggtcctggggcgctcacatcgttagacgccctattt
aaagagatgagggaaacagaaacttatgatagattatatattgattctcatgttggaatt
ataaccgaagatgagataagagatgagaaaaacgacccttatcttatgaatgtaattgga
agcactggccaaggcgtcggttatgcagagagcaaaagaatattaagaaaattaaagtta
gcaaaagattataaagaacttgaaaagtttatcatagatgttcctaataaaatattggat
tacttagataatggtcataatattcttatagaaggaacgcaaggacactatttaagtctg
taccatggcgaatatccatacgtaactagtagaaacactactgcatcaggggtattaagc
gaggctggaataggaccaaaatatgtggatcacataataattaccttcaagagttacgtt
accagagtaggaaaaggtccactggaaggtgagttaacagaagaagatgcaaaaaaactc
ggtttaacggaatatggtaccgtaactggaagattaagaagagtagcgccatttaacgtt
aaacttgctagggaagcaatcagaataaattcagctacaatagttgcgataactaaacta
gacaccttatttaaggacgcatatagagtaagagaatatgaaaaattacctgctgaggct
aggaagtggctagatgaattagaagaagagctaaaaacgcctattgggcttattggaact
ggagaggacgcatatgacatgatagatctcagagaggaggtgggg
>SSO0244 Conserved hypothetical protein
atgagctcttatgatgttgtaataattggaggagggcctgcagggctatttgctgcatat
gaactagcgggtttagctaaagataacgtctctaactataagatactgttagtcgataag
ggagccagagcaagtaaaagaacttgcccacttctatcaccaaaagagaaatgtacattt
tgtgatccatgccatatcatgtatggttttggaggagcgggaacgttcagtagtggaata
ataaacctaaggccagatattggaggagaattacatgaaataacgagaagttgggataag
gcacaagaattaataaattacgttgacgatatttttgtaaaatttggagcgccgaaggac
agagtattcgaaccaaatatggaaaaagtcagagagatacaaagaagagctgcaaaagta
ggtgctgagttcgttccaattagacaaaggcatatgggaactgataaaacaccactaata
atagagaatattgtaaactatgtcgagaagaggggaataaaaattggtgagctaactgag
gttatagacatagaaaagaaggggaacaaattctttctcaaaacttcaagaggcgaaata
gaatctagaatagtcctcgtagctccaggtagagccggggctaaatggttctatgaacaa
tctaaaaaattaggagtagataccataccaggaccgttagatataggagtcagagtagaa
acagagtcgtttgtatttgacgaacttacagaagctgtgtgggatcctaaggttatacta
tactctaagagatatgatgataaagtaagaacgttctgtgttaacccaagaggatatatt
atgaaagaggtttatgatgatggaactattggagttaatggagaaacctatgtcgataaa
aagagtaataatactaatttcgcattcttaacaactattaagctttcagatccacttgag
gatactatagaatacggtaaaagtatagctagactaatgactagactaggtggcggtaaa
ccaatattacagagacttatagattttcaaaaaggaagaaggagcacatgggagagaata
aatagatccactgtaaaacccactctaagagatgtgacaccgggagacataagcatggga
cttccttatagggtagtagataatctaatagatggtttagaaaggttagatagcatagca
ccaggtatattctcttctaatacgctgttatatgcaccagaaataaaatattatagcgtt
agggctgttgtggataataacatggaaactgtggttgataatctatttgcagccggtgat
ggaactggactttctagggggataaatgtcgctgcggcaactggaatactagctgctaga
ggtatcgctataaaactagggttagat
>SSO0245 (nirD) Heme biosynthesis nirD related protein
atgaatttagtcgaaatttcagatattgataaggaaatattaatgaaactagagtacgaa
tttccctttgatcctcaaccttttaatattattagcgacggtttaaaaatatctgaggag
gaattattaaatagagttaaaaaattattggaagatggtataatcaaaagaataggtatg
tatgttagttttagagcaaaaggaatggatggggcgttaattgcagcacgtatacctcaa
gataaaatagaaaagtttagaaagattgcactaggaatcagagaattaactcacaattat
gttagagatcatccaaagtttaacatatggtttgttttaaaggcaaatgatagagataca
ttaaacgagaatgttaaagaattacttagtcatgtagagagtaatgattatgttatatta
tattctaaaaaaacattgaaattaagcgtaaaatacgatgttataagaggtgtatcatgg
agtcctaataataccataaggagtcttagtaaagttcctactgctgaagaattagggata
aacaaacaactactaaccgagttatcttatccactaaaaatctcacaaagaccatttaaa
gaaatagcggaaaaatacaaaatgaaagaagatgaattggtcgaattaattaaggaatta
tatgataaaaatgtaattaaagattatggagcaacgcttaatggagagaaaataggaata
gttgaaaacggcatggttctactagatactagtaatgtagaacaagcttgtgaaaaacta
gctttaaacattccagaagctacgcacgtagtacttagagaatctaatgatgaaaactgg
aaatatttatgctatagtatgatacatgcgagcaagaaagagactataagaaacgtagca
aaagagatttcaaaagaaacaaattcaagaagttacatgatactatttagcctagagaat
ctaaaacccgggatcgttatt
>SSO0246 (pheA) Probable chorismate mutase (CM)/prephenate dehydratase (PDT) (EC: 5.4.99.5 / 4.2.1.51)
gtggtagatgcggatggaatttattatttaggtccagagggaagttttacacacgaagca
gctagtttgtttaaaggaaaagatcttaaggcagaatcaacgatatctttagtatttaag
agagtttatgaaagagaaagttcaataggcatagttcccatagaaaatagcctcgaagga
ccagtaaatgaaacgcttgataatctctacaattatgataatatatatgttataggcgag
attgagaaaaagatagaactagttctagcagcaagaagtgataatttgagtcagattaag
agaatatactcgcatcctcacgcatttaacgaagctagagaaaagttaaaggaattaggc
tttaatgaatatatacctgtagaaagcacttcaaaagcagcaaagattgtgtctcaagat
tcagaggcagcagctatttgttctaattttgcagccaaactttataatttgaaagttctc
attactattagctcacataataactatactagattcatagttctatctaaggaaatgaac
tctaatggaaataagtccatgatattatttactgttcctcataaacctggtgctctttat
aaagttcttcaagtattttatgagtacaacataaatatttcgatgatctattctagacca
ctgaaatctataccttggcaatattatttttatttagagtatgaaggcggtatctcaaat
cgtgagtttattgaaaagctagttaaatccacatctgtattaaaaataaaaggatctttc
tctaagctaaataacgatcccgggttt
>SSO0248 (tdcB) Threonine dehydratase catabolic (threonine deaminase) (EC: 4.2.1.16)
atgaattacttagaatattttgatagaattagactagcaaaagagaaaatagaaaaatat
gtgcatattactccaatagattattctacaacgttttccagaattataaacgcaaaagtt
tatcttaagttggaaaatctacagaaaactggatcattcaaagttagaggtgcctttaat
aagttattatctttaaaggaggaagaaaaaaagaatggcgttattgcagtttcagcaggt
aatcatgctcaaggagttgcttatgcagcctccacgttaaatatcaaatcgactatagtg
atgccagaaacagctccagcttccaagtatttagctacaaaatcctatggggcagaagta
gttctttatggtaagtacttgcatgagagtatgaagaaagcggaagaattgattcaaaat
actggtttaatatttgttcatccttatagtgatttagatgtgataacgggtcaaggtacc
ataggattagaattgtatgatatcgaaccagattacgtaattattccaatagggggtgga
ggattgatttctggtataagtatagctttaaagtatagattcccaaacgtcaagataata
ggcgttcagtcttcttcttctccttcaatgaaggtttctaaggatcttgggaggcttgta
gaaatagagcctagttattccatagctgatggcatattggttaagtctccttctgaatta
acctttagtataattaatgagttagtagatgatatagtattagtggatgatgaagaaata
gctgaggcaatagttttactacttgaaagaagtaaaacgctagcagaaggagcaggagct
gcagcattagcgtcactaatttcagggaaggttaaagtaaatggaatagacaaaaaagta
atttcattagtaagtgggggaaatattgacttatcattattgtctactctaacagagaag
tttttatatagacaaaaaagggtagtcaaagtgagggtaatagttccagataagccagga
cagttaaataaagtattaagctatgtagttaagatcagaggtaatataatagatattgtt
catgataggcacagtagtgatgtattgcctggatacactaaaatatatataactttcgag
cttcagtcttcagaggctattaccttacttctgacaaatctggcaaacgagggaatagac
gtgaaaattgtagaa
>SSO0249 (hit) HIT-like protein, hypothetical
atggatattttatgggcaccatggagagctaaatatatttctgaaactagcaaggtaaaa
caagatgaatgcttattttgtagagtaataaaagaagaaaatgacgaacaaaattacata
gtatatagaggaaaacacgcttttataatactcaacgcttttccctataataccgctcat
gtgatggttgttccttacagacacgtcccttcagttgagcttttaagtaatgatgaggca
ttagacatatttactttatctactattgcaataagagctataagagatatttatgctcca
gacggttttaatataggcgtaaacataggtagagtggcaggagcaggtatagaatctcat
attcacgttcatatcgtgccgagatggaatggtgattccaattttatgccggtcattttt
aacactaaggtcatgccagaaacactcagcgatacgtttaaaaaattaaatacaaaagtt
aatgagattatgaagaagccctcgagatctgag
>SSO0250 (radA) DNA repair protein radA
atgtcaaatgaagttgaacagaaaaagaatataaaaaccattaacgatttgcctgggatt
agtcagactgtaattaataagctaatcgaagcgggttactcttccttagaaaccttagcc
gttgcatctccacaagatctaagtgtagcagctggcattccattatctacagcacaaaag
ataattaaagaagcgagagacgcattagatataagatttaagacggccctggaagtcaaa
aaggagagaatgaacgttaagaagatatctactggtagtcaagcattagatggtctttta
gctggaggtatagaaactagaactatgacggaattcttcggtgagtttgggtctggtaaa
acacagctatgtcatcagttaagtgttaatgtacaactaccaccagagaaaggtggctta
tctggtaaggcagtttacattgatacagaaggtactttcagatgggaaagaattgaaaat
atggctaaggctctaggattggatatcgataatgttatgaataacatatattatataaga
gcgataaatacggatcatcagatagctattgttgatgacttacaagagttagttagtaaa
gacccttcaattaaattaattgttgtggattctgtaacttctcattttagggcagagtat
cctggaagagaaaatctggccgtaaggcaacaaaagctaaacaagcacttacaccaatta
actagacttgcagaggtttacgatattgcagtgattataactaatcaagtaatggctagg
ccagatatgttttatggagaccctactgtggcagttggtggtcatactctttatcatgta
ccgggtataagaattcaacttaagaagagtagaggaaatagaagaatagctagagttgtc
gatgctccacatttgccagaaggagaagtagtgtttgcattaactgaagaaggaataagg
gatgcggaagag
>SSO0251 Hypothetical protein
atgccttttaaagaaggaataaggatgagttttagtgaggctaggatagacgaagttaga
tctaaacttgaggttattttctcaagatataattgtatgaataaattgagtgaatttata
tgtaacaagtcgttctatgaacttaaaggcaaatataatcagctatttatgcttactaat
aatgtagataaggatcgtctactagagttcctaagtggtctattaagcaaagggcttcat
ccctactctatcggtataccaataattatttacgatatgtctgagatcttgcctacttta
gcttttggaagatatttagccgagatatgtgagaataaactagttatattcaattacaat
ttaatctataagattatatataaaaaacctatatatatcaattatgcatataattataaa
gatgtgataattgtagataaaatgaataattttatagcttatgcaaaggttaaaagtaag
aagagaggagtgcatgaggtaataccagttaaagatataggatggtatttaaggcgcgga
gga
>SSO0252 Proliferating-cell nucleolar antigen p120 homolog
atggaaaatcgcatagcgaagtatttaagtgcacattacaatttgtttcaaatttctcct
agctataaggctaaaaggttagcatctaagtacagatttttagattatatgattgagcga
tatttgaatatgtttagtactgaagaagaattagaagaatatttaaattcttgtagcttt
ccattaaaaaagagcattagatgtaatacactgaaaactgattgcaaaaaattagaagag
ataatgttagagaaaggatttgttttggaaaaagttaagtggttgcagcatggctatgta
gttaaaagaactccacctaagccatctttaggttctacactcgagtatctaatgggatat
tatcatatccaaggtctagcctctatggtacctgcatacgttctaaatccttcatatgat
gattttgttttggatatggctgcagcaccaggcggaaaaactacacaattatctcaaatt
atgcagaataaaggtttggtgatagcagttgagaagaagcgtagtaggataagagctctt
ctcagtaacgttaataggctaggtgctgaaaacgtggtgctaattaaaactgatgcctta
aatttaataaatataaacaaatctcaatttgataaaatattattagatgcgccttgtagt
ggtgaaggattaatacagaaggaccctactagacgatataaaaccacaatggacgactta
agggattttgcgcacttgcagttatctctaattgagatcgcatatgaactcttgaaaaag
ggaggttatattgtttattccacatgtagtgtagcaccagaagaggacgaattaattgtt
aatttcgctatcgaagaattaggtatgaaggcaatgagtgtagaaggatatcctgcctct
aacggatatatagagtattatactactagatttagtaacgatgtgaagaattgtttaaga
tttttcccacataagcaaggcacggaggggtttttcttatgccttttaaagaaggaa
>SSO0253 (cyaB) Adenylate cyclase, cyaB-type, putative (EC: 4.6.1.1)
atgatcgaaaaagaggttaaaatagtagttgagtatccatcattagaggagttaagagaa
tcattaggaaaggatatgaaattattagatgtagaaaaacaagaagatgtctattttaat
tatgtttaccgaaatttcaaaataaccgatgaagcagttagaataaggattaacaacaag
ggaatagagcttacatataaagggcctaaattgcattcctcattaaaggctagagaagaa
atatctataactgtaaatgaccttaataaaacaattgaacttctgaggaaaatagggttt
tatcccgttataactatcaaaaagactagaataaattacttagataaatcatttattgtg
tcattagatttagtcaaggacttaggtcaatttatagaaatagaggctattaatgaaatt
agcgatcaagagatccagaactatacttccaactttattagaaaatataagataaaagga
aagttaacgacaaaatcttatctggagctattaattgataaatatgaggcgagttccaaa
tcaaatagcaatacttac
>SSO0254 Conserved hypothetical protein
ttgataaatatgaggcgagttccaaatcaaatagcaatacttactgactttgggcttaac
gataactataacggggtaatggaggcagtaataaagaaaataaacccagaggccaaaatc
acatacataagtggaaatagcaaaccttttaatctaattgcaggtgcgtatttattatat
acctcttataaatattttcctaggaatacgatatttcttgtagttatagatccaggagta
ggtactagtagaagacccttaataataaaaacaaaaaactacgtatttataggaccagat
aatggtgtattatatccagccataacttctgaggaaatagtaaaaataatagagataaaa
aacgaaaagttatatttagctaaaacgatttcaaataccttccacggtagagatatcttc
tccgtagctgctgcttttatctcgattggagtagaaattgatacattcggaaaccaagta
agatacgaagatcttacaaaattaaattttacctataaaccatcaaaaagtgaaatttgt
ggaaaggtactttacatagatcatttcggaaatgtagcaactagcatacccaaagaagtt
ttgttaaacaacttcaaatatgacgaaaacatagagataaaagtaaataactccaaacat
aagtgcagattcgtgaaaaccttcggttatggaatggaaaacgagttgttgatctacttc
aacggttattttctggtcgagataggaattaataaagggagtgcaaaagataaattaaac
gttagagaaggtgatgagatctgtctagagggttatatccaggaagatttcagccattcc
atc
>SSO0255 Nicotinamide mononucleotide adenylyltransferase, putative (EC: 2.7.7.1)
atgataagaaattcccttaaggatgttggaatggatttatctagaatatatataatacca
atgccagatattttaatgaataatatttgggcacactacgtgagtacttatacccctaaa
tttgaagttgtattcgccagaaatccattagtagttagaatattcaaggaagcaggatat
aaagtagagattcctccagcttttaatagagaaaaatataactcaacttatattagacgt
cttataatcttgaatgacaattggagtgagctagtaccaaaaccagtatataaatatatc
ttagaaattaaaggggatcaaagattaagagagatagtaggtacagataag
>SSO0256 Conserved hypothetical protein
ttgctgatctctggagttgatgatggttactttccattatcgtataagggaggaaaaggc
aaaactgcactagttgtggttactttttacgattacgagattattgatttagattggggt
ttcataactgttgatggaaatgatgctactaatgtttttaaacagttaagaaaaggtgat
attgttattttagatggtgtgatatttgctggtttcaactatattgtaccttattccgat
aggatgattttcttttattctaagatgccgaaaatagatctgattaaaaagactcttatg
aagcacttccaatctgatacggaaagagtaagagagatactctatgttttaaataatctt
aaacagattcccacaaagaggggaaacgtttttctttactctacagttgaattaagtctt
gctaaatcaattatagagaaatatcaaatttattcgaaaataccggaggtgttgaagagt
gctcatataatcgcaagtagtttgggaaggtttttagctcactataagaaaaaaata
>SSO0257 (cdc6-1) Cell division control 6/orc1 protein homolog
atgagtgatataattgatgaggtcatttcttcattcaagacatcaagcatcttcataaat
agggaatatttgttgcctgattatatcccagacgagttaccacatagagaggatcagata
agaaagattgcaagtattttagctccattatatagggaagagaaacccaacaatattttc
atatacggtctgactgggacgggaaagacagccgtagtgaagtttgttttatctaaatta
cataagaaatttcttggtaaatttaaacatgtatatattaatactagacagatagatacg
ccatatagggtattggctgatctgttggaatcactagatgtaaaggttccatttaccggg
ttatcaatagccgaactgtatagacgattggtaaaagcagtgagagactacggttcacaa
gtcgtcatagttttagatgagattgatgctttcgttaaaaagtataatgatgatattcta
tacaaattaagtaggattaatagtgaggtgaacaagagtaagatatcttttataggaata
actaatgatgttaagtttgtagatctgttagatcctagagttaaaagtagtttaagtgaa
gaggagataattttccccccttataatgcggaagagttagaagatattttgacaaagaga
gcacaaatggcattcaagcctggagttttaccagataatgtaattaaattatgtgctgca
ctagctgcacgagagcatggtgacgcgcgtagagccttggatcttttaagagtttctggt
gaaatagctgaaagaatgaaagacactaaggttaaagaagagtatgtgtatatggctaag
gaagaaatagagagagatcgagtaagagatattatattaactcttccttttcactctaag
ttagttcttatggcagttgtttctatatcctccgaagaaaatgtagtttcaactactggt
gctgtatatgagacttatctgaacatttgtaagaagttaggtgtagaagctgttactcaa
agaagagttagtgatattataaatgaattagatatggtagggatactaacagccaaggtt
gttaaccggggtagatatggcaagactaaggagataggtttagctgttgataagaatata
attgttagatctttaatagaaagcgatagtaggtttgctgatctctggagt
>SSO0258 Conserved hypothetical protein
atgaaatatgtaatagggattgacgaccacgattcctacaagtttggatgcactacacat
ttttctgtaattctaacctcctatttatataaaaatcatagtactattttattagactta
ccttacctagttagattaaaccccaatataccttggaagacaagaggcaatgcgagcata
aaacttattgttgagtttaatggaacaaaaaaagaactagcagatataattttttcatat
tctattgaatacgttaaagatgtttcactagcactagagcatggaagaaaacctggaata
gcaattatggaatatgataaatatatcactttattcgacaaattatacgatttctatatt
aagggaatatcagatatcattcctattgactatgcgaaaaaattcgctgagaaaaacgat
atagaacttagaggagatagaggtattattggaagtattgctgggctaggaatgagtggg
gattacacatatgaattaattacttacaggaaaaaagaaaattggctcaaaaagagaatg
ataaataaagattcagtaaagagggttgatgaatcaacgtttccgttaacatttgcaaat
tacgattacataaatgacactccccttataactccacatggaactgatccaatcctatat
ggaattagaggagcctccatacaacatctaattaaggctatggaactaatagagtcaaat
gaggatattgatttctttgccatttttaagaccaatcaaagtactgatattcacttccaa
aaaatcggtaaccgtttctaccaggaaactaagaaagttgtacaagtaaaaaatgtaagg
atacttgaaggtggagatgtaatagttgaaactactgataatgacatattatttgtgtat
aaagaaactggggagttaaatagtgcagctaaattattaaaaaagggtgacgaaatagta
gcttatggagccgtaaaaccatccatagcttatggaaagatcatagagctggagaggttt
gaaatattaaaattatacgatttagagttagtcaatcccaaatgtcccagatgtggcgga
tctacaaactctctaggaaaaaataagggatatagatgtaaaaagtgtaaatatattata
aatacaactaataagagtacaaaaaatataatgagaaacttatcattaggaatgtaccaa
actagatcttacagacatcttactaagcctatattcttagaactagaaaacaataaacca
agtttttatgaggagagaaagttcctagagatgtatagatcaacattatataagcttgat
tatcatcta
>SSO0259 Conserved hypothetical protein
atgagaatactgaagaagaaaatgaaattgaaggggaaagtgaagaaatatctcatagac
aagttgaatgataatgagaagttacatttttctctcatagatccctttaaaattaattct
agtgatgaacttaaatatattactaagaacttatacaacgctggaactgacgcatttctc
attggaggtacattaggtgtttctaaagataaattagattttgttatatccttacttgat
gattatgaaataccaaagattatattccctagcaatataaacctattatctgagaaagcg
gacgcattgttatttatgtcactattaaactctgatgatatctattatataataggggcg
caaatagtcgctgctccgatcattaaaatgttacaaatggaggtaataccaactgcttat
gtaatagtgggacacggaggtactgcagcgcatataggtaaggccagagtaataccttat
gataattttgagttggcaactgcctatactttagctgcggaatatttaggaatgagtttc
gtttatctcgaggccggatctggagccccagaaccaataaggccggaaatgatatctttt
atcaaaaatgcttccagtattccgctaatagtagggggtggaataagaagcgtagaagtt
gctttaaaattagtcgaagctggagcagatataattgtaaccggaaatataattgaaagc
gacgttaataaggcaataaaaataataaggggaataaagaataaa
>SSO0260 Conserved hypothetical protein
atgggaggaaaaagacgaaagagaactaaaattatcagggtaaagccaaagttaccaaaa
acctttgagtgccctagatgtggaaaggtttcagttagtgtaaagataaaggataatatc
gcaacaattacatgcgggagttgtggactttatactgaagttgaagtccctcctgtattc
gatgaagcaaatgcttactcgaagttcatagacatgtatctggaaggaagattacaaata
aaagagaggactaatgagaatactgaagaagaaaatgaaattgaaggggaaagtgaagaa
atatctcatagacaagttgaa
>SSO0261 Conserved hypothetical protein
gtgtcttcaaatcaaactaataggcttctattgaaagctagaagagtagttaaagaggga
agatttgtaagtctaactctcaatgatgcgctgtttagaatatttatttacattggacgt
aataacgattacattcttaacctaaatttctgtagttgttccttctatatattcaatgta
gttctaagaggcaagtatgatttttgctatcacgttttaggtttaaaatatgcattagag
aaggatcaaataacaaagatagaattatatgcagatgatttcaaagaaatactgactgag
atatacgcttatggaaaatctttaaaactaagaagaatattgaacaaagtggagagt
>SSO0262 Integrase, probable( amino-end fragment)
atgataagggaatttcctaaaactactaatggtgatgtaatcataagggaaagaaaaggg
aagtattatgtctataaattggaaacgataaacggtgaggtaaaggaaacttatgttggt
cctttagctgacgtggttgaaacatacgaaaaattgaaagatagcagtgggggtgtgagg
gtatcccccacaacatgggcccgctgggatttgaacccaggacctccgccgtgtcagggc
gacgtcctaaccaggctagacgacgggcccttaatactaggttattgttttctcttt
>SSO0264 Conserved hypothetical protein
atgaaagaactatatttcggcctacataatctcactagtaatcaaagactcttagacttt
tccaaattagcctttaatgtaaaatacgtaaagtatctcgttcttacaaaggtaggcgga
acagcagcccaatctggagtccctgaagtaaacaaactagcatttaaatacaataagcct
attttggttctaccagaactaaaggatgctatagagttattaaaaccagaaattacactc
ctagtctcacagaatgctgaaaaacaaattgactttaatgatatgataaaacatgataag
atcttgatagtattttctgggctagaaggaggtggttttaacaaaattgagcaatctcta
ggcgaatatgtaagaatattagaagatactcaagatcttggagccgtgagtctagcatcc
ttctttttatgtaagtatttacaactagtagaaggtaaagtt
>SSO0265 DNA modification methylase, type II R/M system (EC: 2.1.1.73)
ttggagctaataaaaatcattgatctattttctggagctggaggattttcattaggtttt
aaaaaactaggaatagaacctaaattagcaatagacataaatcatgcagcaactagaaca
tattcattaaattttccaaatacaatagtaatagaagatgatataagagaaataagtgga
ggagaaatcttaaaaaacgtggggaatgatatagacgtagtaattggaggccctccatgt
gagggatatactgcagctaaccccttacgtatgcaagatcctttagacagactatattta
gatcaaagagggaatttaacactggaattcataaggattgtggacgaagtgaaaccgaaa
atttttgttatggaaaatgttccagcaattatagaaactcaatcattaagagatgctctg
atcaatgaatttaagaaagctggatatggcaatatattcttcaatatactacatgctgaa
gattatggtaatccatctaaacgaagtagagtgttcatctcaaacgttagaatatcacct
attaaaaatcaaaaaagaatcacagtttacgacgcgattcatgatttagataacaagctg
gatgttcctaataacgaagtaagtgagcctaatgagaaaaaacttctgaaaatttctaaa
attggatatggtaagtatttaacaatgtatagggcgagtaaaggaagaagtataccatta
tatatcagactttctccatttgatctagcacctacgattttgggcaattccagatttata
cacccattccatgatagattcttaactgtaagagaacaagctagactaatgagttatcct
gacgatcatgtatttttaggaagtaaagatgagcaatataatcaagtaggtgaatctgtt
ccagtagccttatctactgctatagctaaagagattttgggtatcttaaatgaaagaact
atatttcggcctaca
>SSO0266 (tfE) Transcription Factor E (TFE), TFIIE alpha subunit homolog
gtggttaacgcagaggatctgtttatcaatctagccaaaagtttgttaggggatgatgta
attgatgttctaagaatattattagataaaggaaccgaaatgactgatgaagaaatagcg
aatcagttgaatataaaagttaatgatgtaaggaagaaattaaatttactagaggagcaa
ggttttgtaagttataggaaaacaagagataaagatagtggttggttcatttactactgg
aaacctaacatagaccagattaatgaaatactgttaaataggaaaagattaatattagat
aaattaaagacaagattggaatatgagaaaaataatacgttctttatatgccctcaagat
aatagtagatattcatttgaagaagcgtttgaaaatgaatttaaatgcttgaaatgtgga
tcgcaactaacctattatgatacggataaaattaagtccttcttagagcaaaaaataaga
caaatagaggaggaaatagacaaggagacaaaacttggagctaataaaaatcat
>SSO0267 Conserved hypothetical protein
gtgactacacacgtaatcttagtagcaagagcttttggagctaagggtgtttatatagaa
ggcaaagatgaaaaaatggtgaaatccatcttaaaagttatagatagttggggtggttca
tcatattttttagtaaaggaaattgaaaatggaaagagtatagtaaatgaatggaaagaa
aaaggaggtacaataatacatttgactatgtatggtattaatattaacgatttccaagat
agatttgaaaaaataaaatatccactactaataattgtaggagcagaaaaagttgaaggt
tggtattaccacaatgcagattataacatagcaatagggaatcaaccacattctgaagtg
gctgcactggcaatctttttagacagaatttataaaggacgagagctatatatggaattt
gaagatgcaaaaataaagatattacctcagaaagccggtaagaaggtgataagaagtggt
>SSO0269 (hflX) GTP-binding protein
gtgaaaacagctgctctttttgtatctaaagagtttgaggaagaggcaatagcgttagtt
gagggggctaactataaggtaacgagtatttataaattaccaaaatcgcctaatgtgaaa
ttttatatacaatatgataagctacaacaaatcaagaacgatgaggaaatttccacgtta
attatattcgaacaacttaagcctaggcactttataaatataagaagagaactgaaagga
aaagaggtcttagacaaaatactgcttctcttagaaatatttgcactacatgcagggtca
aaagaggcaaaaatgcaaatagaactggccaggcttaagtatgaactaccgataataaaa
gaaacatatactaaatcaaaaataggcgagcaacaaggtcccttaggagcaggaacatat
ggagtagaatctacaataaaattttacaaaaggagaatcaataaactaatgaaggaacta
gaaagtataaagatttttaaagaaaaatccatagaatctaataagagaaataatattcct
tctatcggaatcgtaggatatactaactctggaaagacatcactatttaactcactaact
ggattaacacagaaagtggatacaaaattatttactacaatgtctcctaaaagatatgcg
atccccataaataatagaaagattatgctagtcgatactgtagggtttattagaggaatt
ccgccacaaatagtagacgctttctttgtcactctatcagaagcaaaatactcagatgcg
ttaattcttgtaatagattctacattctcagaaaatctcttaatcgagactttgcaatcc
tctttcgaaattttaagagaaataggggtttctggtaagcctatactagtaacccttaat
aaaattgacaaaatcaatggagatttatataaaaagcttgatctagtagagaaactgtcc
aaagaattatactccccaatattcgacgttatacctatatcagctttaaagagaacaaat
cttgaattattaagggataagatataccagctagcaactcagttgagt
>SSO0270 (MBP-like) Multiprotein Bridging Factor (MBP-like), putative
atgcaagctaatagtgaagaatactgtgaattatgtggatctcaaattcgtggtaaaggt
ataactgtgtcgtatgaaggctcaattattactgtatgtaattcgtgttacgatagaata
agaaaacatgcagtgatagtaaaggcagatagtaagaaaagcgaaacacgtaagaaagcc
actcttaaaccacccaaaatggaaaatgctgaattagaaattgtaacagattattacaag
attattaaaactgctagagaacaattgggtatctcacagcagcagctagcacaaaaatta
aaagtatcagaaaacattgttaaaagatttgaaagtggtaaattgaaacctacaatctct
caagctaggcaattagagaaaatccttggcattaaactagttaccccattagaaaataac
gaagaaagcgagaaagaatttgatgacactggattaactttaggggacgtggtaaatatt
aaagagggaaagaag
>SSO0271 AAA family ATPase
ttgtcaggggatttcgacacaataagggatgcttcttctccggatgaagttcaattagtt
agattattagaagaaaaaatcaagtcattgcaaattgaaattgaaaatctaagaaaagaa
ctaaattattataaagcagaaatggaaaaaatgttaagtcctccgctaatagaggcagtt
gtattggacgttttaccagacggtagagttctagttagaagttcgtcagggccaaatttg
gtagtaaatatagctagtcatattgatcaaaaattaataaagcctggaatatctgttgcc
ttaaatcaaagaggatctactatactggaggttttaccacagaaggaagatccaattgta
aagacaatggaaattattgaaagacctaacgtaacttattctgagatcggtggattagaa
gagcaaataagggagttaagggaggtcgtggaattacctttaaagaatcctgagatattt
agggagataggagtagagccaccaaagggagttttactatatggtccgcccggtacaggg
aagactatgttggcaaaggcagtagccactgagagtaatgctgtgtttattcatgttgtt
gcttcagagtttgcacaaaaatttgtgggggaaggcgctaggatagttagagagctattt
gagatggctaaaagaaaggcgccatcaataatcttcattgatgaaattgatgctataggt
gctaagaggatagatataggaactagtggagaaagagagatacaaaggacgctaatgcag
ctcttggccgaacttgatgggtttgatccattggataatgttaagatcatagcagctacc
aataggatagatatattagatcctgcgttattgaggcctggtagatttgataggataata
gaggttcctttacctgattttaaagggagaactgagatatttaatatatatttaaagaaa
atgaaaatcgaagacaatataaaccttgagctattatctcagcttacagaagggtttagt
ggtgcagatattaaaaacgtttgtgttgaagctgcatatatggcaattagggacggtagg
aataaggtaacgatgaacgatttagttgaggctataaacaagattaatgttaaaaggaat
aaaatggaaagcatgaaagagaggcgagagaagtatagc
>SSO0273 Hypothetical protein
atgagtaacgttaagatagtaataaagaaagatttaagtgaattaaaaggttctacattt
ataactggatttagaactataggggaggtaggatatttagcaataaggcatttagccttg
aaaagaaaaatggaaagaatagggtatgttgttactaagtattatagagatgtcacgttt
ttagatgattatggcattgcaacgcctttcgatatattctatgataaggacaaacattta
gtactattacttaatcatattttgccatttcaacgtgaatggaatgatttcgcttca
>SSO0274 (tgtA) Queuine/archaeosine-tRNA -ribosyltransferase
atgactgtatttgaagtaaaatatgaggacttagcagggagaataggaaccttaagaaca
agaagtggtaccttagaaactccagcattctttccagtaattaacgtattaaaaaaagat
gaaatatcgatagatgagataagaaatataggatttaaaaactttatcacaaattcttac
atattatacaaaaataactatataaaggatgatatccataaggagttacgctctgaagaa
atgatcataatgacagattcaggggcatatcaaattctagagtatggagaaataggaata
accaatctccagatcgtgaattatcagcttaaaataaaaccagatatcggagtaatatta
gatttacctaccgggaatataaatgattatgataacgctaaaaagacagtatatgagaca
ttaaaaagagcggaagaagcttcagaaatcatagtaaaaaatcaagataacaatatcatt
tgggtatatccaatacagggaggaagatatcttgatctagttaagacttctgctgaaggt
ctatctaaatttgaacatatatacaatatggccgctcttggtagcccaacagttctctta
gagaagtacatgtatgatactgtaattgacatgatttatactgctaaatctaacataaaa
agaggaatcccgtttcatctatttggaggagggttacctcatatcattccatttgcagta
gcgttaggagttgacagttttgactctgcttcatatataatatatgccagagacaataga
tatattactaggacacgcgtatacaaattagaggatttagaatattttccatgttcttgt
ccaatatgctctaaatacacacctaaggatttacttgaaatgaatgagaaagaaagaaca
aaagcattggctattcataacctttatactattttagaagaatttaaagcaactaaacag
gcgattaaggaaggaagattatttgaatatctccaagaaaaagcttactctcatccagca
gtatattctgcattcaaacgattgatgaaatataaggattatctagagaaatttgaccct
agaataaggggagatccaaaaggtttgtttttatttgacggtaactctttacataggcca
gaaattatacgtcactcgagatttctagaaagatacatacaaaagaaagataaaatatcc
atatattgctatgataaagcaataagtgatactgcttatgatttcaaggaaaaaataagg
gaaaaaatagctgatcgtaatgagagcgacgtatttatagcagtaccgttttttggttta
ataccgttagagatctcagattcttatcctctatctcaattcgagataccaaatgaaata
gatgaagatgtaatagacgatatgaaaactaaaatcatttcgttcttaagacgtaataat
taccaaaaagtagagttaattaactgtgaaaaactaggcttacatatagactctatcagc
acttcctct
>SSO0276 Hypothetical protein
atgagtagtggaagaagaatctcgagcgaattaaataacctaatagataagactgttatt
gtaaaaactactaatggtaaaacatatactggtcaactttatgcatatgaactttcacca
tttatcataagtttaacaaatgttaaggatgatagcaataacactttctataagttaatg
ataaatggaaattcaatttctgagataataattaagaatcctcctctatttgagccaaga
gaatttgcggaattagttgaaaaatccctaaatttaagaccagctgatataaaagtttac
gatgaaacaagtgtagtaacaattctagaaaaaattaaagtatcacagaatggagtagaa
ggaagcggacctatggcacaaagaatttacgacttatataatgattatataaataaaaag
aaaaaggaattaggtcta
>SSO0277 (rpoG) DNA-directed RNA polymerase, subunit G (EC: 2.7.7.6)
atgatggaatcagtggcacaagaaataattctaagttgtgaaataaatagtatagaaaga
ggtagtctaaagaatttatcaatggtaaacatgtcttgcaatggctttaatgtaagtttt
gatataattgatagcataaacatatttagtcaaaaagaaaaggtaaaggttataatttct
aaaaatagaccttcatattctcatgatgacttctgtggacacggctatatcgttactgaa
cttaaagattcttctttaaacaatggaaataaatatacaacgataatttcattatatggt
cttctagtaaagataataagtaataaagaaagcttccttagaacatctcagctaaatatc
atggatcatgtttacttttgcgtgaagaaaaacaat
>SSO0278 Proteasome subunit (EC: 3.4.99.46)
atggaagaattacctgcaactgctgttggtttgaaggtaaatgatggaatcgtattagct
tctgagagacgattaagctatggtggttacgtactaagtaaacaagcaaaaaaagtatat
aaaataaataaattcctcatggcaggggctggaatatatggcgatttgcagactttgaca
cgaataatgaatgtagaaataaagtactatgaggtttcaactggtaaaccaatctctgtt
catgctgcagctaaattactttcggtaatactataccagtataaagtgatgcctttcatt
tcagaaattctatttggaggagtcgatgaaaagggtccacaactttatgtgttagaccct
ataggctcgttaattgaagataattacgctgctgtaggatcaggagccaggatagcaata
ggagttcttgaatctgaatatgatcccaatatgagtttagatgtagcaacacaattaata
acaaaggcgataaaagcatcaatagaacgtgatatcacatctggagatgggatagattta
gctataatagataagaaagggaactacgaaaataaattcatcccatac
>SSO0279 (hisS) Histidyl-tRNA synthetase (EC: 6.1.1.21)
atggtaaagtttgaaacagtaagaggcatgaaagattatattggaatcgatgcagaaaaa
attagatacttggaatctacctttagagacttagcaaaaaaatatggatattctgaaatt
ataacgccagtagtagaagaatttaaactgtttgagttgaagggtggggaggaactaaga
caaacgatgtatgtgtttaaggacaaggcagatagagagatatcgttacgacctgaaata
acaccaagtgtagcaagagcatacatacaaaatttacagagttcgccaaagccgataagg
ctattttactttggtaccgtttataggtatgacgaaccccagtacggcagatatagagag
ttcagacaagccggaatagaaatgataggtgattcttccatcttagctgatgtagaagta
ttagatttattgtacaatttttatgataagcttaatctttctaaggatataacaattaaa
ataaataacattggtatatttagaaaaataatggataaatataatatcgaagataatcta
caagagcatgttctgcatttaatagataagaataaggttgacgaagctttagttattctt
gaaaaaaatataaagaataaggatataatggactttttaaatatgatccttactaaaaaa
gaggcaaaactagaagatatagaatccttagctgaattagaggaagtttcaaaattagat
attaaaaacgaatttgaatatctacttcgattatctagaattttaagcagcttaaatgta
aaatttaaggttgacctaggttttgtaagaggattagcttattatactggactaatattt
gaggttcttcatccctctgttcagtttagcattgctggaggaggaagatatgataaactt
atagagctctatggtggcttaccctcaccagcaataggattcgctataggagttgagaga
actttattagtaattaaagatctgaaagttgaagaaccaataaatgtgatagtagtaggc
atctcagaggaggcaataccagctatgtttacggtatccagaatgttaagaaaggaagaa
tataaggtagtaataaatactaaagatcagcctctctctaaactattaccttattatgct
tcccaaggatttaaactcgcaataataataggtaaacaagaacttgagaaaaatatgata
acagttagaaatttaattacacgaaaacagatttctatcccactagagaacgttctagat
gcaataaaacaaacgtta
>SSO0280 Hypothetical protein
atgcaatgccctgcatgtggttcgaatgaaataatttgggataataagaacggagaaata
gtgtgtagtaattgtggtacaattatcgacaatatttactataatgggcaaaatgaatca
gagagtacggagataatctcaataaataataagttttacaaggatgatatacaagttaaa
gaactgcgagttaaaaatttcttaaagaataatcgaatagaaactaaaaaaatagatcag
tatgaaattatcttaagatctatgttgctcgatagtcaatataagaaaatatacaagcta
ctgtatgatgagggtattttaagtggtttaaaagctaaaagtaaactgggtcttctaatc
tattttagattcgcgttaaataatggatatttacatctattagaaaaattcgacataaaa
aatgaaacccttaaaaaaatactcaaaagaattggtagaaaacgcttaacattacttttc
gataaacttaacgaagaaagcgatcgtatt
>SSO0281 Hypothetical protein
ttgcccattatagtaaatattgtcgataattgtaccacaattactacacactatttctcc
gttcttattatcccaaattatttcattcgaaccacatgcagggcattgcatatgaaaaca
ataacttttatggggaatatacttatttttgataatgtgactataatgtctgagaaaagt
gaaactactttagacaagatatacacagccttaaactcatctaaacagttacctagtgag
ataatttatcttgtaaattgggataaagttgatgtcttcgttgacttaaaacagcgagga
agggttacgattgatggtatagatgagcactctcttataataaaggacaaggaaaatgga
agatatactgctatggttttgatagtagacgaaaatgaaaaggtaagttttaagaaaata
ttagataaactacatcagtcaaaatcaatgaatttagaactttatctttcaattgtagat
aaatatggagatgtaacgtattatactctatctgagataaaaatgtcaaag
>SSO0282 (thsB) Thermosome beta subunit(thermophilic factor 55) (ring complex beta subunit)(chaperonin beta subunit)
gtgcgtaaaatggcaacagctacagttgcaactacacccgaaggtatacctgtaattatt
ttaaaagaaggatcaagtagaacatatggaaaagaggctttaagggctaatattgctgca
gtgaaggcaattgaagaggcgctgaaaagtacatatggtccacgcggaatggataagatg
cttgttgatagcttaggagatattacaataacaaatgatggagcaactattcttgataaa
atggatttacaacacccaacgggtaaacttttagttcagatagctaagggacaagacgag
gaaacagctgatggtactaaaactgctgtaattctagctggagaattagctaaaaaggca
gaagatctcttatataaggagattcatcccacaataattgttagtggatataagaaggca
gaagaaattgcgctaaagactatccaagagatagcacaaccagtcactataaatgacact
gatgtacttaggaaagtggcactcacatcattaggcagcaaagcggtagcaggtgcccga
gagtatttagctgaccttgtagttaaagcagtagcgcaagtagctgaattaaggggtgat
aagtggtacgttgatctagataatgtacaaatagttaagaaacatggtggtagtgttaat
gatactcaattagtatatggtatagtagtagataaggaagttgtacatcctggtatgcca
aagaggatcgaaaacgctaagatagcacttttagacgcttcattagaagttgagaaacca
gaattagatgcggagataaggattaacgatccaacacaaatgcacaaattcttagaagaa
gaagaaaatatactgaaagaaaaggtagataagattgcagctactggtgctaacgttgta
atatgtcagaaaggtattgatgaagttgcacaacactatctagctaagaaaggtatacta
gcagttagaagagctaagaagagcgatttagaaaaattagccagagctactggaggaaga
gttatatcaaatattgacgaattgacttcgcaagacctaggctacgctgcattagtagag
gagagaaaagtaggagaggataagatggttttcgtagaaggtgcaaagaatccaaaatcc
gttagcatactaataagaggcggattggaaagagtagttgatgaaacggaaagagctctg
agggatgctttaggtactgtagctgatgtaataagagatggtagagctgtagctggtggt
ggagctgtagagatagagatagctaagagattgaggaagtatgctcctcaagttggtggt
aaagagcaattagctattgaagcctatgctaacgcaattgagggtcttataatgatatta
gctgaaaatgcaggattagaccctatagacaaattgatgcaattaagaagtcttcatgag
aatgagactaataaatggtacggacttaatttattcactggaaatccagaagatatgtgg
aaattgggcgttattgaaccagcattagttaaaatgaatgcagttaaagctgcaacagaa
gcggtgacattagtgctaagaatagatgatattgtagcagctgggaagaagagtggaagc
gagcccagcggtaagaaagaaaaagataaagaagaaaaatcttctgaagac
>SSO0283 Conserved hypothetical protein
ttgaagatgaataaaaatctttggattcctatactactcataattctgggaattggtttt
ctgtttcataatttaattaatattaacttaatgtttttcgtatttccaattataatgata
gtggttatctcgtttattttcagaaattctcttaaagtaaaaataaataaattcattctt
aaaaatggaatcttccagataatgtatgataatacttgcatttgtggagttgctatgaaa
ataacgggtaaaatcgaaccgacttcaaataagaacgatatagaaaaagaacttaaagac
ttcataaatgcaatagctagaaaagactcagaattcaagtttataatatttactatagta
gaaaaaaataaactaggttcatctataataatttatagaatactccaacattccaccgat
atagagttggacagtttcatggaagaagttaacaatttattagtgttagcaaaagctata
gctccacatctagagtttaaaattattcaaccatcaaaaaatgttcttccaattccaatg
gcttttgggaactacccttttctaacagtgtccgagataacttacaccaatcctattaat
tctaatattgtgtcagaggattttgatgtagagataggagaagccacaaacggaacagta
acatcaagggtaggaataagagtaaaagacattacgagacatataggaatctttggaagt
actggatctggaaagacgaatactgcaatacttttagcctcccaattgaacgctaaaggt
gttaaggtaattatattggattggcatggggaatatgatcaactcctcaaaaacggcttt
agaatttatgatgagaaaactatagtaaaaataaatccattacacttaatagatttagac
gtggaagatacagttgacattattggagatgttttacaactaacagatccacaacgattt
ttactttataccattttattaaaactaaaaagttatagaaaattctcaattaatcagtta
ttagaagttattaatagtatcgaagatacgtcgtactggatgcgggacgtgaaatatgct
ttgcttagaaaaatatttatcttatttactccaactgcatctaaattattttctactgta
gatgaaacttcacttaatgactttccagattatttaacgagttctacaatcataaactta
ggatttatttcaaatcttaaactcagaaaattatactcattatttctaataaaacttata
gtggaaagttatataagatataagataaaccaacagacccttatcattctagatgaagca
caaaattacttcaatagggagggaaatgaatttatagatagattagcctccgagataaga
aaatataatataggtttatgctttattactcagtcaccatcattactttcgcagaatgta
ctgaaaaatacaaatataaaaattattcattcaataaaatctgatgtcgataagaaagct
attagagatacgttgtcactcgatgaaagacttacacaaagtttagataaactagacgta
ggagaagcaataataagtgcaccaaatttaaaaatacctataataattaaaattaaaaaa
atatct
>SSO0284 Hypothetical protein
atggatattgctaacattaacaacttaattaaacacgatgatgagtacgttagtcaagtc
ctacctctattgccttctgaaggagtactaagacaggcttgttttctatatttcaactat
gatacgtccagaaataagataagaagcccgataatgtttttcttacttctcttattacct
tttgaacaaataaaggatgcattagactatattagaggcgaaattaacagcgttaatgaa
ctgtatttaatagaatgtataaagaatactagtgctcaagaaaacttcttaccatatcaa
attatgggaaataaagaaagattaattttaactaagaacgctttagttttaatcgactcg
ctg
>SSO0286 Conserved hypothetical protein
atgaaaactacacttagtgtaatcaaggccgatataggaagcctagctggacatcatgtt
gttcaccctgatactatagctgcagctaacaaaatattggccgaagctaaaaggaataac
ataatttccgattactacataacctatgttggtgatgatttacaattaataatgacacat
aacagaggagaactggatactagagttcatgaaacagcttggaacgcatttaaagaagct
gcaaaaatagctaaggatctaggattatatgctgcaggacaagatttactttcggattct
ttttctggtaatcttagaggtatgggccctggaatcgctgaaatagaatttgaagaaaga
cccgctgaaccagtagttattttcatggctgataaaactgagcctggtgcatataatctt
ccattatataagatatttgcagatccatttaatactgccggactggtaatagatccaact
atgcatgaagggtataaatttgaagttttagatgtatatgaaggagagtcaataatgctg
aacacaccagaggagagttatgatttgcttgcgctaataggaacacctagtagatatata
gtgcgaagagtttataggaaagccgataatttgcaagcatcagttgtctccgtagaaaga
ttgaatctaatagctggaaaatacgtaggtaaagacgatccagttatggtagtaagggct
caacacggtctgcctgcgctaggagaaattttagaagcgtttacagtaccttatttagta
ccagggtggatgagaggcagtcactatggacctcttatgccagtatctcaaaaggatgcg
agggctacaagattcgatggcccacctaggctaataagtttaggatttaacattaaaaat
ggaaaactggtaggtccaactgatttattcgatgatcctgcatttgatgaagttagaaga
acggctgtaataattgcagattacattaggaaacatggcccgtttatgccccatagatta
gagccacaagaaatggagtatactactctaccattagtgatagagaagttaaagaataga
tttaagaaagagacagatatgtataaaactaaaccaagcgtatattcacacgaaagttca
catgaa
>SSO0287 RNase L inhibitor
gtgagagttgctgtaataaattatgacttttgtaagccagataaatgtaacttagagtgt
ataaatttctgtcctgttgataggtctggaggaaaagccatagaactgtcggaaattgtt
aagggaaaaccagtaatttatgaagaaacttgtataggttgtggaatatgtgtaaagaaa
tgtccatatgaagctatatcaattgttaatcttccagacgagttagaaggagaggttata
catagatacaaagtaaatgggttcaaattattcggcttacctacacctaaaaataatacg
atattaggagtattagggaagaatggagtagggaaaaccacagtacttaaaatactagct
ggtgaaataatcccaaattttggagatccaaattccaaagtaggtaaagacgaagtgtta
aaaaggtttagaggaaaagaaatttataattattttaaagaattatatagtaatgaacta
aaaatagtacataagattcaatacgttgagtacgcttcaaaattccttaaaggtacggtg
aatgaaattttgacaaagatagatgaaagagggaaaaaggatgaagttaaagaacttcta
aacatgactaatctttggaataaggatgctaatatactttctggaggaggacttcagcga
ttattagtagctgcttcactattgagagaagcagatgtatacatatttgacgaaccttct
tcttatctagatgttagggaaagaatgaatatggctaaggcaattagagaattgttaaag
aataaatatgttatagttgtggatcatgacttaatagttttggattatcttacagattta
atacatataatctatggagaaagttcagtatatggaagggtttcaaaatcttatgcagct
agagtagggataaataattttcttaaaggatatttaccagctgaaaatatgaaaataaga
ccagacgaaataaagtttatgctaaaagaggttagtgacctagacctttccaaagatcta
aaaacaaaaatgaaatggactaagataatcaagaagttaggtgattttcagttagtagta
gataatggagaggctaaagagggagaaataatcggaattttaggaccaaacggaattgga
aagacaactttcgcaagaatattagttggcgaaattacagcagatgaaggatctgtaacc
ccagaaaaacaaatattatcttataaaccacaacgaatctttcctaactatgatggaact
gttcaacaatacttagaaaatgcgagtaaagacgctctttctacctcatcctggttcttc
gaagaggtaactaaaaggcttaacttgcacagactgctggaatctaatgtgaatgatcta
agtggaggcgaattacagaaattatatatagcagctactttggcaaaagaagctgatctt
tacgttttggatgaaccttcctcttatctcgatgtcgaagagagatatatagtcgctaaa
gctataaagagagttacgagggagaggaaagcggtaacttttatcatagatcacgatctt
tcaatacatgattatatagcggatagaattatcgttttcaaaggagaaccagaaaaagct
ggattagcaacatctccggtaacgttaaagacgggaatgaatgagtttttgagagaattg
gaggtaacgttcaggagagatgcagagaccggaagacctagagtaaataagattgggagt
tacttagatagagtccagaaagaaagaggagattattactccatggttctttctacccag
>SSO0288 Integrase, probable (fragment)
ttggcaaccataatacagtgggtgaaaataaaggaaaaacaacatcattataaatatggc
gacataattatacgtgaaagaaaagggcggtattatgtttacaaactagagtatgagaac
ggtaacgtaaaggaaacttacgtcgaccctttagttgacgtagttgaaacgtacgaaaaa
ttgaaagatagcagtgggggttttagggggtatccccctaaccccacaacggacccgccg
ggatttgaacccgggacctctggctccggaggccggcgctccatcctggctgagctacgg
gtccaacataaatatacactatacggtcttttaaactgt
>SSO0290 Inorganic phosphate permease related protein
atgggttataataaaccggacttttcctcactagaattcaagagcgtcttaacagccggt
atgggagtatttactgatggatatgaactttatgcgatttcattagttttctattatata
caaaaggaatttctattaaatggactagaggaagggatagttatagctagtgcatattat
ggtgcagcagtttccgcaattctattaggctttttatcagataaactaggaagaaagttt
atttacggtctcgatgtagctttaatgagtttaggaatactatttcagtcaatatcaaca
aattttgcagagttagtcatgtctagaataatcttaggttttgggattggcgcagattat
gttctttctcctataattactgcagagaattcaaatcccaaaaatagaggaaaacgaatg
atagtaacttttgcactactttggggaatgggtgcagttactgcagcatttgttgagcaa
atcttgctgttagtgaacatggagaatgatctcatatggagaatagtattgtttatggga
attctcccagcaatttctgtattttacttaaggagaaaaattcctgaaacatataaattc
ttaactagaattaaaccgaaaccagaagagctaaaaaaactagaaaaagaaataaaaagt
aaagttgcaatttctccagatgaagtcccgttctcaaaaagattcgtatcagctatagga
attacaattatatcttctattctctggcttctttacgatatgtattcctctacatttgca
atctatggaccaataacaatagcgggaaatttaggtctaaatcccatagaattcacctat
ttggcacagtttcttgcaggtttgccaggtcagataattagcatttatctagttgacaaa
ataggaagaaaaccattaatcgtaataggttatgctggtgttgcattttggctttttatg
tactcgatactcctcatggatccgtattactttggacttaagatacatataagtaatcct
ttaaaagcggcagaaagtttaaccggagaggcagcattattaggactatcattttatctt
atgaactatttgtcatcagcaattggacccgcgtccataataggatcagcgatgttaacc
ccagagttagttccaaccaaagttagagggaccagccaagctattagtgtggcagtagat
agacttgctgcagcttttagtattactgcgtttcctttgttattagctaagtttggactc
ccagtactactaggaatatattcgataatagctttagtatcgtgtagtataactctattt
ttaataccagaaactaagggagtagaattaagt
>SSO0291 (rpoM-1) DNA-directed RNA polymerase, subunit M (EC: 2.7.7.6)
gtgatagtagtgaagttctgtcccaaatgtaactctatgatggttccaaagaaatccaat
ggcaagaacgtatatagatgtaccaaatgtggttatgaaaaagaggtcccagaaacaacg
atagtagtaacgagtaaagtaaaacatagtattaaagaaaaaacgttagtattagaagag
gaggaaatgcccagtggtgcacaaaaaataaaaggtgttctatgtccttcatgcaaaaat
gatgaagcctatttctggatattacaaactagaagggcggatgagccacctactagattt
tataagtgcacgaaatgcggtaaagtatggagagagtacgag
>SSO0292 Conserved hypothetical protein
gtgagaactcaaggcgaattaactttaccaggagaggagttagcagtaattgaagaattt
atgactggcgatggtacgtatgaacaaaatggtatagttagagccgcagttgtaggaaag
atcttttatgatatgctaaataggaagagtaacgtactaggatttaagaaaattatattt
caacatttgaagaaggctaaatatgtgattggcattgttaattctatcaaagaagactca
gcactagtttcaatagtagggatcgaggagagaggtcttgcgtcaccaatttcagcttac
ttacatatttctcaaataagtaataaaaaaattaataatgtaacagatgctataaaaatc
ggagatgtaattaaagctaaattactttcatacacttttcccttggctttgaccattaaa
atgaaagatcttggtgttatttacgctagatgctcaagatgtggatatttattgattaag
caagacgaaaataatttaaaatgtcagagatgcggaaatattgaacaacgaaaaatagga
tcttatatggtgaagaaaggtggaaat
>SSO0293 Conserved hypothetical protein
ttgagctataatttcgaagaggaacgtgtaatcaaggagatacgtgaaaagaacgcgaaa
cgtgttcttttacaatttcctgaaggattaaagtatttttctatagatatagtaaagaag
ttaagggaaaaactacctaacgttaattttataatatcaggtgagcctagttggggtgct
tgcgacatagcagaggatgaggcacaacaagtaaatgctgaccttataattcacttcggt
cataccccttatacgtggtactatcccaagtttcctaccatatttattaacgctgaaagt
aatttagatatttctgaaaatgctcttcattctttagaaaatgatatcagtaaatataat
ggaagaaaaatctcattaacggcaactttacaacatgtaagattattatctaaaattaag
tctttcttagaagataagggatacgatatagttataggtaaaccatctaatagatttatg
tttgatggacaagttttaggatgtgattataaagctgctgaagtagaagcagatatttat
gtgattgtatcaggaggattatttcacgctttaggtttaggattagctacaaacaaacca
actataaaacttgatccgtatttacagaaaagtgaggatataacaaatgatgttaggaag
atactgaaagttagatatggtaaaatattacaagcattagataaacgtagttgggtaatt
atacaaggggttaaggttggacaaaatagaccaaacatgataaaatatttctatgataag
ttaaccgaaaaaggctatgatgtatttacagtaacaaataaggtattaacactagacata
cttagaaatttagatagaaattatatagacgtatttttagtcacatcttgtcctagactg
ccaatagatgacctatacaactatgaaaaaccagtattaacgcctggagaggcaaaaatg
atcataaataatagtctggaaccctatatttttccatgg
>SSO0294 (rpl10E) LSU ribosomal protein L10E
atgccactacgacctggaagatgttatagacatttctccggtcctgcctataccaggaag
gaatatatccctggtattccacagccaaagataactaagttcacttctggaaatccaaat
ggagattatgactatgaggttaggttaattactactgagatagggcaaataagacataat
gctttagaggctgtcagaactcttactcttaagacgttatctaagaaaactggaagtgaa
acttcgttctttatgtggatattaaagtatccccatcatgtgctaagagagaataaaatg
atggcgtttgctggagctgatagattgcaagatggaatgagattgtcttttggtacacca
ataggtactgctgctaggattgaaaaactgggagaaactttaattgtaataaaagttaaa
aaagaacatctagaatttgcaaaggaggcgttaaagatagcatcaaagaaactacctttg
cgtactagaattgagatcattccattaaggctcgtaagacaggaggttcaaagt
>SSO0295 Hypothetical protein
atggtcaaaagaaattctaaagagatagtaatggaagtattcttaggagagccgaataat
caagaaataagggaagtagttaggaatgtgtattctaaggataatttgtgtttatctgcg
tactattctatagagcctatcctattttcatttattatttccaaaaatactaagaattct
ttcactctttcgttcattccagaagaatgtgaaacacaaattagacttgacgctaacggg
aaatggataatagataataagaaaaaatatttcttgggtcagaattccttttgttcatat
ttacctataactgctgaagatgtcttgccaattgttagttgtattataacgtctacaata
ttagacagaagatcactttccgaatgggaattagagacaataagggaaatggagaaattt
gatatgactatcgaaaaaaatctgaaaattcctgcatataaaactttaccagccttttta
tcgttaatgttttctctagatccttatatacctggcatatctggcaatagagaaaatgcc
ataagtctcataagagaggtaaacgctagtgagatatcgaaattagaagatttgaatgag
agtcagctaaatacattacttttcagaataatttctactattgtgaaagaaaatccaaaa
ttcactagggatgatataattacggatagatttttttatcttgattatgatatattagag
ttggcattctctttaatttattcgtttgatactattggcagtaatgagatcttacagttt
gtcctgtcatcctcttatgcagaggcattaattagtagatttaggcaaactctctccaag
ggattctcaatcaattctattgaaaataaacagtcatattatattgttgagacatctaat
ctcacttctcctctcttagcacaaataatattgttacagttacaaaaaataaggagagat
aaaatgatagtaatcagagacaatgatagacttttcactagtagattttttattccgtca
gtaaagaaagaaggattgattaaaattgatgatagagttaagaatctcatcggaata
>SSO0296 Hypothetical protein
atggataagaaatacattgcagctatttttcttccgtttatagtgatcatagtctatgca
tacatatttaagattaatataatatatgttttacaagaagatcccaaattctttctgatt
tttcttttaacgtatactgcccagaatttcgtctcatcatttaaggattcattactaatt
aagcgtagagtagatataacgttaagagcaagattactaggtaacttcgtaggtttatta
gtacctggatgggctggacaagaattggttagaagtttagtttacaacaaatatggggta
aacttaaggcaagcgtttagctactctattcttataggatccatagatgtgctcgcaata
tgtttgggctatattttactgctgccattcttttttaacccattagaatttgtattcatt
ctagtcgtattatttaacatagctggatggataggagcattgtcgtatttttacttgcaa
catgataaagtaaataaaattgaacaatttatctttaagatagttaaaatggaacgaatt
gttacagattatatggaatttaaatattaccttaagcaaggaaccacaaaggattttgta
atttatatcatgattgatatatttagttttgccttatatggaggttatttttattatgta
acacataatattttcttgtcaatttttatctcttttttataccaagtatctatattaata
ccgataccatctgcagcaatagtgggagaattagcgttatcaatatttttaaatccctct
tacgtctttgctacaagattgaactatattatatcaaacttgcttggatctattttcttt
aaggatatgagctttgaagagcttaaaaaatggtcaaaagaaattctaaagaga
>SSO0297 (tkt-1) Transketolase, N-terminal section (EC: 2.2.1.1)
gtggggattgatattgttccaatggaaaaaggtggagggagtgatggaactccaatatca
atagaggaattggacaagttaagacaagtagctgaaaaggcaagaagaaatgtaataaaa
atgctattttatgatcaaacaatacatgtgggatcgtccctaagtagcatagagatatta
actacgttaatattcaagcatataaggacggattcaagcttagtgaataaagactggctt
attttaagtaaaggccatgcagcgccagctctttatgccgttttagctgaaaaaggttac
ataaaagaagaggaactttggagaatacaagatataacgggattattacaagggcatcca
gaaacttttattcccggtgtagatatgtcgactggtagtttagggcaaggtttgagcttt
ggaataggtgttgctactggtataaagatggccaacggcactggaagagtatatgtcata
atgggtgatggtgaacaggatgagggagaaatatgggaggctatgacgcatgcagtagtt
agaaatcttgataacttaattgcatttatagagatgaacaatttccagcttgatggttca
acagatgagataaaaccaaagaacttcttacctaaggtatgggaagcagtaggttggaaa
gtattaaactgcgatgggcatgatttcattagtattactaatgcagttaacgaggcatat
aaggcaagcaagcccgtagtaatattcgctaagactgtaagaggaaaggggtttcctcca
atagaaaatacccataaacagaggtccagtccagatgatgcaaggaaatatttactcaat
gcg
>SSO0298 (thiF) Thiamine biosynthesis protein related protein
ttgtccaattcctctattgatattggagttccatcactccctccacctttttccattgga
acaatatcaatccccacttttagtaggcaacacttatttttaaagattattctacattat
aatcttgtggaaagatattctaggcaactaatagttttaggattaggaattcaacagagg
ttaaatgagttaaagatattaattgcaggctgtggagctttaggtactgccgttgcagag
ttgctagctaggctaggagttaaagagttaactatagtagatgcagatgtggtagatata
actaatctacatagggtccatttatttgatgaaaatgatgtaggcaaacctaaagctgaa
gtttgcgctaaaaaaatatcccttataaattcttcaatcaaaattaattatattatagat
atactcgacgaggagaacgtcgagaggctaatttctgataaggattacgtgttcgatgca
ttagacagcttgtactacaagctattgttaaatgatgctatagtaaaattaggaaaaatc
ctaatatatggaggaattaatggtgaatacggttctgctaaactgatagaccctagtcaa
acctcctgtttatcttgttttattgactattcagatcaagacgaaattgggaattcatgt
gatgttattggaactactccactaatagtagaattaacagctacacttcaagttaactta
atgcttaatcacttgagaggcaatccggattattcattattctatatagattctagagaa
ttaaaaattgagagaattaacatcgagaagaactcacaatgtaagacatgcgttctaaat
gagtatccttttctatatcaaaagataagtaaacctaaatgtggaatatttagaactaat
atgaaaattcctgagttagatgagcccaaagtgtttaaaaatcttgggaatgtaacttta
tgctatcctagtattggatgttttgagaaaaggggaaga
>SSO0299 (tkt-2) Transketolase, C-terminal section (EC: 2.2.1.1)
atgatgcaaggaaatatttactcaatgcgtgaaaccttcggaaggctattagcagaccta
ggggataagaacaaggatctagtcgtgataactgcagatgtaggagactctaccagagcg
ctatactttagagagaagtttaaggatagatactttaatgtaggcatagcagagcaagat
atggtgaattttgctgctggcttggctgctgtaggaaaaaagcccgctatagttaacttt
ggaatgttcttaatgagagcgtgggagcagataagaaatagtatagctagaatgaatcta
gacgtcaagatgtttgtaacacacaccggatacagtgaccacggtgatggttcgagtcat
caagttctcgaagatatagcgctaatgcgtgtattaccaaacatgaaagtagtagtacca
gcagatcctaaggatattgaaagaagcttaccagttataattaatgaggaaaggggtcca
ttgtattataggataggtagagaatattcaccaccaatcactataggacaagaatacgaa
ttcaagattggtaaagcttatgtgattaaggatgggagtgacttagccataataggagca
ggcgttgttttgtgggatgcactaaaggcggctgaagaattagagaaattaggaattagc
gtagcagttataaatttattctcaataaagcctattgacgaaaatacaatagaatattat
gctagaaaggctggtaagataattactattgaggaacatagcatatatggaggtattggt
tctgccgttgcagaggttacggctaggcgttatccagtacccataagatttgtaggtgct
acgacttttggaagatctgctagaagccaaagggatctactagattactataatataaac
tataaaacaattataagggaggcaattgatttattgaag
>SSO0302 (tyrA) Chorismate mutase/prephenate dehydratase, putative
atgactgaagaaataacacggctgagggaagaaatagataaggtagacgagcagttagta
aagttactctcatatagattagaattatctagaaaaatagggaaagctaagtcgaattct
aatataagtgttactgacgagaatagggaaatgaaagttagagaaaaatggattgctaac
gcaaaaaagtataatattccaaatagtctggttgaatctatattgcctttgattttttct
tattctaaactagttcagattaacccaggagagaaagaaagagtagtaatatatggatat
ggcggaatggctaaatcgatcgtttctattctttcattagctgggcatgaagtatcgatt
actggaagagatttaagtaaagcggagatgttagctaatcaatttaaatgtgtaagtatg
tccttattaaaagcaatagattggggggatataattatatttgcaatacctcctagtgca
atattaaataattccgatgaattattttcaaaggcacttaaagataagattgttatggat
attagttcttctaaatttaaaatatttggcttcctagaagaattatctaggaaactagag
tttaggtatatttctacacatccacttttcggtcctattgaataccctattggagagaga
gttgtaattataccttccaaaactagttctaatgatgatgtcatgaaggtggagaatttc
tggaggaaaagtggtttagtacccgtcataactgatgttgaaactcatgaaaaagcaatg
gctattgttcaagttctaacgcattattatcttctgggtttatcaaacgcaattgatact
ttatcgttagagttaggtgtagattacagtaatttccatactacaaactttagagaatta
aacaagattttaaagcgggttaaagatctaaaaaatgtaattactgaaatacaaaatcaa
aacccttattcttataaagttagaaatataggtttagaggagcttaaaaaaattaaagaa
gaattagaaggaggtaaa
>SSO0304 (aroG) Phospho-2-dehydro-3-deoxyheptonate aldolase /chorismate mutase (EC: 4.1.2.15 / 5.4.99.5)
atgatcttatatgtccttaaggatagagctgattactctatactaatagaaaagctaaat
gaaaactcagcatctttcaagatattaaacctatatggtaaaaacttaatattagcatgg
ccagatcagaacgtgaaaggtatcattgataatagtatagaaatggctgtggaagtaaag
aaaagctatgtattagctggtaatgattggaaaaagcaaccaacagtggtaaatgtaaaa
gatgtagaaattggaagcaaaaaggtaatagtagctgcaggtccttgtgcagtagaaaat
gaagaacaagtccttactactgctaaggctgtaaaaagggctggagcatcattacttaga
ggaggggcttacaaacctaggacaagtccatattccttccaaggtctcggagaagaaggg
gtgaaaatcttgaggagagtaggagatgaagtaggcttacctattgtcacagaaataatg
gatacaagagattccaatatatttagccaatatgttgatatgatacagattggagccaga
aacgcacagaacttctctttattgaaggaagttggaaagttaggtaaaccagtactactt
aagcgaggtatgggaaatacagtagaggaatggcttcaagctgcagagtacattttacta
gagggaaatggcaatacagtattatgcgaaagaggaataagaacatttgaaaagtcaact
aggtttacgttagatataggtgggatggtagctgctaaactaatgacacatttgcccatc
tgtgctgatccaagtcatcctgcgggaaaaagagaattggtacactctttagcactagct
gcagtcgctgctggtgcggatatgttattaattgaagttcatccacatccagaaaaggca
ttaagtgattcagagcaacaacttacaccggaatcattcgaagttctaatgaatcgaatt
agaacgctagctagagctttagggagagatgca
>SSO0305 (aroB) 3-dehydroquinate synthase (EC: 4.6.1.3)
atgagggaaatcttagaagatatttgttgctctgaagtaagagtagtagtaggagaggga
tcactttcaaaattatctaagattaaagacaataacgctgcagttatctattcaagaaaa
attagtatagcagataaaattaataaatatttaccaaatgcatacttcatcccaattaat
gatggtgaaagtactaaagaattatctagtgtaatatctttagtagaaaagctatttgaa
aagaatttcgataggggggattatattataggtgttggtggtggaacggtaactgatgta
gctggtttcttagcatctatatatttaagaggattaaatctgataaacgtaccaacgacc
ttcttaggcatggtcgatgcagcaatagggggtaagaatggagtaaatttcaataatata
aagaacttaattggaacattctatcaaccaagtatgataatttccgatttagaatttttg
gaaactctaccaatagaagaactaaagaagggattagctgaagtaattaaatatggctta
actttagataaagaattatatgattacttgtctttaaataaggagaagatactaaataaa
gataaacaagcattagaagatataatctttagatctacacttgataaactaagtattgta
aaagaagatgagagagagactaaaggaatacgaatagttctaaatttcggccatacgata
ggtcatgctatagaagctggatcctcttttaatgttccacatggctacgctatctctgta
ggaatggtttgtgaggctaagatggcggaagagttaggttatgcagaggaaggagtagta
gaagatgtgttatggctattacagatttatggtttaccttacgatatatctcaaatagat
gccccagtagatcttaaactagcattaaatgctattaatatggataaaaaacataggaaa
gatgtaattttgataccgtttcctactagaataggtagctggaaaaaagttgaagttcct
ctagataccgtaaaggggtttgccgaacaatgcttgaagaaa
>SSO0306 (aroE) Shikimate 5-dehydrogenase (EC: 1.1.1.25)
atgcttgaagaaataaattatgatactaagttattcggtctaataggtaaaaacataaag
tacacgctatccccttatattcataatttctcatttagaacactaggaataaatgcagtt
tatctagtttttgatctcgacgaaatgaaattcaagcgtagtattagtgggatattggaa
attgcagaaggacttaatgttacgataccgtataaggatgaagtaatgaaatatttggat
aatactgatacgcactccacgagaattcaagctgtaaatacaatatataaaaaaagtggt
tataacactgattatttagcaataaaaaatcttgtaagaaagaagattaagaatgtatct
ggctacgaatgttacatatatggggctggaggtgcagcaaaagcagcagcttttgcgtta
tctgaattaggatgctctagtattagtattgtgaatagaacaaaatcaagggcttatgag
ttagctgaattattaaataagaacggttataacgcgtcaattaaagagaattgcaacatt
acaaataatatacttattgtcaatagcactcctaattcttctgtagtcccagaggactgt
gttaaaaaatctgatcttgttatagaatttgtttatagaccagttgagactgagttaatt
aaaaatgctaaaaaatatggtatacaatatataaacggtctagaaattttagtgaatcaa
gctgtagaagcggagaagatatggtttaataagagtgtggcagatgaaaagattatagag
tatctttatgccagggaactcgtttgg
>SSO0307 (aroC) Chorismate synthase (EC: 4.6.1.4)
atgccagggaactcgtttggtaaactatttagaataaccacttttggagagagccatggt
cctgcagtaggtgtagtcatagacggtgttcctgccggtttaccattaactgttgaagat
ataaagttcgaattagaatttagaagaccaggtagactatacgtttctggaaggagagaa
aaagatgagccggaaatattaagtgggatctttaataatagaactaccggatctccaata
gcagttatagtacgaaatactgatgtaatatcaagtttttatgacgagattaaatataaa
ccaagaccaggacatgcagaccttccatttataatgaaatatggatatgaaaattgggat
tataggggaggtggaagagcaagtgctagagaaactgtaagtagagttatagctggtgca
gtagctaagaagttacttatgctaacagatacttggatagctggccatcttagaagttta
ggcccagaagagttgagtgaagaggtaacatttgaggaggttctatgctcaaaatatagc
ccagtaagagctagtaaaaaagaccttgaggaaaaatatgaagcattaataaagaaagct
actcaagaaggggatagctatggcggaatagctgaagtaatagccaagaatccaccaata
ggtttaggagaaccagtctttgataagatgaaagctgaattggctaaagcaataatgtcg
atccctgctgtgatgggcttcgagtatggtttaggttttattgctagtaaaatgaaagga
agtgaggctaatgacgagattataagaaagaataatagaattggctggaagtacaattac
gctggaggcattttaggtggtttaacaaatggtgaagatcttatagtgagatgtgcattt
aaacctactagctcgattagaaagcctcaaaagaccatagatttaaggaacttagaggag
agttatatttcagtaattggcagacacgacccagctgtagcaattaggggagttactgtt
gtagaatcaatggtagcgttaaccatagtagaccatgcaatgcgtgcaggagctattcca
ctagttaaacttacagaggaccaagctaatacaatacagcaacgttgggagaggtatgtg
aaatcatgcaagcctatggaggagtctcaatcg
>SSO0308 Conserved hypothetical protein
ttgggagaggtatgtgaaatcatgcaagcctatggaggagtctcaatcgtaaacgcacta
ccatcttggtatggctcatctatggcaatcaatttgaaggtaaaagtagaaattagagaa
ggtaagagagtttattctcaagagagtgaactaattaagaccattcttaattactttaaa
gaaaaatattcaataccggatattgaagttgatattgaatctgaacttccacaaaagagt
ggactaaaaagcagtagtgcagtttctgtagccctaatagcggagattgcaaagcaatat
gatctaaggaatattaaccctccaatattatctgcgatactttcactgaaagctggagtg
tcatataccggggcacttgatgatgcagttgcatcatattgtggaggaatagcattcact
tataataagatgtttagaatagtaaagttagagaatcttgaggataatttatcgatcctc
atattagctaagggagggagacaaaaacctgttaatctaaacgagctaagaaaatatagt
cacgtctttgaagaaatttttaagatagcacttaaggattacttgactgctatgaagatg
aatggaatattgattgctaatattttaggctattcattagaaccaatagaaattgcactg
aaaaaaggagcgttagctgccgggattagtggaaatgggccttcatattttgcagtttct
aagaatggagaagaaggtccgatatacgaaagtcttaagaaatttggagatgttattata
gttaggcctgtaagtcttgattgtaaagatttatccatcaaagat
>SSO0309 (aroA) 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase)(EPSP synthase) (EC: 2.5.1.19)
ttgattgtaaagatttatccatcaaagattagtggaataataaaagctcctcaatcaaaa
agtctagctattaggttaatttttctttcacttttcactagagtatatcttcataactta
gttctatcggaagatgttatagacgctataaaatcagtaagagcattaggagtaaaggta
aaaaacaattctgaatttatacctccagagaaattagaaattaaggagaggtttataaaa
ttaaaaggttccgctactactcttagaatgcttattccaatattagccgcaataggcgga
gaagtgacaattgatgcagatgagagtttaagaaggagacctttaaacagaatcgtacaa
gcattaagtaactacggtatatccttttcttcttacagtttgcctttgactatcacggga
aagttaagtagtaatgagataaagatttctggtgatgagagtagtcaatatatttctggc
ttaatatacgcacttcatattctaaatggcggtagtattgaaatattgccccccatttca
tctaaaagttatattctgcttacaatagatttatttaagagatttggttctgatgttaag
ttttatggtagtaagattcatgttaatcccaataatttggttgaatttcaaggcgaagtg
gcgggagattatggtttagcctcgttttacgcgctttctgcattagttagtggtggagga
attacaataactaatttgtgggagccgaaggaatattttggtgatcatagtattgttaaa
atatttagtgagatgggcgcttccagtgaatataaagacggtagatggtttgtcaaggct
aaagataaatattctcccataaaaattgatatagatgacgcacctgacctggctatgaca
attgcgggattatctgcaatagcggagggaacaagtgaaattatagggatcgaaagattg
aggattaaggaaagtgatagaattgaaagtataaggaaaatcttaggattatatggtgta
ggtagtgaagtaaagtataattctattctgatattcggaattaacaagggtatgttaaac
tctccagttacagactgtttgaatgatcacagagttgctatgatgtcgtcagccttagct
ttagtgaatggtggggtaattacatcagctgaatgtgtaggtaaaagtaatcctaattac
tggcaagatttattatcactaaatgcgaagatttctattgaa
>SSO0311 (aroD) 3-dehydroquinate dehydratase, putative (EC: 4.2.1.10)
atgagaccattaattgtagcttcattaccaattaaaaagatagaagacttaaaacttata
gaaaattttttagatgcagatctaatagaactaagacttgattatctaagagaaagagaa
gtcagtttgatatctgactattatgaatttttagataaatataaaaagaagttaatagta
acgttaagagataaaggggagggaggaataaatcaattagcggatgaattaaagataaaa
attttaaatgaactctacgagagacaatatctgtatgatatagaggtttcatttcttcaa
aaatatgatataccatacgataataggatagtttctgtccactattttaattatcttcca
actctagagaagataaaggaaattgttagcaagttttccgaaaaagcgttcagcgttaag
attgcagttcctagtctaaaaggatataaggaggtactcttacctcttcttgaatatgaa
aacgtaaccgtaattccaatgagtaataattctttagagaggatcgcagtgggtctactg
ggctcaaagttagtttattcgtacgcaattgaacctttagcacaagggcaactttactat
aaaaaagttatccagatttttaattatattaacgatataacaacttcatctttagttact
>SSO0312 Benzene 1,2-dioxygenase system ferredoxin component, putative
gtggagtatataaggataagtagaactgattttaagactggtgaaaagagaaaaattata
ctgcctaatggacgtgaattagtcgttttttatctaggagtagatagattttttgttttt
gataataaatgcccgcatttaggttgtgatctttcaaaatatggcgttatcataaaagaa
gaattagtatgtcaatgtcacttttctcatttttctatatatagtggagaacctaaaaag
ggagcttccaaaaagcctataaaagtatacagagttcaagtaactaaagatgaagttgtt
atatcgttaata
>SSO0313 DNA helicase
gtggaacttagagagtggcaaagcaaaatagctgagaaaattgtagaagcattaagaaat
aattttttagtttcattgcaagctcctacgggtagtggtaagactttatttgcactttac
actgctcttaaggttaagccaaaagtagcgtttgttgtaagaactcataacgaatttttc
ccagtttacagagaactatctttacactttaaggataaaaaatacggatttttagtaggt
aaatcctctgcgtgtgtttttagttcatctgacgttgatgctcaagatatatattgtaat
ggatgtgaaatttttaacgcgtccgcagttaccgtaactgattcgccaaaggtaagtctg
aataagctaaaggaggagggtaaaaaattaggattttgcccttattattctcttctggag
accataaaaaccgctgatgtgatattactcacatatccttatctgtttataccttggctt
agagaatctttagatattaattgggaggactatgttgttatagtagacgaggctcataat
atagagaacgtttctaatatagaagagaaaaaactaaacaaaagaattatagagatggca
atttcccaatctcactcacaaaatgtgaaagtaatattggaaagacttaaggaaaatgtt
gaaaaggcagtttattcagaggataaatatatacttattgaaaaggataaattagacaat
atactaccttctaatgaagaaatcgagattttatcggaagaatatgatgaaattaggaag
attatgataaaaaataagacggtaagtaggaattatctcggatcgattttgaggtttttt
gatttagttaatgatgaaggaattagagttttttcatattctggttccttgattgcaaaa
tatataataccctcttactttactgatatacttaacgatgagaaaattacgtatatgctg
atgtccggtactatgcaacccttagattatcttagaaatattataggaattaaaaggaaa
atattatatattgatgcagaaaaggttatgaaaaaaagattaactgggacatatgagtgt
cttatatctattgatgttacaactacttatagtttaagatcggaacaaatggcacgtaaa
tatgcatcatatttactaaaaattttctataattctagaagacatgttctagctatattt
cctagctatgaatttatgagaatagtatctaaatttctaaatataagatatttggcagaa
gatacagaaactagtatcgaagagataatgagcaatctgaaaaaagaaaaaacaattatc
atgggtatagcaaggggtaagttagctgaaggaattgaaatagttgaaaatggatctagt
ctaatatcagatgtggcaatggtaggtatcccttatcctccaatagatgattacttaaag
atacgagttgaggagatatcaaaaatcttgaaaaaggatattagtaacgaattaatcagt
atacaagcattaattgctgtaaaacaatccataggtagggccataaggggtccaacggat
aatgcaactatatggcttcttgataaaagatatgatagtctatggtggaagaaagaactt
aattgcttgaatgcaaggaaaattaaactg
>SSO0314 Conserved hypothetical protein
atgcaaggaaaattaaactgtgaaatagaaatggaagtgcagatttttactcataaaaac
tgtgtagaatgtaacatgcttcttgagtatctagagaataaaggactattgggtaaagta
aaaatcattgataccgaattatatccatttttagctttcgaaaaaggtgtaatttcaaca
ccgtccatttttattgatgggaagttggtatatgctggtattgtagattttgaggagttt
gaaagaattttaagtgggcaaaaggtgactaaacaaatagataaggctagtttggttgaa
aaattgatgcttggaatagtggattcttttgcagcaacagcttggttatatattaaccgc
gactttgattcgtttttggctcaaaaggatttcgtaatggcagtaactggattatcactt
ttggacgagagggaaggggatgaatactataattacctgagaaatgtgatggtaaaagaa
ggagataggtatttggaggaatggaaacctagaatgctaaggaatatatcgtctaatttc
attagggaaatattttggctatatgagagaaaaataagtaaggaaacactcacgcagaaa
tatccagtagaagttttcgcccattggttgatgataagaagtggtgcagtaggaagagtg
ggtctaagaatctatccactttctgactccactgtaatgaaaagggtattagaggcatac
aatttcatgttagagaattacgatgagatatttaataaggttcaaaaagaacaaatggag
ctcaagactaaaaacaaagagcaagtaaggtatttgcaactt
>SSO0315 Hypothetical protein
ttgagagataatattattctaagtatgtttataaagaacatggaggcaaatagtgatatt
gtatatgaatatataaatagagtaatagttgcagttattaatgcaattctgtcatacaaa
atcttcttttcgtttttacctattgattacgtgtattttgttatagctattatctcagta
atttcatttttcttctacaaacctctttctataatatttttagcgatatatattatagaa
agtgcagtagtttttaagacattatacaatattacattattacctctgattcaaggctac
tcaattgaatatctaatagaattactggtagcattaatttttatattcataatcccgcta
ttttctattttaaaatatagttccataggaggtgtaataacatctagttctatactttta
tcaatatataatcctttctttctattgtttttaccgtttggaattgctgaaaagaatagt
agaattacagtaaatattctttccgtattacctctactaatactaatagtacctagcatt
ttaagctacaacacaacatcatacatattacataactattcgctctgggtatctattata
ttagctctagcagctggtatattatttggtataagtcaactatatagtttaattggaagt
attccactttctatctttctttatctaaatggtcaggctttagaaataataaccttaact
gggttattaacgataattttaaatataattccttctatagtatcactgattaaagccaat
ttttatattaaaaaagaattagttgatacaagaaaaagaattattgaaaatctagatgaa
ctaaaaggagtactagaaaagataaaattagttataaaggatactaatgatatagaacta
actcctttaattcaaaagtataataagttctttgctgatatttcaagtaatctagaaaat
atatctgatatgaagactttgcaaaatctcgagctggaattaaacgctaaaagattagag
ttagagagaagtattaatgattatctcttcgatcaaatttcacgatataatgaaatcgta
gatgaaattaaaaattatggtatcgtgttagataaaatagaaccattatctgaagctata
aaaattaatgatgaaggagtaattaagataagaaaattactatctagagtaaatgtaaat
gtccaaatattgtataaatatatcgaatctatatataattcattagagttgttattaggc
aagaagtataataacgaaataactgatataagatttaatatagaaatgtcaatcaagtat
tttaataggttacttaataaagaaaatttagaaacttgcaaaacttgtacagaactgatg
ctaaagtttttacagctatctaattcacttaatttaaatgcaaatcaagaattgttgaaa
aacataataaagcttagtgatgaaaaaccagctatatttgtggtaaaaagtaaagaattt
ttagaacaaggcttaaaaacagcttctattgtgttagctaaagttaaagaggaatacgaa
tacatcaagaatgagataccttcattaagtagatataaagaatttgatcttattaactta
cttgagaaagaaataaacgactccactaagccaatatgtaagagaatagagacgttatcc
tcatctttccaagtaattcaagatttgtctagcataatagcacataagagtgaaattgcc
gatgttattaatttgattaacgataactatgatctcatcttgcaaaaagtaatagaagag
ggatgtataaaactcagcgagttggggatagccttagattatggtaagttcatagatctg
gtacttcaagaaaagggtacgaacttaagagttgttaatgactcaatttgttacatgaga
>SSO0316 (sod) Superoxide dismutase [Fe] (EC: 1.15.1.1)
atgactctccaaattcagtttaaaaagtacgagctacctccattaccctacaagatagat
gcattagaaccgtatataagtaaagatataattgatgtacattataacggacatcataaa
ggctatgtaaatggagcaaattcactcctagaaagactagaaaaagtagtaaaaggagat
ttacaaacagggcaatatgatattcaaggtattatacgtggtcttacgtttaacattaat
ggacacaagttacacgccttgtattgggaaaatatggcaccaagtggaaaaggtggtgga
aaacctggtggtgcactagcagacttaataaacaagcaatatggtagttttgataggttt
aagcaagtatttactgaaactgctaattcactacccgggactggttgggctgttctctat
tacgatactgagtctggcaatttgcaaattatgacgttcgaaaatcacttccaaaatcat
atagcggaaataccaataatattaatactagatgagttcgagcatgcgtactatcttcag
tataagaacaagagagctgattacgttaatgcttggtggaatgtagtaaattgggatgca
gcggaaaagaagttacagaaatatttaacgaag
>SSO0317 Sugar phosphate nucleotydyl transferase (EC: 2.7.7.-)
atggtatccgcaattgtactagctggaggttatgctactagacttaggcctttaagtttg
actaaaccgaaagctcttttccccattttaaacaaacctatactgggttacattttggaa
agtcttatcaattccgatgttagtgatatatatttatcattaagagtaatggctgacaag
ataatcgattacttaaaggatactagcatgctagataaggttaagatagaagttgaaagt
gaacctttaggtgatgcaggacctttaaaattgatctcccagaagtataatttagatgat
gacgttttggtcatatatggagatatatatagtgagataaatataaaatcccttctcgat
ttttattataaaaagagttgtgatgcagtagtagttggtacggaagttgaagatccgaga
agatatggtgtactttatacagaaaatgatgtcttagtagagttaatagaaaaacctaaa
aaacctataagcaatttgattaacggaggagtatatatttttaaaaaggatctattcaag
ttagtagaaactccatcttctattagtaaggattttttacctaagctacttagaactaag
tccatttcagtgtataaatatcacgggatatgggcagatataggagtcccagacgactat
cttagactcaattttgaagtattagtacagaaataccctaagggttatataaactcgtca
gctaaggtcagtgaaaaatctacgcttattccgccctattatattggttcgaaaaatgtt
attggagaggatgcatatattacctctaatactattttgggtaatgatgtagaaatagga
aaaggaacatacatatctgagagtatactaatgaataaagtgcaagttaaagaatataca
tatatctcaggatctataatagctgacaaaactaagatagggagatggaatcatatatta
gatgggtctattttaggtgaagaggtaattactagcgatggagtacttataaatcgacgt
acgataatcttgcctaataaggaagtgaaggaacacgtttatgataaaggcaaaataata
cta
>SSO0318 Hypothetical protein
gtgacaattatgatccttagggaaattattgacgaattgtcatatcagttgaagcaaaga
agaattattaacgtatgtgttagccctgcttacacatcagtaatgttagacgatcaatcc
ataggaatctcacatactataacagatggtgagatagaaggtgctggtgagataataggg
aaaaatgcttatgatgttgtgataaacaatctagactcaaacttgcaaagatctctgtct
ctagcaattctaaatgctttagggagtatgattgattttacgcaaggtgatccaattaat
ttatactctggaggaaagctttgcgtatttggtttttcacctcaactgtcatatagtaat
tttgatagcgttatcgtgtatgatttcatgtctactgaaaataagaaggtaggtaacaca
gaaataaaaccttactcttcactatctcgtgaagtatgttctactgcattaattttcgca
tcttctatagtcaataatacaatagataggattattagtcagatctctgctaatcaccta
attctaactggcatttcttcggtagacgctccaattacgcttaaaaaccatggatttgaa
gtgttaggaaaattattcccagttgagaaatatcgagtatttcgaacaatctgcgaaggt
ggcagtaataagttattgagtaaatatataatgaggtattttaaaaagctg
>SSO0320 Hypothetical protein
atgatactaaattcacgcacaattgatgacgctaaattcttcgacaagcccatattattg
ttttttactgatgaaaactgtaaggactgtgatactatctattcaaaactacaagattct
acaattttttcaaaatatataggcaaaaaggtaaatgcactagaatacattcactatacg
attagactaacacgaggaatgatacccacaattactattcttagtcctactttagattta
ctcgcggtaatcgaatctaaagatttgaaatttatcgaaaataaattaagagagttacta
gatgaatataaaagaagaatagtaaaaggtataaaattagagggatatacccctgatcct
atagaacccactcctagcataatttatgaaacaataaataaagtgattgggggatatgaa
gctgatactaggatgatagaagtttatttaacctatactaatgtatacaaggaatacctt
aaagcgaaagataagataaaatgctctgatgatgtagctaggtatcttttagaaggaaaa
ggagagataaaaattgatgagaaatcctctgcaaacgtttcaatgttagtaaattacgga
gtgactagtgtacaaaaattactagattttatagacattaatagtggtgaagtatataga
agtaagaaaaaagaaactaaaggaattttgctcgatgaagcattagctggtaatgcacta
gttagtgaatatgagagaactataaacgaggagtatctcagtctcgctataaaggttgca
gattatataaagaataatttacaacatgaaagaggttttagggacataaaggagattgat
aatataactaaagtgccttacttagagccaatttcaaactctgaagcttctatattcttt
tcacgattatggaatataactggtgacgaaacatacaagaatttagcacttaagggatta
ggtagcgcgttaggaggggctctaaataatcctaaggttattgcaagagcagcgatagct
taccttaaactttttgatagtataaaagctaatcgttacttaaatattatagatgccaga
attactgtagtaaaaaataatggttgcaatgactctatgttatattatagtgggcaatgt
tattcaaaaattgatgaaatacaacctacagctttt
>SSO0321 Conserved hypothetical protein
atgatctctgttaaattagtctcatatacgaatgatggagagaaagtcattgctattgct
gctaagatgagtaggagtagaaaaggttgggattatcatgagaaagacatgactgatgat
gaaattgagacatggatcagagatgcaatccttcacggttattggagtgttcttgagcat
agcgtttatactttttctatagaagaaatttctcgtgtagcttcacatcagcttgtgagg
cataggattgcaagttatacgcaaatgagtcataggtttgctaagcctatagacgaatac
tacaaaccaattattccgccatctgccaagaaaagaagtaaagagttagtggagaaagcg
tataaggaagcctatgacaactattacacacttttagaaagcggtgtaccagaggaagat
gcaagatatgtactaccaaatggagtaaatacaaatattgtcgtcacaatgaatgctaga
gagttatataacttcttctcgcttcgactgtgttcaagggcacagtgggagattagagca
atagcttggaaaatgttagaggaggttaagaaagttcatccccgactattcaaatatact
ggaccaaattgtataatacatgaaaacttcataagaaatgaaaatgaatctataacttta
gaagatatatttaaagattacaaattagagttcatatctcaaagatgcatcgagggagta
ttgagagacggaataaaaaaatgcatcataaattcgcgttctgtattggataatattaaa
>SSO0322 (NuoA) NADH dehydrogenase subunit A
atgtcatttacacaagctattttaggttttggtattcccattgtagtctttctggctgct
gggtatggtctttataagttcttactgctgatacttccatcgaagcctaatcccttaaag
gttagccgatttgaggctggtaatatccccacaggatcagggaggctttggttcccattg
caatattatggttatttattgctttatgttaccttagaaccgataattgtattactactt
cctatcgcattttcaaattattattcagtaccagtagctttcagagatctattattaata
attgtagtgtttattgttttaatgtaccccgttttgtattatgctatcagacaaattaat
ttattataccagtgggagatgagaaga
>SSO0323 (NuoC) NADH dehydrogenase subunit C
gtgggagatgagaagatgagcgaagcgctaaaaagtcttgtaaacgatttgcagactaag
tttaaatgtcaagccaagattgaaagtgatagacggataactgtgattgtgcctgataag
aaaatcataagagatgtggccagcttcttaaaagattttgggtttgatcatgttaaggca
gtaactggtatagactatcctgagcacgagaaactagaggtggtttatcatatatcttca
tactctaatttagatctggctaaaatcatattagccttaagaacgactgtaagttataag
gatccttctttgccttcactatattcaatatttgaaagtgcgtggactggagaaagggag
acttatgagatgttaggaatcagatttgagggtcatccagatcttagaagatttttcttg
gatgaggattttgaaggtgtatatccattgaggaagtcatataagatcaagttggagggg
gtcttcgttgacaagccaaccacagaa
>SSO0324 (NuoD) NADH dehydrogenase subunit D
ttgacaagccaaccacagaatgaaatacaagaacaactacttgcagctactggaatgtct
gtagaatttataccagttcaaggagagctcaatgtcggcccgcaacaccctggctctggt
catatgagaatatttgttaaactaaatggtgacatcatagaggatgtagacttagatgtc
ggttatgttcatagagcagtagaaaagctttcagaaaataggaattacatgcaccttata
cctttagtagagaggccggcgattttagattctatacatatgaatttaggctacataatt
gcggtagaaaagattttaggagttgatgttccagaaagggcgcaatacttaaggagcttt
gctgcggaggtaaatagaatagctagtcacctctacggattaggaattttggcaatattc
ttaggccattctaccggttttatgtggggctttggtgatagagaggtatgggttaccata
ttagaagcattaacaggggcgagggttacaaattcgtacgtaataccaggtggggttaga
aaagatataactcaagaaataaaagaaatgaccataaaggctatagcatatcaacgtaaa
agactagaagattggaaaaaaattttcttttataatccatcgattagagcgaggcttgaa
aatgttggagttatgagtagagaaaatgcaattaaatggggagctgtcgggcctaattta
agagcttctggagtatactatgacgttcgaaaaatagaaccatatggggcttacgataag
ttagattttgagattccagtttacaaggagggagatggtctagcaagaggtttggtaaga
ttagaggaaatcgaacaaagtatgagaatattagagcagataataaagaatatacctgag
ggtaatatcttatcagatagattcttcaaacagatacctcctattagacttaagaagtat
tgggagacatatcgacgcattgtattgccaggctattacgcttcatttagaccacctaag
ggtgaagcaatatctagagttgaagctggaaggggagagctggcatattatgtagtaagt
gatggttctcctaagccttatagattaagaatgataactccttcttataggttaatatat
gtttttaaagagttatgtaaaggttcacgatatgctgatttggtttcgatttatggtagt
ctagattatttccctccggaggcggatagg
>SSO0325 (NuoH) NADH dehydrogenase subunit H
atgagcgttctctcagctttgcaatattatttcttttatccttcatttttcttaacagta
attttccctggtctaatattcactctaatttttcttttagttactatatggtttgaaaga
aaagcagcagctatagttcaacttagatacggtccttactatgcatctaaacgattagga
ggtatacttcagttatttgctgacgctataaaatttgtattctcggagataataattcct
aatggagtaaatcaaacactttatgcaatatctccagttctagtattaatatttgcgttt
ttacctatggctcttataccaatatctactataccaacacaaggatctatattgtcagtt
tatcatggcatattttatgacacccaaattcatcaaggtattttagttccatatttcata
gagtacaatttaataggaataatcgcactggaatctctatatccaatacttgtcatattc
ttggcatggaatacaaacaatagattcgctatagtaggttctataagggaggcttatttg
tcagtatcttatgatgtattaatcataatttcgacacttgcattaggattagaatatcac
acacttgatgttgctaagatagtgacttctggaataccgggatttatagctaatcctatt
gcggcatttgtattcttagttgcaatgttaataggttcttcgaggtttccatttgaaata
gtagaagctgaaacagagttagttataggtccttatactgaatatagcggttttctattt
gtattaaccatggcgggttcctatgtggcaaatttggtatatgcaattctctttgtggac
ttattcttgggtggttggcttccatttacgggatttgtaggtgcaatatttaccgttttc
aaggcagcaatagtggtattttttgctgtatttcttagagcggtttatggaagatacaga
atagatcaagctttaaggggaagttggaaatatttctttcccttagctttagcttcctta
ttattaggtgtggtggtgggttatttatggataagg
>SSO0326 (NuoI) NADH dehydrogenase subunit I
ttggaaatatttctttcccttagctttagcttccttattattaggtgtggtggtgggtta
tttatggataaggtgaaagaatataaaaaagaaaatatagcgagtttatttgcagaacat
atacagtccatagttacgggtataaaatattttgtaaagcctcagagaatcacactgcaa
tatccagaagatagccttactcttcctacgggttatagaggtatgattaggctgtacaaa
gacgtatgtataggctgtactttatgcgctttgatatgtcccgcagatgcgatgaaaatg
gttacagaaagtggaaagaagtttccgcaaataaattacggtaggtgcgtcttctgtggt
ttctgtgtagacgtatgtccagtggatgctttaaaggaaactaaagtacatgatcttgtt
tttaataacagaaaacaactgatcttcgatccggatagatttaacgtagatatagatgat
gtgcctatgcaagataagcctgtaagaaaagtaaaagcaataatagatgagaagaggggt
ataaaatatgtacccgcagacgag
>SSO0327 (NuoJ) NADH dehydrogenase subunit J
atgtacccgcagacgagtgagataatacaatatatattatttggtttttttggagttatg
actatagccttctcaatatatattgttagggctaagaatgtgttttatggtgcagtgagt
ctagcatttctaggtttaagtattgcagcattaatagcattagaagctccatcaacgtat
ggtatatattcagtgtttcatattctcttgtatgtgggagcgacggtaacttttcttgct
atttcgctggtaatgtttaaagatttagaggtaaaatttggtagaggagcattaggaata
ttggctggaggggctgtaacactcttgtttttaattatagtttttatctctattcctcaa
gtttcttcagcagaagtacaaccaattaatttccaagtattagctaatgatcttatagag
aattattggtttccactaattatacttgttatagctttattaactactttaattgaggca
atatccttagctaggagggat
>SSO0328 (NuoL) NADH dehydrogenase subunit L
ttgcatttgcggctgttatactttactataggcaaaaggataaactggaggtggaataag
atgtttcctctctcctttataatgttaataatatcctttatacttgcagttagtatattt
tttgttagatcaagagtagcctcatttattttgagttttgtatcaatagccataaatatc
ccatttttggtttttagaggtatttttgaaaacatattcgtctcgaaatatgttggagac
ttcggaattgtagtaaacaatttcaactatccatttataataactattataattattaca
ctattgtccgcaatatattccttaaggtatatggaacataagtttgatgaggagagaaaa
agtagctggggtctttactatgctttgtatactttatttgccctttcgatgctatacact
gtactatcgactaatctactggaattatatatatttttggagatttcgttaatttcgtca
tttttactgatagcgctttatgggtatggtgatagacgcagaataagccttatgtatttc
atatggacgcacattggtacaatattactcttggcttcaataatagtaataggtctttct
acaggctctatgaacatttacgttgatgcttatacttttgccaattattcaactatatcc
tatggaatcctagtatttataatagcagtagttggtatgtttgtaaaaggtgctcaagct
ggtttcaacatatggctaccgtatgcccatggcgaagcaccaactcctatttcagtattg
ttaagtccaaatatggttggtttaggaatatttgtagtaataatttactattatctattt
cccactatgtccttcttagctcccatattcatagcttgggccattatcacgatgatttat
ggtggtattaacgctctggctcaaaaagactttaagaggtttttagcgtattctagtgtt
tctcaaatgggttatatgctattaggtgcttctatagcatttttaagcggattatcaaat
tccattatttcgttgcctataggaatattggcgagtattttgatctatgtatctcatggt
tttggcaaagctatattattcatgagcgctggtgcgtcaattaccgaacttaatgaaagg
aatattgaaaagttagggggactatatctttcttctccccttcattcaacattagcgttt
ataggcgcattgaatcttttgggtctgcctcctacaattggactgataagtgaagcattg
ttgatattttcattaggtactatattagataagataggaatagtaggttttatagtgata
gtagcttttataatgatcgcaataggtacctcttcggcttatataggttatttgttcaag
actgtgtacgcaggtaaaaaggaaaccaagaatattgataacgtaaaagagtattctatt
ccaatgttattaataggaatatttagcataattacgttctttattcctcaatatgtatca
ccttctttagtattcacgtcactgttttcaaattctacaattttgccattcatagcgttc
ttgcccgttttaggttcgctaatcgcgctaataactccaaagtcattaaatcaagatttg
agaggcgcaatagtagtggtatcaataggtatttcaatggtcttatctgctgtgttatta
gttaataatttaggaaaacccttattcggacaccctcagttatcatattcatttggttat
ctacaatttagtgctaatttgcttcaatccattttagccctatttgtatcttcactatca
ttctttatagcattatatagtataggatacatgagagaagataacgttttaagaaggtac
tggggtttctttggacttttcgtaacatcaatgttatctgttgttttagctaataacgtt
ttattatttattgctggatgggagggaactagtctagcatcttatggtttaattagttac
tggctagatgacaatgaaaggaatgtagttggagattttggaagaagaatattcggaatc
gaaaatgtctccaaaccaacaactagtgggattagagctttaattttcactcgtgtaggt
gatgttggcttgctagcggtactaggatatttgctttcattatcaagttacaattatatc
ttatatcccatttcaaatgtatcgtccacagtattttctgcattgtacgctgtagcctca
catccagaagggtggttaatattgctaatattctttttaggtgggcttgctaaaagtgca
caatttcctttcacgcaatggctattgactgctatgactggtcccacaccagttagtgct
ctaatacacgcagctactatggttaatttaggggctattcttacattcctcacctatcaa
tttataccaataaattctaacacttatttgttctttgccataatggtaggaataacatta
tttacagcattatacacaagtattaacgctctagcctcaaatgaacaaaaggtaatttta
gcttattctacagcggatcaaatatcgttaatgatattctcatcttctttaggtgcttta
cttggaaatgtaagtttaggaataataatagggcttatacaaatgttcgcacacggacta
tataaggcatctctctttatgaacgctggttccgtaatacattacacagaaagtagatat
gtagcttcaaaaccattattatataaggagattccttctgtgtttattttacaactaatt
gctgcattaaacctagccaatttgccgcctttaataggattttgggcccacaatatcata
ggtaatttagctagtagtacttcaactacgatattttacttgtatataattctggaattt
ctaggttcaatctatatattaagatatattgcaagaacgttcttatggaagggagagaca
gataagactcatgaacatgggcacttaagtatcttaatggttataagtcctgcattcttg
atattaggatcaataatactaggtgtactttactttaatctggcgaccttctttaatatt
atacaattttctgagatagatttccttagtttaacattatctataataggttggataatc
gcttttgccatatatactagatatttgaatttaagttctgtaaagcccctaatagatttt
gtttattatggttggtatgtgaatccagcttttgataaatttggatatcttttcaaagat
tttgctggtgctctattcaaaaactttgagagaggagttatcgatttagggctgaacgag
agattacctaaatctatagtaaactttggatcaagaatctataatgtagtcgaggatcat
attcttggggattatatcatgttatatgcatggggtatagttttacttttaattatagtt
ttgattctattcggggtgattgga
>SSO0329 (NuoN) NADH dehydrogenase subunit N
atggggtatagttttacttttaattatagttttgattctattcggggtgattggataatg
gatcctatgtattatttaccaattttaataccatcaatttttattttgttttcatctata
tcagttttatttatagacaatggtcttgatgaaaataggtttagattatcagtaatactt
tctgtagtattattaggagttagcctagcgtttttaatatactcgtggacagctagtgtt
ataaactatactctattctctaaatctctacttatagacgtgccgggctatttcttttca
ataactgtatttagtataggtatacttgctattttattgagtaaagatcatataatatct
tggcctacacgctcttcgatgctgtcattgatgttgctatctttactaggtctattttat
atgtcttttgcgaacaatattatcattgttctcacaacttgggcaatatcatcagctgca
agttatgcaatagctatgcttagaaaggattacaagtcagttgatgctggtattaaatat
cttattatggggcttttatcgagctcaataatgataattggttttgcctcatatctaatt
tcaactggttcattactatttactacatctgtgatatatccaaatctcttctttttctct
atatcttttatttcaatagcatttttatttaagattggagcatttccatttcaagcatgg
ttgccagatgtttacacggatgctgatagaatatcagtggcttttatttcaagtgtgggt
aagcttataggtataattcctttatttagggtagtatatctatcagatcctaatatggta
gaattggttatattcatagtcatttcagtagctagtatgttggttggaaatataaccgct
ttttcaaggagagatgttgcagcaatactttcatttagttctataactcaaatgggctat
atcttaataggttttgcaatgtttacagtatctccagccatagcagttgtaggcatttta
gtacaatcccttgcatatggaatagctcaagttggtctatttggtatagtgagtcacgta
gagaaagtatctgggacttctgatatttctggtcttagaggaatatcatctcaagataag
ccactagcttttgcaattgttgttcttatattaagtttactaggaataccgccaattttc
gggttttggggtaagttgttcttatttgaaagctcattcacatacccttggcttactata
atagctgtacttaatagtgcaatttctgccggatactatgtacctattgttagagaagtg
tttagggaaggagaatttgaggttataaaaagttcagaaagaaacattgcagtagtctcg
gcaattttaagtataatactaggtatagttattccaattgtatttcagattttggtgagt
cagattgat
>SSO0330 Conserved hypothetical protein
ttgattagaattgccttaattggagtaggtaatgtggcttctgcattagtgcaatctata
gaactgattagaaatggcaaagagatttacggaatattagatctcccaataaggccaaat
gatatagagatagtagcggctttcgatattgacaagaggaaagttaataagaggcttaga
gaggctatattcactaaaccaaatgtagttgataagtatgtagacgttaaaaacgatata
attgtaatgagaggtcctactctcgatggaagagttgggattctttcaaatattattgaa
gaatctgaagaagaacctgttgatatagttgacgttttaaagaaagagaaggtagacgtg
gtagtaaatttattaccaactggggcaacaagcgcaagtaatttctatgctaaggcttcc
ttagaggctggttctgctttcataaacactactccttccccaactgctaaggaatttaaa
gatcaatttatggagaaaagacttccaatcttaggcgatgatttattaagtcaaatagga
ggaacaataacacatgctggtattattgagtttttaaaaagtagaggagtaaaagttcta
aagtcttatcaaatagacattgctggttctacagaagctctcgtagccttggaagactgg
agaaaagatctcaaaaagagcttaaagtcctccttcatatcttcttttacgaacgacgtt
gaagttgtagcggggacatctgattacgtagagtttctaaaggacagaagggttagttat
atggtaattgaaggattatatggaataggagttccaataagaattgacatttctctgaaa
acatacgattctttcaatgcagtagctcctctaatagatctaataagaattgcaaagctc
ttaggacgtcatggtattggtggtgctgtaaaagaggtttgttattactactttaaagac
cctccagaaaaggctaagagtattatggatgctaaaagatcattagattcccttttaaat
aagcttttagga
>SSO0333 (thiI) Thiamine biosynthesis protein thiI
atgttagtaattataagaccatcaggtgaaattgcacttaaatcgccaaggtctaggagg
aattttgagtatacattaatcaataatataagaaatactataggaggagggaaaatatgg
agatcacaaggagtaatcctattagaagttaacgataataacgcgaacatagaggcactt
agcgaggtattcggtatatcgtctttctcgccagtaatagcaattaaatcaaataatttg
gaagatatagttaacaaagctaaagaaatttttgcggagatagttaaaggcaaaattttc
gcagtaagagcaaaaagaataggatctcacagttttactagcctagatgttgaaagaaga
gctggtgaagctttatatccatattctaaaggagtagatctagagaaccctgaagttgag
atatttatagaaattagaaatgagatgacgtacttctatcataaggttattaaaggaccg
aagggtttaccggtcggtgttgcagggaagacagttgtgttgttttctggtggcattgat
tcacctgtagccacatggatgatgatgaaaagagggtcagttcccattattttaaacttc
aatttgggcggagacctacataaggagttagtattaaaagaattaaatatgcttaaaaga
tggagtggaggacataaattaaaaatatttatcgtaaagggtacagatgtgtttattaag
ttatcgcaagttgagagaagaagccgtgtagtcatgttaaagagagtgatgtataaaacg
gctgaaaagctgtgcgaaaaaacgaatgctaaatcgattaccaccggggaatcactttcg
caagtatcgtcacaaactatggctaatttatacgtaactgaatatgggataaagtatcct
atttttagacctctaattggatttgataaggaagaaatcgttgacatcgcaaggaaaatt
ggaacttacaaacactcaataaaacttccagaatattgcgcaatctcaactaaagctagg
acctctgaggatcttaatgaaatattaaagaatgaagagaggctaaatgttgattacgag
aagatacttgaaaactcggaggtaattgaatta
>SSO0334 Hypothetical protein
gtgtatctatctccatcgaatgctacagccgaagtcatagccaacgatactgtatttttt
ggattcgtaaatcaaggtcaacctaatttcccaatgatatatgatattcatgttgcaata
accgcatatttcgtttataatatcactactgcaagctggcaaataactaaggaaatttgg
aactcaacagaagtcaatgcattatcagatacggtttactataatctcaatgaaccaata
atgaaggttagtgggatagatacagtaactataaatgccagtagcggtcaaggatataca
ttacaagttggcaatgtaatggttatagtaaaaccagatacctatgcggaattagcgaat
ggtacaatgttatctgtatacaatttctcattagtaacctttagccttgaagccatatat
tcaccaccgactgcacctaacctaacgccattatatgcgtttgcattcgctgtaaacaac
cagataacgccagctatttcgttagtaactatgagcaatggaaaagttatagctcaacca
ccaataacagttgtatgggctccaaatacttggacctcttggacttggtttggtggaaca
tttaatggaactgcatacataggtggaagctacaagtttgtggaccattggttatatggt
aatggagtaatggttaatgtacagttcttcaagccagttatatggatattcgagtcatca
gaaacgccagttgcccaaacacccaaaccagtacaagtaagtgtaagtagcgtatatggt
ctgactccagtaaatgtgtatagttacgaaataaatggtacccaaggaggggtagcagta
gctggcaatatgattgtcacaatacagccaaacactaaaatagttacacctagtggaaat
ctgagtgtatttaacttctcaatagtgttttataatcctgcaaatgcagggaatgcaccg
aatggacaagtcccaatactagctttcgcctatgcaataaacggaaatgtcacatttagt
tactcatcagtgaactcaattaccggtcttgctaatccatttataactgtaatattaacg
ccaagtcaaaacgtgtcaatgtggacatggggagcaaaaggctatatatttaaggatccg
ataatagttggaaatggtatagtaataaacttaacattctttaaaccagtaccatggata
ctgacggcaccagaaatttcttcttcatctagcacaccaatgacctcgtcatcctcaact
tctactacaacaacttccacctctagtccttactgggga
>SSO0335 Conserved hypothetical protein
ttgggtaaaaactttttaaataagtttcaactttcttctcgatccaaaatggcagacatg
aaaactattgcattctctatagtagcagtagttttaattgtaatagcagctataggtttt
tatgaatattcagtagcaaactcgagatacactagcgcatataatgagtatcagagtgta
gatagtcaatacatggcattgcaaggaaattatactaaattaaatcaaacatattcacaa
ctagcttcccaatacaaactactagaaggcatgtataatgcagtattaacagaagctaag
aataattacaccttatacaggcaagcggaaacaaactatacttattataagaccttatat
gaacagatgttacagcaaataagcaaattaaacgtttcgggatataaacctggcgcagct
ctatctgcagtattacagttctatgacggcatagcgatagaatctccctcagatgttgtt
cctttgttagcatctaactttactgcgtatataatgggacagccatttgccggaacatat
aacttaaccacatttaatacaacttggctagctaacttcttcggaacttatgagacagta
tacttctacaccacagcattacctactgtaacacaaattaatggaaatacgttcaatgta
actgacgttgtacaatactttgtagcacctaccgctgatccagtatatttacaagtattt
aatgctagcaatactataatagtacaatacattcacggagttccggaaattactgaatta
atatggaaaggaaacgaggtacctccatcagctgtaattacaggatatccatctcaacac
ttaatacaagcaaatcaagtgcttgatgaattcttgtcacagatgaacgcattaggagca
gaatttccaggcagtacaatagcacaaaattttgctccaaatgcacaattagtgttaatt
ggacaattactccggtatttaaagcgggaacttatactggagtttctagta
>SSO0337 Conserved hypothetical protein
ttgattgaaatgttaggaataaaaataccactaaggaaaaccaccatactaccagtatta
agctttacattatcttcctacttccttactaatttcattttttatctacaatatacagat
tatacgggcttagtggagtttttattaataggtgccccatttataggaagagcgataact
ccaataacatatccttttctgatgtcaagaataaatattgagagaataacttatctctca
ttaggaaatatggctattttggatatattagaattctttatgggaacagacacccttgca
ctaattctattaagagttgcaactggaattctattcggcctggctacatcagcagcagta
gaacttgcaactcagagtaggagcaaaataattatgggaatgacaatgggtggatgggca
ttaggatggatactatccgcactcatgtcatttctaatgggaaaaatggtacttataaca
agctctttttcattagtatttttcttgctaatcaagagatctaatattgataagaaatta
ttctctaattctggaagtataagtatagcgttctcgtggaaagcattgttaatattttta
ctaggatttgagccagcatatatattacagctaattccttccctattaggagagaataat
gcaatagaagaaacgataatcgcgtattctatttcatttatagcgtatataattctacca
agtatcggaaacattagaatttcatcattactgacttctctgatgatcggaattttggga
tttacatcatttattacgcttaaagcatggatgttcataccttttacagtactgggattg
ggtcttaattcattgttgcctattataattaaattaatgaaagttgaagtaacaaaaata
gggcctagtatgaacctagcctcattaagtggatttctaataccttctttagttagtatt
ggagatatagaaataaactcagcaatattaactctaatatcctcaatttcacttggagca
atagtatacaaaaatcttaagattacagcc
>SSO0340 Conserved hypothetical protein
atgtatttcacagatgtttttagggaggcttatttggattataaatattttttaaataga
gactattctagaaaggttgtccttgatataatagctgctaaatacaacttatctagctta
gaacgactcttattatatcgctgcgtacattccgataaggaaatagaaataattaaagga
aaaataaacaacgaagaaagagaagttgtattggacggatataatttagctttaacacta
atttctgcgataaataatgacgagttatatctatgtgatgatggattccttagagatcta
ggtttaggaagacacaaatctagtgagataatatccgatacattgatactaatttctgaa
tattgtgagaaatatagaataaaatgtgaaataatacttgataaacagttaagtaaaagt
ggcgaaataacaagtaaattaaggaaaaaaggaatagaaataagaactgttaacaaggct
gataaagagataataatttcaaataaagctgtttatagtaacgatttcgtaattctgttc
aaatcacaaaaaatttctactatcttaaacacgatatttttcgaaagcacgtttaagata
cttaagggaccttggattgctaatcttgaagaaaaactt
>SSO0341 (alaS) Alanyl-tRNA synthetase (EC: 6.1.1.7)
atgaaagctagtgaagaggagtacaaactaaatttttttatcaaaaatgattttaagcga
aaaatatgcaaatcatgccaaacaccattttggaccaaggacgataaaaaagaatattgt
tcagatataccttgtactgattattatttttttgacataaatataaaaagccaaccatta
acagttaaggaagccagggagaaattcctttcattctttgagaagagaggacatacaagg
atacctcctaaaccagttttggctagatggagagaggacttatacttaacaatagcgagc
attgttgactttcagccccatgtgactagcggcttagttcctccacccgcaaatccccta
gtggtttcacaaccttcaataagattagaagatatagataatgtgggagtaacgtttgga
aggcatttaactacgttcgaaatggccgcacatcatgccttcaactatccagatcgttat
gtgtattggaaggacgaaacgacagcatatgccacagaattcttcacaaaggagttagga
ataccagaagaggaattaaacttcaaagagtcgtggtgggaaggaggaggaaacgccgga
ccttgcctagaagttacagtaggtggattagagttagcaacattagtatttatgcaatat
aagataactgataatggtgattacattccactgaaattaaaaattgtagataccgggtat
ggtgtggaaaggattgcatgggtaacacaaaagactccctctgcatttcatgcgatatat
ggtaatttagtatacaaattctttgacaaaataggagtagcttacatagatgagacacta
ctaaaagtagcatctagatttgctggtaagatagacccagataacccagatactataaaa
attcatagacaaatggttagcaaggaattaggaattgatatcaagaatgttgaagaagaa
ttagatagggcagctaaggtatttcagatcttagaccatacgaaaacaataatgctaatg
ctagctgatggtctagttccttccaactctggtgaaggatatcttggcagactcgttata
agaagagccttaaaagtactaagattactcaaatcggatgtaagactgtatgaactagta
aaagagcaaataggcttctggaaagaagattttccgcaagtattaaagaataaagattac
atattagacgcagtggaactagaacaacagagatttgagaagattttggaaaaagttcca
tctatagcctcaactttagctagaaagagcgaaattacaacagaagacttaatacaagtt
tacgattctaatggcgttcccccggatctactagaagaggaactaaagaaaaagagagta
aaatttgaactaccgcgtaacttttacgcattagtagctaagagacaccaaacctcaaca
atcaaaaacgtatatgataaggttaagttgcccaaggatttattagaatatattactaca
ctacaaccaactgaaaaattatactataaagaccagtatatgagatcttttgaaggaaaa
gtgttgggaatctataagaactacttgattttagataagaccacattttatccagaggga
ggaggccaattaggtgatactggcctcataattgatgaaaaaagtagtaaaagatatgaa
gttgtagatacgcagaaagtaaacgatgtgataatacatgtactaaaggaggagccatca
acaataaaggttggagataatgtaagaggggaaattaattgggaaagaaggtatcgttta
atgagacatcacacagtaacacacgtaatacttgcagccgctaaaaaagtattaggtgac
catatatggcaagctggagctgaaaaaacgccagaaaagggaagactagatattactcat
cataaagctttaactgaggaagaagttaagctaatagagaattacgcaaatagtgtaata
tcagatagaagaccagttaaacctttagaaatgaacagaatggaagctgaaatgaaatat
ggagtatcgatatatgagggtggagtacctaattctgcaacaatcagattattggagata
aaggactgggatatagagagttgtggaggaactcatgtaagtaatactagtgagatagga
gccgtgaaaataattaacgtggagagaatacaagatggtataataagacttgaatatgtt
gcgggaccagcgttagttgactatattagggaaactgaagcaaaaattgctgaagcttcg
aaaataataggtacttctccagatcaactacctagcagattgagaagaatacttaatgaa
gttgagaaaaaaaataatttaataatccaatatagaagaatagttgaaactgaattgcta
aatagtctgaagccttacgaaattaacggtaataaaatatatatcatagagggattaaat
gacgaggaggaaaacaaggagatactaagaaaattaacttccacagataatactattgca
atatccatctctgataatagattacaaattgccacgtctaaaaatatgagagtagataag
atagtagaagaattactaaagggaggaggaaaaggaggaggaaaaggtacatttgcaaac
gtaattctaagtagtaaaaagagtaaagaagaaataatagatatagtaagaaaatcgcta
>SSO0342 (rpl12AB) LSU ribosomal protein L12AB
atggagtacatatatgcgagtctcctattacattcagctaagaaggaaataagtgaagat
gctctaaagaatgtactaactgcagctggtataagtgtagatgaggtaagattaaaagcc
gtagtagctgcattaaaagaagtaaatattgatgaagtactaaagaatgctgcagctatg
ccggtagcagtagctgcacaaccacaagcaactcaagcacaacctgctgcagaagagaag
aaagaagaaaagaaagaagaagaaaagaaaggaccaagcgaagaagaaattgcaagcggg
ttagcctcactattcggc
>SSO0344 (rplp0) LSU acidic ribosomal protein P0 homolog
gtgaaaagattggctctagccttgaaacagagaaaagttgccagttggaagcttgaagaa
gtcaaggaattaactgaacttattaaaaacagcaatactatactaattggaaatcttgaa
ggtttccctgcagataaattacatgaaattaggaagaaattaagaggaaaagccacaata
aaagtaactaaaaatactttattcaagatagctgccaaaaatgctggtatagatatagaa
aagcttgagcaatatttaactggtccaaacgttttcatattcactaaagataatccattc
ataactaacatgttctttgaaaattataaattaagaaggtacgccatgccaggcgataag
gctgaagaagaagttgtaattccagctggagatactgggatgcctgcaggaccaatatta
agcgtatttggaaagctaaaggtacaaactaaggtacaagatggtaaggtacacgtagta
aaagatacagtagtagcgaaacctggtgatgtaatccctgcagaggccttaccaatttta
cagaaacttggaataatgccagtatatgtaaaattaaagataaaagtagcgtatcatgaa
ggtttagtaattcccgctgaaagtctaaaacttgatttagaaggttataggagtaatata
actgaagcttataggaacgcattcactcttgcagtagagatagcgtatccaactccagat
gtattaaagtttacaattagtaaggtatttaagaatgcgatcgcactagcatctgagata
ggctacattacaccagaatcagcccaagcggtaatatctaaagctgtagctaaagcatat
gcattagctaccgcgatcggcggaaaagtagatttaggagtacagttacctacagtacaa
cagagccagagccaacaacctgctgcagaagagaagaaagaagaaaagaaagaagaagaa
aagaaaggaccaagcgaagaagaaattgcaagcggacttgcatccttatttgga
>SSO0345 (rpl1AB) LSU ribosomal protein L1AB
atgcaaattgttgatagaagtaatcttgaagcttctcttaagctagcactatctcccgaa
aacaaccctaagagaaactttgtccaaagcgtagagataatagttacgtttaaagaagta
gacatgaaaaagggagacttaaaattaagagaaatagtagtattgcctaagcctccggaa
aaaacaaagaaagttttagtagtcccaactattcagcaactagagtacgcaaagaaagcc
gaacctaacaccattttaaccaaagaagaattacaaaaacttcaagggaacaagagggca
attaaaaaaatagctcgtcaaaatgattggtttctgatagccccagactcaatggcttta
gtaggtagaatattaggtccagctttaggtccaagagggaaattcccgactccattgcca
aatactgcagacatctcagaatatatactacgatttaagagatcaacattagttaagacg
aaagatcaaccacaaacacaagtatttataggcactgaaagccagcaaattgcagactta
gctgaaaacgcactagcagtactaaacgtaatagaatctaaagggtacgcccaaaaggta
aggaatatatatgtaaaaactactatgggtaaggtagtaaaagtagagttaagg
>SSO0346 (rpl11AB) LSU ribosomal protein L11AB
gtgaataaggtgcccataaaaacaataaaaataatggtagaaggaggtaatgttaagcca
ggaccaccattagcgccaacactttcgcagttagggttaaatgtaggagaagttgtcaag
aaattaaatgaggctactagtagttttaaaggcatgtcagttccagttactatagaagtc
gatagtagtactaaaaaatatgagataaaagtcggaatacctactactactgcattatta
ttaaaggaagccggtgctagtgaaccatctggagatcccgcacataaaaagataggtaat
ttatcgttagaacaagtaattaaaatagcaattatgaaaaaaccggggttaactactaaa
tcgttaaaggctgcattaaaaagtatgctaggtacagctaagtctatcggactaacagtg
gataatagagaccctaaagaactagtaaaggaagtggaagaaggtaaatacgatgattta
ttagcaaaatatgagaatgaatggaatggggtgaaagag
>SSO0347 (nusG) Transcription termination antitermination factor
ttggggtgtaattttgtggaaaaaccgaatatgagaaactattatgctataaaggtggtt
ggagggcaagaaataaatgtagctttaatgctggaagaaagaataaaaactaataatatt
aaaggaatatacgcaataattgttccacccaatttaaaaggatatgtagttctagaggca
gagggtttacatatagttaaaccattaattgctgggataaggaatgcaagaggtcttgca
caaggtttactacctagagatgaaatattaaagattgtatctagaaaaactgtaggtcct
actgtaaaacctggtgatgtagtagaagtaatttctggtccctttaggggtactcaagct
caagtgataagggttgaggaagctaaaggagaggtagtgttaaatattttagaatcagca
tttccattacaagtcacagttcctctagatcaaattaaggtctcaaagagg
>SSO0348 (srpR) Signal recognition particle protein (docking protein)
ttgagatatcagctactggaaagtgacgtttcttttgaagttactgagaaaattcttgaa
gatctgaaagaaaacataatcggcaaaaaggtaaaacgaagcgatgatcttgaaagaata
gtaaaggattctctgaaaaaatctatcactgagataataacaaagaataatgccataaat
gtattagaagaaataaaaaaatcaccaaaaccttatataataatatttttcggaataaac
ggagtaggtaaaactacaactattgcgaaatttgcatatatgcttaaaaaaaatggctta
tcgtgtattatttcagcttcagatacgtttagagcagcagcgcaagaacagttggaagtt
cattcaagaaacttagagatacctttaattaaaggtagatatggaggtgaccctgcctca
gttgcttttgatgcaatacgtgcagctaaaagtaggggtatagatgtagtcttaatagat
actgctggaagaatgcatactgacactgatttagtgaatgagctaaagagagttgttaat
attgcaaagccaaatctaaaaatattagttttagactccctaggtggaaacgatgcatta
gagcaagctaaatacttcgaaaataatgttggattcgatctagtaatattaactaaagtc
gatgcagatgtaaaaggcggtgtaatattatcgttagcttatgaattaaataagcctgtt
ggatatttaggaataggtcaggcttatgatgatctaattccatttaatgccgaatggttc
attcagagattattcagt
>SSO0349 Conserved hypothetical protein
atgagtcaaggacaaggaggtataacattagacgaattaatagcacaagcagattaccta
aaaaggtacatagattcattgcagagaactcaactagaattgctagagtcgataaactca
atagactctgcaaaacaagcgatagagacgatgaagagtggaaataaagaaatgttagtc
ttcattgatagaaaaggatatcttttagcaaaagtagggggtataataggagataaggta
actgttcatttaggtttatcttattatgcagaagtggacctagactcagctataaagatt
cttgataagagaaaggatgagataagtaaggcagcccaagatctaaataatgaacttcaa
aaagctgctagtacatataatcagatagttgacatactaaatcaaatacagcaagcagct
gccaggagacaacaaggtgaa
>SSO0351 (eiF6) Translation initiation factor 6 (eiF 6)
atgaatctgcaaaggttatcagtttttggaacagataatataggagtctatatttatact
aataataaatatacaatcatacctagaggattagatagcgaaacaaaagaaaatattgcc
caagtattaggaacggagttattagaagcagaaatatccagaagttttcttttaggtatt
ttcataagcggtaacgataacggaattcttttacctaagtctacaattgatgatgaattc
agatttctgaaggagaatctaagggattgcagagttgagattcttaattcaaaagttact
gcactaggaaatacaatactggcaaataataaggccgcgttaatctaccctgaatttaat
gatattgaagagaagataataaaggagaccttaggtgttgaagatataaaaagagggaaa
atagctcaaatgataaccgtaggttctgtaggagttataacaaataagggtggactagta
catgttgatacaagtgagaaagaattaaaagaattggaaaaattgttcggagttaagata
gatattggcacggtaaattttggaagtgtatttatcaaaagtgggctagtcgcaaacgat
aaaggaacgttagtaggcgcgtcaactacgggtccagagattttaagaattcaaaaagca
ttaggtgaa
>SSO0352 (pdcd5) Apoptosis-related Tfar19 related protein
atgtcaactccaaactcatatgatgatgaagaattagaagaattattaagaagaaaagct
gcacaagagcaaaaaagaatagaagaagagagaaagagaaaagcagaattagaatcccaa
aaagagtcaatcttaagagtaatattaacacctgaggcacgacagaggctaacaaatata
aaattagttaagcctgaatttgccgaatcgctggaaaatcaattaattgcactagcacaa
tctggaagaataaagataccaataacagatgaggaattaaagcaaatattggaacagatt
tcacaacagaacagacgtgatttcaaaatacaaataagagagagaggatggaaa
>SSO0353 (rps19E) SSU ribosomal protein S19E
ttgagtcttataatgataacagctgaaatggtacctccagatcttttgataaaacggtta
gcaatatatctaaaggagaatgtgaaaactgtagatccaccagagtgggcactattagct
aaaacagctagctttaaggaaagagtaccagataacgcagaggattggtggtatataaga
gccgcatcattactaagaaaactttacgttaactcaattattggaatagaaaaaacaaga
acaatttacggtggaagaaaaagaagggggactagaccagaaaaatttgtaaaagctcct
ggtcatgtaaatagattaatatttcaacaattagaaaaagctgggctagtccaaaaaatt
aagaataagggaagatctttaagtcctaaaggaaggtcattattagataaattagcgttg
gaaatctttaaagagctggctgagaataatacttctttgaaggtatacttggaa
>SSO0354 Nicotinic acid phosphoribosyltransferase, putative
atggagttttatatagccgattttaagcagattaaggagggtaaagtcacagatatttat
tttgaaagaacattaaagacactagaatatcttgggattaaagacgctaaagtaaggatg
gaagtacattcttacggtttacctaaaggttatgaatgggctctttttactggtttagaa
gaagttcttcatttgttggaaggagtgccagtgaacgtttatgcgatgccagaaggtacc
ttatttaaagaaatagaaccggtaatgataatagaaggcaactatttagattttggtatt
tacgagactgccttcctaggaatattgaggcattattctagcatatctactaaggcagcc
agacttaaatttcttgcaatggataaaacattatttttctttggcttaagatctcttcat
cctgcactagcccctatggcagatagggcagcttatataggcggcatggatggagtttct
ggtgccatgagtaaggaatatctaggagttgacccttcaggtactatgcctcatgcacta
atgcttattgtaggtgataacgtgaaagcctggaaggcttttgacgaggctatgggatct
gaagttcctagaataaccttagttgatacatttgaggacgaaagaactgaagccttaaag
gctgcaactttacttggtaagaaattatatggtataaggttagatacgccgtcaagtaga
agagggaattttagaaaaattattcaggaggttaaatggacgttaaagatacacggttat
gatcatgttaagatatttgcaagcggagggatagatgaggacgatataattaaccttcga
gatattgttgacggatttgggattggaacgagtatagcatttcctccaagtgttgatttc
agtgctgatatagtggaaaaatttgttgatggtaaatgggtgccttttacaaagagaggc
aaatggcccggggctaagcaagtatatagatgtggaaagctaaatgatgtaattaccctt
atggaccaagaacatccttcttcagattgtaagcctctactgcaaaaatatatggaaaat
ggaaagattataaaacctttaccttctccaaaagaaataagggaatacgtgattaaacag
ttaactgaattgcagagtagc
>SSO0356 Phosphate regulatory protein, putative
atggaagttaggagagttcaaaagttcggcaaatctacacttatggtttcgctacctgca
gaatgggtaaaagaagtctctttaagtccaggcgaaagtgtatatctagaagttgatgag
gatggtagtctaaaagtatatccaccgaatctaaaggcagaaagtaaagtaaaagagatg
aaaataagtatacaaaacgatagtgttcaaggtgaattagtaagcagagtaatatactca
ttatacatcctaggctacgataggatagatattgaaagtaaaagcggtatctttactgag
gatatactgaggaaagttaaagatacaataaggaatctgattggattagagatcgtatcg
cagacaacagatacaatccaaatacaatcttttcttgatcctacaaagtatactatgaat
aatctaattaatagattatcaaattcaataaaacaaatgcttcactacctagatctcgga
ataaaagaatcaagtagaactttcttacaagaagtaatagaattagaaagggaagtagat
agactatattatctagctttaaggcaattactattagctcaaatgaataggagcttagcc
tatatgataggtgttaaaagaatacaaatagtgggaaatagaattttaataaaggcaata
gaggaagctgccgatgagataagtgagatagcattagatctattatctttacatccatca
gatcttgaggaaatgaagagattatggaataagataaatatgtatatagaacaaacttct
tctgtaattgaccacgcggtaaaagtgctagcgaaagaggataccatactaataaatgaa
gtgatggaagaattaagaacactaagaagagtattgataactgaggctataatctcagaa
gaaatgcttaaagaggtcaaatctcccagcctaatagctgtattgcgagcgcttaactta
aggttatataacgcaataagaagaatggagccaataaccgaaatagcatttaacagaagc
atagagaatcaaaaagaaattataataacaggc
>SSO0358 Conserved hypothetical protein
atgatgataagagcgataacaattttcgttaccaactactcaaaaattagtgattatacg
gaaaaactaagtaaattaaatgataacaatatatggagtaaaaggatctcattaccacct
acacctattgatttaagcttaagtaaactaatagaattattacctacaacgcatagtgaa
attatatttagtctaataaatctccaagagaaagataagagattaagagaaatcaaggat
atattgaaatctgataaaagaatttacgtccatgtattagtaaagacaacagataatctg
aaagatctagcaaaacttatcattagtctggagccagaggaggcttctaggtttgcctta
ttatttaaccaagattttctattaaccccctattttccaacttcctccgcaaatacagtc
tatgattcttttggaatatctttactatatgtagacgaatttaaacaaggaaagataaat
gaagccttatcaaaggcagatacaatagggagacaattagagaaaaaattaaatataaag
tacttaggaatagatgcgtcattatcgccatggatggaaagtagtgtgggagaaattgta
gaaagtagaagtaagaaaatgtttgatatctcaaatttatcagcagtagctgaaataaat
agggagatatttgagggagtttggagaaatagagtaaatcctatcggtttttcagaatta
atgttgccaattgcagaggacaatcttttaagggagagagttaaggagggtagcctaact
ttaaaggatttattactaatgagctatgtttgtgtcgcaggcattgacatggttggtata
tattcagatttagttacatatgagaatatattgaaatcagtttattatattcagtataca
aaacgaaaaccatacggtgtaaggatgataccaactaatggaagcccagtattaactaag
atgtttggagaaatacccgaggtaaaagtagta
>SSO0359 Hypothetical protein
atgagtaagattactatcttacttgcagataataatatagataaactgtatcatggtctg
gtggtagctttaggcgcaaaagcgttaggttgggatgttaagtttttcgtgacatcgcaa
gcagtagttcttttcacaaaggcaaagaagggaaaagggaaattaggtttaccttttttt
gccagattttttgttaggcttcaaatgaagaggttaaatattccaaatcctgaaaaatta
attgatgacgcaataaatcaaggtgttgaattttttgtagatgaggctggtttaaggctt
gtaaacgctagaagtgaagatttattagaaaatgttaaattatcaggaactataacgttt
atattggaagcaaaggaatcagatgtggtgattacgcta
>SSO0360 (cysM) Cysteine synthase B (EC: 4.2.99.8)
gtgtcaaatcctcttcacgtattctcaaatgagcaagagttactagaaggtatgtggcct
actccactactaaaacttaggataggaaatgacacatgggctaaactagaattttataat
ccttttagcagaagtgtaaaagataggacagcgtggttcttatttaggcaagcattacta
aagaatgcaactcatatagttgaagccacctctggcaatactggaatagcattagcgtcg
ctatcttcaattttcggtatgcgattcacaatgtttcttcccgtagttgctccaaaggtg
tataaggtttttgtaaagttattaggaggtaatgttatagaggctggtaattcgaccaat
gatgtaatacccttagtaaagaagtttgcagagatgactaatgcgctcaatttggatcag
ttcaataatccaatcaacgtaatagctcactatgagactaccgcaagagaaattgatgaa
cagttaagttctattgggaagaagccttcacgtattatagctaccatgggaactgggggt
catatagcggggattgctaagtattttaaagagaaatatggaaatgatgtagaaataata
ggagttcaaccctcagaaaattccagaattcctggaataaagagacaaaatggctctaat
tctttactaagggacgtgaagatagatagagtagttgacgtaagtttggaagaagcaatc
gatgggactattagtgtagcaaggacttccgggattttaataggtataagtgcaggtgct
actgtggcagcctataagaagataagtgatgtttcctccactacagtgcttatatttcca
gatgatgcttttaagtatgttgatattttagagcaaactttaaaagagata
>SSO0361 Hypothetical protein
atgtttaaaaattcatacagtcagtcaagaatcataaagaaggataacaacatatatgtg
caaaaatgttatatgacaatctttggaataaagtggtattttatctctactttcttttgg
aattatccctatgtggctgatcctaaggaaagattcgttagagaactggattttttcttg
gataatgcgtggaaagatacagttgttgtacctaaactaatcgatattgatgcaaaagaa
ctttgcattactagagagtttatagaaggggatgaaataaatgaggaaaatatagagatc
atggctaagggcctaagggaaattcatgaggttggatatgtgctaggtgatactaaaata
agtaactttgttatagtagataaaagtaagttagctgttatagatgctgagcaatctttt
aaatctaacaatttatattatagagcttgggatttactagtatttttcctatttttaagt
tacaaaatggttaatataagtcatttccaagaggtagctaaaagatttctagacgaatat
atgccagataagaatattgtgaaagaattctttgatatgaagaatataaatctaatggga
ttatatccccccactcatttatatgtactaaaaaacttaatgagtaatttttat
>SSO0362 (moaA) Molybdenum cofactor biosynthesis protein A
atgattgatagatttggtagaccattagaagatcttagaataacgttaacacacgcatgt
aactttgaatgtttcttctgccatatggagggagaagaaggagataattatcttttaagt
aaagaggatattttattagttgctaaagttgctaggaaatttggtataaactctgtaaaa
ttaactggaggagaaccgacattacgacgagatttagttgaaatagttcgagggcttaag
caattagggtatgaagacgtttctatgacaactaatggttttctcctaaaagatttagct
cacaaattaaagctagctgggcttgataggattaatatcagccttcatgctgtttcaagg
gatacatttaagaaaattacgggtgtagatgcttttgatagagtaattgaagggataaaa
agtgccatagatgtgggtttagtaccagttaagttaaattttgttgtaaataggagaaat
cgtgaagaagccttcaagttcattgagctatcccaaaatttaggtgtaaatgagatacac
cttatagaactgcatccggtagggttaggaaaattagcttttaaggaacatgatgattta
agagaaatagaagaatatattgagaaaatatctattaaaaaactaattaggaaaaagcat
tttagaccacgttatgttttaccctctggattaatagtcgaagtagttaagccctatgcg
aatccgatattctgtgctggatgtaacaggatcagattatctgttgatggaaagttaaag
acgtgtttatacagagaagataacgtaatagatgtattagatatattgaaaggtgaatat
tccgaagatgttaaagaagaattattaggaagagcctttatgatagcaatagctattaga
gagcctaacttcaaatataaaata
>SSO0363 (pepQ) Prolidase (Xaa-Pro dipeptidase) (EC: 3.4.13.9)
atgaataggttaagaaagcttaaggcaatcctagaagataagaaagatagttgtgccata
atatttggttctccaaatttattctacttcttagaatattctggggcaggagcgttaatt
tattgtgattcacgctttaccttacttgtccctgccctagagatgtatagagcagagaat
gtgaaagatgtcgatattgcaatttattatccatctaaaatcttggagaatgtcattgaa
ggtaatatatttagggctattgaaaaaattgttaataagagcaacataatgctagacgta
agctgggttgaggcaagtacgtataaggcgttatcagaaaagtataaggtaattgatttt
tctaatgagatagtaaggttaagagaagttaaggataacgatgagatagaaagaataaga
aaagctggtgaaattactgctgttgcaatgaaaattggtatggagaaattgagcgaagga
acttctaacgaaaaacaagtagcgggtattatagatatgactatgagatctatgggtgct
gaagattatgctttcccatcaatagtggcatttggagagaattcagcgtatccacatcac
attcctacagatcgtgtattaggaaataatgatattgtactatttgatataggtgcgaaa
tataatggttactgctttgatagcaccagaacttttgtatttaagaatagtgaagcaaag
aaagtttatgaagtagttttggaagcacaaatggaggctatagatgccgttagggatgga
gtaatggcttctgaagtagatattactgctaggagagttatagaaaaagctggttatggt
aaatattttatacactctactggacatggagttggagtagaaattcatgaaagccctgca
gtttccatgaattccaagcagatattgaaggaaaatatgattattaccgtagaacctgga
atatatctgaaaggcaggttcggtatacgtatagaagatacccttattgtaactaaagga
aagcccatcgtgctagaaactgcttataaactgttg
>SSO0364 (folE) GTP cyclohydrolase I (EC: 3.5.4.16)
atgcaaaagacagaattagacgaccaaaaattagtagaagaaatagctagaaggattaga
gaaattctagaactactgggtgagaatccggagagagaagggcttaaagagacgcctgaa
agagtagcaaaggctttattagaaatgacctcagggttgagaacaccgcctcctcaaata
aaggttttcaatttaggcgacgatggtgaagtatacgaaaagaatcaaatagtactaata
aaagacgttaacttttcgtcattgtgtgagcatcacatgttgccaattatcggaaaaatt
catgtagcgtatattgttagtaatagcggtaaggtagctggttttagcaaaataattaga
attgtgaattactattcttcacgtctccaaatccaagagagattagtagaacaaatagct
gatgcgataatgaatagcgaaataaagcctaaaggtgtcatggtgatcgggaacgcaata
catatgtgttcatatgtcaggggagtaaaggataaagaggctaagttagtttcagtagct
tacagaggactgtttaagactaatagggctttacaaaatcatgtatttaggctactcgat
aatgcaaataaggtaaacttatta
>SSO0365 Conserved hypothetical protein
ttgttaatgggcagtaaagataaagttatatctatattgaaggaaaaaggtcctatatcc
caaactgaattaagtaaactttctggattatcgaagagcagattatctgaagtcttatcc
gaacttgagaaacaaggtatagtaaaaaggaggaaggttttaggaaaaaaccttgaggta
agtttatctcaagatagatttttgagattgggaattataagagctgcagaatatccattt
ataattccatttattaaaaacttggaaaatagaggatatagcgttactgttaaaatttat
gaaaatggaattgatctaactagggatttagttgaagcaaagttagatttaggcctatcc
ccgatcataacgcaaataatattttcgacgatatatcggaatataagaattattggggga
ggcgctaaagggggaggtggtattataggcaaaacttgtaacagaattgcatcaactgta
atgtcaagtatggaaatatgggcgtttagtgaattcaagaatattgaaatcattccatct
tatagttcatatgaaatgttagactttcttgaaaaagggatagtagatggtatagcaatt
tgggaaccttttttgtcaattttagagaggaagggacataaggtacatagatttacacca
ttacactgttgtactttagcagtaagggaaactatggattgggagagaataaagaatatt
tatgaagaatcgtttagctggtttaaatcttccatagatagatgggtttcaagttattca
aacttacttaatattgattataatattctaaaagaagcatcaaaaaattatgaattcgat
tattacctcgaccttaaggagttcaaaaactcattaaaaaatactggtatttttatacca
att
>SSO0366 (glnA-1) Glutamine synthetase (glutamate ammonia ligase) (GS). (EC: 6.3.1.2)
atgccaagtacagcagaagatgtactcaaattcctaaaggaaaataacataaaatgggta
gatctacaattcacagatgttcccggtaggctgcatcatattacaatacctgctgacgag
tttgatttagaatccttaaagacgggtttcggaaaattagacggaagcagtataagagga
tttacgagcatttatgaaagtgatatggtactcttaccagtaccagagactatgacacta
attccttggtctccaggagtagctagagtcttatgcaaagttttttggggagggggaaag
ggaagatttgaaagagatcctagattcatagccgaggaagccgagaaataccagacagaa
caaggctacacttcctactatggtccagaattggaattcttcatgtttgataaggtaaaa
ttagacgtaagtgccccacagtctggaactgggtacaaaatttatgcaagggaggctccg
tggagcgatagtggaacctttgtaataagatttaaagagggatattaccctgcaccacca
gttgatcagctaatggatgtaagagtagagatagtcgatactttagttaagtactttgga
tacaccatagaggctacacatcatgaagttgcaactgcaggtcaaggggaaatagatttc
agattctctactcttgtagatactgcagacaaggtccaaactttgaagtatgtagctaaa
aatattgccgctaaacacggattagtagtaactttcatgccaaaacctatttatggtgat
aatggaactggtatgcacacgcacctcagtttatggactaaagatggaaagaagaattta
atgtatgatcctaatgacgaatatgcagagataagccaatttggaagatatgtaatagga
ggtcttttaacacacgctagggctttatctgcaatagtctcacctactgtaaacagttat
agaaggttaataccagggtttgaagctccagtttacattgcgtggagtaagggaaacaga
agtgccgtaattagagtgccagcatactatagaggaatggaaaaggcaaaaagaatagag
tatagacctccagatccatccactaatccgtatctagcatttgctgctttactaatggct
gcattagatggtgtaaataagaaaatagatccaggagatccagtggatgagaatatatac
catctaactccagagaagagaagacaattgggaataaaagaactacctagatcattaaat
gaagctttagatgagttagaaagtgataaagagttcttgaagccagtatttaattcgtca
atattagatacttacatagatttaaagagagatgaggcaagaagcttgcaaggttatcca
cacccaatggagttatactattatttagattcc
>SSO0367 ABC transporter, ATP binding protein
atgattgaggtatatgtaaaaaagaaattacaagcttttttgctaaatgttaatttttct
gaaaaaggtataattgcaattaccggtaaaaatggtagtgggaaaagtacattattaaac
gttattgccggaattttaaaaccagatgaagggtacattagattaaatgacatagatatc
acaaatttacctataaacaagagaaatgttatattagtaactccagatagttacattccc
acattagacttaaagaaacatctaacatggggagctaaactaagaggaagaaaagtaaat
gataaagaagtaatggaggtggctaaattactcggagttccgaatgagaacaaaaaagta
ggtaatttaagtttaggaaatagggagaaagtatcattagccacagctattttaacaaaa
cctaacctaattttagttgatgaggggttcagtaatatctcagaaaaggaatattttatt
aatatctataccgatctatgtaaaaagaatcaaatagatctaatttacgttactcaagat
actgaagatgctaaattttctgatcaccattacgtgatgaataatggctctctacataaa
gttttc
>SSO0368 (trxA-1) Thioredoxin
ttgagcgaaattgactcattaattaaggaggttgctgaaagattacaaaagaaggctgag
gaatatggtaaaaagaaggaggatgttacattagtcttaactgaagagaacttcgatgag
gtaattagaaataataagttagttctagttgattgttgggctgaatggtgtgctccatgc
cacctctatgaaccaatttataaaaaagttgctgagaaatataaaggtaaagcagttttt
ggaagactaaacgttgatgaaaatcaaaaaattgcggataagtatagcgtacttaatata
cctactacattaattttcgtcaatggtcagttggttgattccttagttggagctgttgat
gaagatactttagagagtactgtaaataaatacttgaaa
>SSO0369 (fadD-1) Long-chain-fatty-acid--CoA ligase (EC: 6.2.1.3)
gtgagtcttgcaacattactctataaatggtttaaagaaacgccttcaaaaaccttttta
attgacaaaaatcagtcacttacctatgaacaagttacgagagaagtagtatatgtagct
tccaacatctcacctggagatactgtagtccatataatgttaaactctctgcagtcagtg
attaattacttagcaatattttgggcaggcggtaaggcagttgcagttgacccgcaaact
tcagcagaagatttaaagttcatattggaggattcaaaccctgacctaatagtaaccgac
gaggagatatacaagagagagtacgatattctcaaatcgtaccaggtgatagtgaataag
agaggaaaagacgtttttacaaaaccttatgagtacagagaggatgaggtcggcttagtt
tactattatgctggaatagtaggaaggacaatgcaagtactgcatagcgctaacagagtt
gaactcaattctgcgacgctctacaattctattggccttaaagagattaggggaatacta
acagttcctttagctcacgtcttaggaaatagcgtgttaggtattaccttggaagctggt
ggcaagttatatattatgagtaagtttaacgtcgatgaggctattgaaagtataaacaaa
tataacataaattatctatcaactgtcccaactgtttacgattacttaaataacgaggaa
aaaaggaaagtagatagtttagaactgtgtgtaagttctgctgcaccactgtatccatcg
accgtaaatacatttaagagtaaatacggaaaggatattgttcaacaatacggctttact
gagggtttaattctaactttccaacccaaagagctatctggagtaatttcgataggaaaa
cctttgcctggcgttgagataaagatagtagatgataagggcaatgagaataatgaggga
gaattgtgggttaaggctccttggctcatgctaggatataaagatagagaggagacggcc
agagtatttaatgaggggtggctaagaacaggtgatttagttaagattgatgaaaagggc
ttattgtattttagaggagtcaaaaagaggatgttgaaatttaagggctacccgatattt
ccaagagatttagaagagatcttaaagactcatccaatggttgaagacgtaaaagttata
ggggaagatgctggaaatctaggacagcaacccgttgccttagttaaggtaaaggagcac
aaagccggaattgaggatgaattacttaattatgtaaattctagggtagctttttataag
agattgaagaaagtttatgtggtagataggattgagcgaaat
>SSO0370 Conserved hypothetical protein
atgataaagatcgtcggattatcacgaattcatattaccttgtttgatcttgagggaaaa
tatggtagactcgacggtggggcaggagttgccttgaaataccctaggatagtagttagg
agtggcaattgttttaagcctgaagtctccttgccttttgatgtccctaaaatatgtata
gaggaagactttgaacaacatataggacttggtcacactacacaatatttgttatcagtg
gctaagctagctgctgaatataattttaagaggcttaactcatatgaactagccaaattg
gtaaaaagaggtgggacatccggtgtcggtgtttacgccttcgagtatggaggttttata
gtagatggaggccattccactaaagtaaaaagggaattattaccatcggatttctcttct
gctcctcctcccccactaatagctagactaaattttccttggtatatttacgttaatgtg
gttaggggcggtagaagagtattcggaaaagatgagattaacgcatttaaacaagctaag
ctagagggattagatactttggcgagagtagttttaatggagttaattccatcagttgca
gaaagagatttggaaggagcgttaaatgctatctcgttaatacaggatctaggatttaag
aaagttgaggtctttttgcaaactgatgaggtcaaaaaacttatgaatgatatggttaaa
gctgggtttcccgctggtctttcctccttcggtccagccgtctatacattcgttagctct
aaaagggagggtgatgagttaatttcaagatttggtggatttgtatctgaaccaaataat
gagggtgctaaggtattctggagtacgatgagttcg
>SSO0371 (sun-1) Sun (fmu) protein
ttgaatgccataaggaagccaaatcctagattatacattagggttaatactctaaagacc
tctgtagagaaaatactggaaaggcttccacattttaagccggacgaagatttcaaagag
gcaatttacgttgagataaaagggccaaatgaaattaacattcatgaaaataaggtaatt
gtagataagaaaactgcggaaagcgctatgttaggtgctaatgtttacaaaccgggttta
aagagtgttgtaattaataatgcaaaagataaaagggttacagtttatagcgataatgga
ataccagtagctgagggtaaatattatggcatgaatactaatttagtagttgaggttacg
aattccttatacacctcccctaaattagctgatctgccagagttgaagaatggattaata
tatgttcaaggtaaggcatcaatgtatgttgctcatttacttgatccacatcctaatgag
aaaatagtagatatgactgcatatgctggtgggaaattaactcatatttatcagttagag
cctagagttaagcttattggttttgatcatactgaaaagaaggtagagaaattaagggat
ttagcaaataaaatgggaatgagaatagaaatatataaggcggattcaaggtatctttac
gaggattataaaataggtgatgttgataaagtggtaattgatcctccatgttcagcgttg
gggataaggcctaaattatacgaccataaaactaaacaagatatactcaatttccataaa
taccagaagcaattcctaaattccgcttataagattttaaagaaaaatggtgtggtaatt
tattctacttgtactgtaactacatgggagaacgagaaggttataaatgatccaagattt
tcggtagaatatgagattagatttcatccccatattcacgaaattaccggttttttcata
gctaagctaataaagaaaggc
>SSO0372 Ferripyochelin binding protein
atgccaatagaagagtatttaggtaaaaccccaaaggtttctcagaaggcgtacatacat
cctacttcttacattataggtgatgtggaaataggggatctgacgagtatatggcattat
gttgtgattaggggagataatgacagtataagaattggcaaggaatctaatgtgcaagag
aatactacaatccacacagattacggatacccagttgaaattggcgataaagtcacaatt
ggtcataatgctgttattcatggtgccaaagtctcatctcacgttattgtaggaatgggg
gcaatattattaaatggatctcaagttaaggaatactcaattattggagctgggtctgta
gttactcaaggcactgttatccctccctatagtgtagcagttggagttcccgctaaagtt
atcaaaaagttaagagaagatgagattttgataatagatgagaacgctgaagaatattta
aagcatacgaggaggttattgaaatta
>SSO0373 (nirJ-like) Heme biosynthesisrelated protein (nirJ-like)
atgaataaggatttgaaagctataaaatggtttattacaacgcaaattcttaaagatcct
tttaatcccgcatatgcaacgtttaaggtaacatctagatgcaacttgagatgtacattc
tgttctccatcgtattattctggtgaattaggagagggaagtacggaaagggtgaaaaag
ataatagacaatttgagggattcgtcaatagttgtcttatcgtttgaaggtggagaacca
acttataggccagatattttagatcttttagagtacgcacacgatgggtccttttatatt
atgcttacaactaatggttataggcttaaggatgaagatttcctaactaaactggcagac
aagatagacttcttgcactattctatagacgaatatcattggaatgtgaaggaattagag
aatttatgtaggttcaggaaatatggccttaaggttaacgttcaaaccgtagttaccaga
tataatttatataaattggaggaaaaagttaggaaggttgctgaatgtggatacaagata
ctagcgatgcctgcagtagattatcccaattcaaaggtaaagttagctccagatccttac
gaattttataaagtactgtatgatctgaagcgaaaatatggttctacattaaataactca
tggggattcataaacgccataataggtaaagtccctaaaagggtagtaagttatgcaata
accatatatcctaatggcgacttgccttatccagacgatataaatggagaaatagttgga
aacgtagctgaagaacccctaaataaaattttacaatctagtaaagtgaaggaattacag
cagaaaatgctagaaaatcaagctaaatttgaatacttacatttgcaaactgcttcgttc
aataatattagagatctagcatcatatgttagtgaaatgttaaggtggcgttttactgga
agagct
>SSO0375 (xerC/D) XerC/D integrase-recombinase protein
gtgaagcttgatctaggctctccaccagaatccggagatctttataacgctttcataaac
gcattaattatcgcaggagctggaaatggaactataaagctttactctaccgcagtaagg
gactttctagactttataaacaaagatcctagaaaggttactagtgaagatctaaacaga
tggatttctagtctgttaaatagagagggtaaggttaaaggagacgaagtagaaaagaag
agagccaagagtgttaccattagatattatataattgcagtgagaagattccttaaatgg
attaacgtttctgtaaggccacctattcctaaagtaaggagaaaagaagttaaggctctg
gacgagattcagatccagaaagtacttaacgcatgtaagaggactaaggataaattaata
ataaggttactattagatactgggttacgtgcaaatgaattgttatcggtattagtaaag
gatatagatttggaaaataacatgattagagttaggaatactaagaatggagaggaaaga
atagttttctttactgatgagactaaactgctgttgagaaagtacataaagggaaagaaa
gctgaggacaaattattcgatttaaaatatgatactttatatagaaaattaaagagatta
ggtaagaaagttggaattgatttaagaccacatattttgagacacactttcgctacctta
tcactaaaaagaggaattaatgtaattacattacagaaattactaggacataaggatata
aaaacaactcaaatctacacacatttagtcctagacgatttaaggaatgaataccttaag
gcaatgtcaagctcttccagtaaaacgccacct
>SSO0376 Na(+)/H(+) antiporter
atggtatcattgcttctgatttccttgttatatctaggaataatgttgatagctgctaag
atatctgaggagatattcagaagaattggtttagtaacttttgttggccctatattaatg
ggcattctacttggaaacggtgtatttggagtcatacagattaatgagattatctcattt
attacatctcttggtatagtttttctattattcttggctggagctgaagagtttaacgtc
gaaaatagacctaatgctaacgtatttctagcggtgatattagagtcaattataccattt
tcggtaatactcgttgcgatctatattataggctttaagaactacctaattctcatagtc
ccattagcaatgagtagtgctggtcccttatccagaatgctgatggacgttaagatttct
gataacagaatttctaacttaattttccaacaagtaatcttaatagaaataatttttgtg
atattgtttgcaatactcttaaagactagtgaaattctgattacaataattgaaattttc
ttggtattcgcatttacgataatgtttggtagaactttagctaagattctagagaaaata
gagtattattttaaggcgagagaaatagagtttgcctcgcttattgcaataattttaatc
ataggttatttagcagaattatacaaatttaattcagccatatcagcctttttcctgggt
atattattaaaggattatttaaaagataggccagaattactggagaggcttcacgcattt
acatatggattctttgaaccattattctttttaggtataggcttatatgttactaaaatt
aacgcatccattattctttttagcttgctcttcttctcactaataattgcttctaaattc
cttgccggctttatttcatcgaagattctaaatattaaggggaagataaatggatttgca
actagcgtaaaaggaggagttgattcatcactattgcttactggactaactttagggtat
ataaacgaattcatgtactcgttttcaattttagcgatttcgctttcagcattaatagtt
cccctcctatttcaaattaattttaaaattagtaataaaatttcagagagtaaaaaggtg
aaactctctcaagaggtaattaagcttcagataaagccactttacgcttcatgtgaagag
aacttgagatcggtaattagtaaaattagtgaaagaggtgttaggggaatagttgttgta
aattatgagaataaacctctaggttatgtttcaatacaaactttacttgaaattgacccc
gaactatatgagagtactaaagcttgcgaggtaccactggatgaggttccaatagaatac
gataacgtgaaagttatagatcttctaagaaaatttagggaaactgagaaaccggtaata
gcaattataaataaggaaggagtcttagtcactacagtatatgaaagagaactggcgagg
tttttaatttccttt
>SSO0377 Conserved hypothetical protein
atgacagtttggtatactggaactggtgataagggtaagacgaaattaccttcagttggc
gagatttggaaggatgatgatattgtaaatgctattggagatcttgatgagttgaatgcc
agtttaggcgttatttcatccctttatccacaacttcgtgaaattatggtaagaattcaa
tcagatatattctcactttcctcagaaattgctgggtttgacatgaatttcgaagaagag
aaggtaaaatggatagaagaggagatcagtagtttttctaagggcatacccgagttaaga
aatttcattttaccgggaggacatgtcgcagcttcttttcttcatctagctagaaccata
tgcagaaggagtgagagaagtgtagtaaagatattaaagaggagtaaggcgaaggacgtt
cacgttaaataccttaatcgtttatcctcattgctatttgttttagcattatacgttaat
aagcaagagaaagtccaagagattatatggaaacgt
>SSO0378 (ocd-like1) Ornithine cyclodeaminase related protein (EC: 4.3.1.12)
atgattatcttaacaaggaaagatctagatgaattattaaaagctgaaatagccgtaagc
tcagtgaaagaggcattcaaattgcattatcagaagaaggtagatcaaccacaaaggtta
gtcatgagtgtaaagggaaattggtggggcttaatgccatcatcaactgattattctttt
gtgaccaaaatagttaacgttatacctgagaataaagagagagggttaccattagttcaa
ggtgttgtaatattgatgtcaccagatactggagagattttagcgataattgatgggaca
acgctaactgcaataagaaccgctgcagcaagtatattatcgactgagttagctataaat
ggtagaaatataggcatcttaggaataataggtgcaggcactgaagcatactatcacgca
aaattagccttagagtactttaaagttcagaagctttacatttcagctagaaaatctcac
ttcgaattagctaagagagttggcggtgaggctacggacttagaaacgttattgaagaat
tcagatactatcttcgcaaccacctcatctaattttccagttgtattaggtaagtatcta
aaagatgtatttcatttatcaagtataggagcccatactccagattcgagggaattagat
gatgatactataataaaggtaaagagttatattgtcgactcgttagaagcagtttctaaa
gagagtggtgattatatcattcctaaacaaagaggattattggaaaacaaaatgataaaa
gaactgggagaaataatagaaaagggaataaaaatagaaagaccatcattatttaaaact
gtggggattgctgtagaggataacataactgcccacatagcttatcaagaggctttaagg
agaggaattggttttaacgtttccata
>SSO0379 Hypothetical protein
ttgtatttaatacttatcaacataatactactaagcaaaaagtttatttacaaacacgtt
ttgcataatgtgatgtcagtgaatttaagaaaagtacttgtaactggttttatatcacta
tttgcaattttaatgttaatacttccaattacactagcacaatcgcaaacgataagtaat
gtactccttattccaactggttttatcacaattcctacaagtggttcatcagcctcgttt
acggcttacgtcataaataataacccaaatagtgaaacagtaactgtttatttgaacggt
aactcatatactacattaactatccctccctattcttactctccggttacgttatcttta
tcaactggtaagaacattttaatcgtaaacggccagtctctaataattaacgtgaatagt
atatctaaggttatatctgcaaacatcttgctaaacaacagtgcaaacttgatattaata
aatggaatacccggtaagctttacacagtaaatttaacaattgcaaatatccataattgg
aacatctccatatccacatatacctattcatcaatatttttcaccaatatgtataagctc
tacaacgctccgtttgagttacaaccgcctctgtcaaactcctcttacataccgattcta
gtaccactttacgttccacaaggtctatattatttctataattacgttcagttctataat
attagtaattatcaacaagtgttggggtacattccatttttaatttttataaatgtaagc
tatgggttgaatggtacgttagttacgtctaacacgtatacatctaataacatcacggta
tcgtatgttacagcaaacggctatacatacattttatctaagtatccatttagcttaagc
gataaagttatagtgaaagttattccacactcatcctctcttaatccatatacagtggtc
ttaggtaacttcacctcaacactgacaataaatggtcaagcattacaagaaccttacttt
gggagtaatagcagtgaatttgcatatggtaattcttggatagaattaaagatccctgaa
cagtataccgggacacaatatcaaataaatataacttacattacaccacatggtatagta
agcactggagtaatacccgccattacttcttctactacaactactacaacgacgagctct
actacaactacaagtactactacctcaacgacatctactacctcaacttcttcctcaaca
acttcgactacgacatcgtcctcctcaacaactactacctcttcttcaattacatcctcc
tcaaccacatcatcaacaacttcttcaacatccactaccacacccacctcgacttcctcg
tctactacctcagttactacttctggggtatctacttcagttataataggcattgcaata
gtggtgataataatagtgattgtcgctgtagtacttttaagaagaaga
>SSO0381 Sugar phosphate nucleotydyl transferase (EC: 2.7.7.-)
ttgagtgaaatgaaggctatagtattagctggaggaaagggagagggactgttaccatat
actgagaaggtacagaaagaagctattacagtactaggtaaggcaataataaactacaca
atagagggtttaaagaaagctggtgtaaaagaatttgaaataattgtaaacgagaaggga
aatcaaatagaagaagaggtggagaaacttgacgtgtcctttgagaccatagtgcaaaag
aaacaaggaattgatggagcagttctagaaggtatagaaagtattgatgatgacgtattt
gtattggcatttggtgatataatagcgcctgcggaattctacaagagccttatggacaca
tacataatgacggggagtcaagcggtaataccgctgataccgataagtgagggaacagaa
acttacggtttagttaaaatcgtcgataataaactaaaggtagttaaagaaagctcaact
ctagcgttaggtggagcctacatactaccaaaaccaaaggacaatttcacctctctacta
gattatattgatctactttctagtcaagctagactcaactatttcatttggtcagagagt
tgggttgacataggttacccagaggatttattatttgcattggaaacgttgctaaggaga
aaagaaagcgtaatttcagataaggctgagatttcgaaaaacgcaataatagggaaagga
gttataatagaagattatgcaataatagaagattatgcaataattaaaggaccagcttat
attggtaaaaacgcttacgtaggatcattttctctagttagagattattcctccatagag
gagggagctaagataggagcttactgtgaaattgcccattctttaattgaaccctttgct
gaagtaggttcaaaatcctatttgacttactcaatagtaggtaaaggagctaagatagga
gcttctgtcataactgcaagttacccagcacattcactaagtagacctagattcaataaa
cttggcgctttaatttcaccagaaaaagtaattaaacatggaagcgtaatagaggctggt
acgaaggtt
>SSO0382 (glmS-1) Glutamine-fructose-6-phosphate transaminase (isomerizing) (EC: 2.6.1.16)
gtgtgtggaattatagggattgtgtcaaataaggaaagtaatagactagctgaattagta
gtctcatgccttaatagattagagtataggggttatgatagtgttggtgttgcagcactt
tcaggcggtaatttagaggtcagaaaggctaaaggtactgttgaggaagtagtgagaaag
aaaaatattaaagaattatctggttacgcatttttaggacataccagatgggctactcat
ggagctcctactgattacaatgctcatcctcacacagattgcatcaataatatagcagtg
attcataatggaacaataaggaactttaaagagctaagggatgagttacaagctctaggc
cataagttcaaaagcgagactgacaccgaagtaataccccatatgatggaggaatacatg
aagagaggtatggatacttttcaagcgtttagaagcgcaataaagaacattcaaggcagt
tatgcagttttagcaatagttaagggagagagaagaattttctttgcaaagagagataac
ccattagtaataggattaggagatgataagacgtttgtggctagtgatataccttcattt
ttaccttatactagaaaggttatagtaatatctgatggagagctaggatatgttacgcca
aatactgtttatatggaagacgaaaacggtaatccaatagatgttacaagtagaataaaa
attatagattgggacgcatcatcagcctctaagcaaggatatcctcactttatgcttaag
gaaatccatgagagcccaatagctgttaaagacacaatttctggacttttaagtgaagtt
gataagataaatgaaatcgctgaggaaataagagagtcctctagaataatagttacagct
gcagggacgagttatcacgctggactatatttctccctattacttacaagaaaggggtat
acggttattccattaattgcatctgaataccacaattttagagctagaaagggtgatatt
gtacttgccataagtcagagtggagaaactctcgacgtgaaaatgggaattaggaaattc
aaggatgaaggggctaagataattgcattaacaaacgtaattgagagcgacatagctagg
gaaagtcattacaaattatatatgagagctgggccagaaataggggtagctgctacaaaa
actttcacatctgagatagtatccttacttttcttatattccctaatagaaaaagaaagc
atttcgtatctggaaactgctcatgagacagttagaaatgtaataactgagactgaagga
tttgctaagaagattggggaggaattagctaacaagaacaacgtttattatttaggaaga
ggtctaggagtacctttagctatggaaggggcattaaagataaaggaaatagcatacatt
catgcagaagcgtatccagccggcgaaagtaaacatggtccaatagcgttagtagagagt
ggatttccaataatcttcgtaaatgatggtgaactagtagatgaattagagaagaatttg
caagagatgaaagctagaggtggcaagacttattcaataagtgtgaataagagacttaat
ttcgcagatactgaaattctagtaaatactagcgaaaaactttcttcacttgccatagcg
ccaataattcaacttattgcgtattatgcttctgttaagagaggatatgatccagataag
cctaggaacctagcgaaaacagtaacggttgag
>SSO0383 Mevalonate kinase (EC: 2.7.1.36)
atgatggttgaagctaaggttccgttgaagctgacattatttggggaacatgctgtagtt
tacgatagaccagcaatcgcaatgactatttcagaaagtttaaaggtaaaggtaagtgaa
aacgacaagttcctaattatatctccatcccttaatataaaaggggttaagttagattta
aatgagatgaaaattgagagcgatgaggctaagaaagtacttagatatgtatttgaggtg
ttgaactattttgaaatgaagaagccagttaaaatagaaataaattcaacagtcgaacct
tctgttggattaggtactagtgctgcagttattgttggcactgttgctgcttactctaaa
tatttgggtattgatttaagcagagatgaaatagccaaaatctcgcacaatatagagtta
aaggttcaaggaatagccagtaggatggatacttatactgaaacttatggtgggctaatt
tactttccagctggtggaaagggatttgaaaaaatagataccaattttgaactgactgca
ggatacataaggaggagtatgagtactgctgatgttttatggcgtgttagaacgcttaag
gagtcaaacaaggaagtctttgagaacatattagatgtgataggcgagataactaatagg
gctaaatctttaatagtcgaacaaaatttcgaggaattaggactcttaatgtacgtaaat
catggattattgttttcattaggaataacttcaccagaagctgatgagattgtttctaga
gctaaacaattgggaataaaaggttgtaagatcagtgggggaggggctgggggttccata
atatgtataaagtccgttgaggctgaagttcttctgaggagttacaacgctagaatagtt
aattctacactaactaaagatggtgtcattttttcgatacta
>SSO0384 (thrS-like) Threonyl-tRNA synthetase homolog (EC: 6.1.1.3)
gtgataatactatttattcacgcatctgacttctcatttaatgtaaaggaaagagctatt
aaggaaccagaagaagcaaaattaaaatcgatagagctgaagaacactctagtctgtttt
actacagtggagaaaggagatgatgaggagattttaagcaaagcaatagacgatatctta
gacgtttatagtaaggtaaaagcggattctgtggttatttacccttacgctcacctatct
tctaatttagcaaacccagatactgcaataaagatacttgaatccttggagaatctatta
aaggataaggtaaaggtttatagggcgccatttggttggtataaggctttttcaatatct
tgctatggtcatcctttaagtgagttatctaggagaataagaaaaactgaggagttggag
aaaagtgaggagttaaagtattgtgaaaaatttggatttcctagctcctctgaaagtgcg
ttcatgaggagagctacaatagggtatttaaggaacttgtttcaaccgcttttcgaatct
gaaaataacgagaacgtacgtgatggtgaaatgagtatactttatcaaaacgttgagagc
ggaagaattctcccatgtatcaatgagaatcctaggatagtggtagtgtatggtggtgtt
agagagttaaattttcccaaggaaattaacgatagtaaaaataggattagggtctggtgg
gttaatgagagtaaaatctacgtagacgtcggaagattaatatattacttcattttagag
tcggttaaacaacagcctcccacattaccggattggcttaatccaattcaagttagactt
ttgccagttaagaaagacttcttggatttctcgatacaagttgctgaaaggttaagaaag
gagggaataagagttaacattgacgacctagatgatagcttaggaaataagataagaaga
gccggaactgactggatacctttcgttatagttataggagaaagggaagtaaagactaat
actcttactgtaaaaatcagagcgaggaatgagcagaaaagtatgactgttgaggagtta
gtaaaggaaataaaggatgaggttaaagaaaggcagaatttaccactttattatactctt
tataggcataaaaataac
>SSO0386 mRNA 3'-end processing factor, putative
ttgcccatgacatttgttttcataacggtaggattttcaattactatattcttttcatta
gtctcaattatcactctagttgcatttatttgttcagtttttattcccattctttccatt
ttctttagatcagagggttttatttttgccattacatgttttattgaagaggaagtaaac
ttaatagtttgcggttacgatatttcacaaatgaattactttctgaaaatattaggtggt
ggaagagaagtaggtagatctgccattgaggttggaaatagtgatggtagcataatacta
gactatggtgtaaacttcgatgaaaaggacaatcctaattttccgttgcaagaaatgcca
ggtaaggtgaagggctttgtcgtatctcatgcacatctagaccatataggagctttacct
atttatcaaataggttcattgaacactaaggtctatggcactgtggccactaggataata
actgagacaatgctaaaggattttctaaagctttctggagctaaaataccgtacgaatgg
gttgaagtaaggaaaacaatggacaatttcatggcaattgggtatggggaagaagtagaa
atagatagtttgaaagtttcgctttacaatgctgggcacataccgggaagttctattatt
aaggtatcgtcagagaaaggcgtaatagcctttacgggggatattaacttaacggagacc
aaattaatgaaacctgcagaaattgagaatataggagatgcaaatgttttagttatggag
tcaacttatggcaagtttaatcatccaaatagaaaagatgttgaaaacgatttctacgat
aaggttatggaagtagtagaaagcggtgggactgttttagtaccagcttttagtttagct
aggagccaggaagtcttatctgtattggcggaaaggaattttccttatccagtttattat
gacggtatgtccagagagataacggagataatgcttggttttaaagagtttttgaataga
ccagatctgcttaagaaggcttatgataatttcaattacgttaagggctgggaggatagg
catagagcatggaaggagaaaggggttatcgttgcgagtgcgggaatgcttaagggtggg
ccagccgtttattacttcaaaaagctatcagaaaatagtaagaatgcggtattcttagtc
agttaccaagctattaacactccgggaaggaagctattagaaatgggtaagttcgatgag
tattctggattgttaaaggctaggttagaaatctttgacttttcaagtcacgctggaaga
agacagttgttggaaatagttaaatccgttaaggatttggaaaaagtcgtgctcgttcat
ggttctccagataatgaatcatctttagcggatctaataaagcaagagattggggttgaa
gttataactccggaaaatggtcaagaaattagttta
>SSO0387 Conserved hypothetical protein
gtgtttataacactaatggcagttgatgaattatttgattcctatataatagagactatt
ggtaagagaatatctggagatattgtttggagtaaggatatatccggatctttaaggaag
tggagggaaatgtttaacgtttctcaaggtgagctggctagggagatgggaattaagcaa
tctgttatcgcagattacgaaaggggaagaaggcaggctggtagtgagttcattaagcgt
tatgtgtctgctttgatttcaattgacgctaggaggggttataaggttgttaaagagttg
gctaagatgtttggtataaatttccctttcattgttgatatgagggatttcaattctcct
atttgtatagataagttgattagggctgttgacggtgttgtcgtaaattcctttgttact
gataagaaggtttacggttacgttgttaccgatagtattagggctattctgagtttaagt
ggtttagagttttatcaagttttgagtatgatggtgaatagggttgtggttttcacgaga
gtaagtagcggtaggtctccaatgatagctcttaaggttgccccaataaggcctcaggtt
gtggttttccatagaccggttaagctagaccccttagccttaatgttaagtgaggttgaa
ggaataaacatcattgtctctatgaaaccaactgaggaggatttaattaagggtttgagg
tctctccttgcagaatca
>SSO0388 LPS biosynthesis protein, putative
atgactacactgggagttgtctacgataaattcctctcaccgtattttgctggtggtgga
gccgttcatgcttatgaggttacgattaggcttaaggagcatttcaaaattgtatattac
ccttctagcccagtcctttcatgggataaggagaacgtagagaagaaggctaaggaatta
gagagccaaggcataaaggttgctgatgaattttatgagatattggaggagaagaggaga
attggaaggcttaagaggtttttatttgccgataagatcgctagggagttttccaagggt
tttaaagttgacgccgatatcttgtacgagccagaccacacatcccttgatattttctat
ctggctagggatactaaatatggcgtaactttccatgaaccccccttttataataactcc
cttagatactttaggagattagtcaaattttatggtgtaaatccatatactggaaaaggt
tttcacactaggtttctatacaacgagtatataaaatatttgtataagaggttgtttaaa
aaagtgaaaaaacctacttttttagctggtgtcagtgaagctcctttacttgagtctggt
ttaggtggtgaggttattaaacccggaaatgcttttaatccttctcttctgaagtttagg
aatagggggaaagaggattacgttgtattctggagtaggttaaatcaagataagggtttt
catgagttgccagacattttgcgcattatggaaaagaggggtggtaataaggtaaggtta
attctaatgggcaaatttttcgataaatacaacgagaggaggttttggtctaaggtcaga
aaatacgatttgagggttgactataagggctttgttaagagggaggagttagcagatatt
gtttctaaggctaaggttctaatttatccatctcatgttgatggtttctcattagttgct
ctagaatctctagccctaggtacgccggttgttgcctatgacattcccgcaattaagagt
gtttatggaggattagagtgtgttaggattgttaatgaattcgataaggaaagtatggct
gaaaacgctttaaagttctacaaaatgagtgagaaagaaattgaagagatcatgaatgga
gataagttaatggaattcttaaagctgcattcgaattgggataatgttgccaattctgtc
ttgaaaattttaaagaagtatcttatt
>SSO0389 Hypothetical protein
atgaataaaaccctcggtctaatcctaacctctgtattcctactatccactttaggcata
ataactggatttgtaataccaacacaagctgccaactctaatgatgcggcaatatacaca
atacctagtgttactagtgtaagtaatacttctaatatagtcattaacctattctttaac
gctacttcaaactctacagtaggcgcacaagcatctgcatttaattatggtttagcaatt
aactatactttagatgccataacgtttaccgtggtacttccaagtggtacgtcctatcca
ctaataaaattaaatgctaaaaattttgcaaattatggatattatgatctagctcacaat
tcaatagttttactattaaatactactgcttcatccacagccaaagaattggcatatagt
tatgagcaaagtattggagtaactccttcagcaagttataaaatttataattatactaat
aaaaccgtaaatgttaatcaatacatgaatgagctacctctatcaatgttgatatatatg
gcaactaatggaaaatataacaatttagcatcattaccagtaggtactaaactagaattc
acttacgctggtgtcacttatatcatagcagtgtccccaaccgtgaaattagtaggtgag
ttattaaacccattgtatacagcaaattcaaagatgttacctggcactaactacgcagtt
ggaagaagcaacataaccgtagcagtttacgataacttgattacaactaccacatcacca
tttaactttaccttaacctattcctcattagcgccagccctaatatactggtttgtaata
gctaatacaacatatactaataatggtgcttctacaccaacagctagcttccaggctcca
ccgtttaaacaatacttcccatctaatagtaccatattatattccgcagcaccaactaaa
agttcgatcctaatgtttaatggacaaatgaacgtcactgcacatgaaaacgtaacgcta
accttacaaaccggtactaacatatacacatctccaaacttcaacgtgactccaccaggt
aattatactttctctggtaagttaggtgttggattcaatggcttcatctatcaaaacggt
agtgcaacattaactgcaactatatttaatggtacaattaatttcttctttagcagtact
ggccagaaagccgcatttactttcttcctagttccgatagttccaataaacttaggcgat
aataatggtgcaacagtgatctataatggggtatctctcaacactggcttcccacaagta
gtagtaatgtttaacataactggtaatttcactaaatctggaagtaattatctattatac
ggatcagtatatgaggctgagttaaaaccgttaggctctactcaattacaaaaattagct
ggtgcaactgatagtacacagttcgtgggtaacttaatttcatccgcttcatcaccttta
gtatcttacttcaactacggtgaatctacaacaacaataacaggaacatcattatccttc
acagtgctaatgccattaaagttcattgttgagagattaggctacatctatctagtaacc
ttccatatatggggtccgtcagctactgtaactgtaactggtgttgactaccacggtacc
caaattgcactaggttcctttagagcatatgtagcacttccaagcttctatacactgcca
aaaactccattggttggcttaacttgcgacaacatgtatacactagcacaagtaagtgat
gctggctcagtcctagagacctccacggcgaattccaatgctaataatgcaactgttatt
ggaccctatgacttaatgtccaatgctggtctacacgtggcaatttacaatggttctaaa
ctagtgaagagtgggaatttaggcctattacccaatgcgacaacagctcctataaccact
actataacgctaaatggacaaacagttgcattaacttactcttctgctccaacagcgata
tacccagttgatttcaagtttgagccaggattcagttacagtgttacaactaacgtgata
tataatacttcaattccaacctatgttgtgactgtatatatgccattgaaatacatacta
caaactaaaatcgtaatgtggtatgtgagtcctgactatgctgcttacttctattattca
agcactggacagtatcaaactagtaacgtaaccttaacgtttgcaaatgttactccagaa
ttagtaatgccacaagtattcccggttggcaaactatacatgcccttcggaattaatgat
ccgtattacgtgttctacagcagtataagtataggtccgcagagtggagtaattgaagct
gttgagaatggatttaacgtaggtaacattacttcaattactgtagaactaaatggtatg
aacgagtcaatagtattatcaccactaaatgttagtaaattattaatatcaagtaactta
ggtgaagtatctcaatgcagcccattatttacaactacactattcaacatatccgcgtta
gcttcactattaggtttaccaaacgcagctgctctaaatggaagctatttatatgtaacc
tatcacgatataatcagtggagcttatgtgacaaacaggaccttactggtggttggtcaa
ttctacgtgatgccaccaactactccaggttcggttgaatggatattaactgcaaagtac
attaatgctacaacgggtattccagttgagataagctatgctgtagtgcaacagccaagt
gctaaggtagttgatataaacgcagctaatgcaagcattacacaaatacaagtaactggt
gtgaagattgttagcaagtacgctactgtgacagttatgtataatccaagtaatgcaagc
acaatcgtatacatgaacggtatgtttgtagcttcatatggtggtaatctaatatcttcg
ctatcagagacgtcaacatttggagtatattacggagcagtagttaacttatatgtagcg
actggtacattaagtagtcctaacggaacaatgtatgtagtattaggatctcataaagtt
gcagtaggtactgctaatctatacacttacgctggataccacttcggtccatacacagcc
ctaccactagtatctaatgtaacatttacagtacaagacccagtaactcatgcgacactc
actggtcaaaccaccttaggtgcatttaacaacactccaattaggttagctccattaggt
gtatcaatacctcaaactgcccaatataaagtgttctactactatagcacacctttagta
ttaagcccaacaagtcagtacatagtgttgtctgtgacaagtgttatatcctatccatat
ccattctacatagaaactgtatcgttcttaggttataacgtaactactggaactccagtg
cctggcactccagcattccagacagtatattcgccatccttaggtcctggtgtagtatta
caagtacctgttcagtcatatcagttcataagcttatcgactccaagtgagcctcataca
gtagtaatgtttgcagtgccgtttgcaggcggtccagcaatatctctatacccgacattc
ttagtatacgctaatgtgacggcgatttcaagt
>SSO0390 Hypothetical protein
ttggttgtgaaaaaaacattcgttttatctaccttgatattaatttcagttgtagcgtta
gtgagtacagcagtttatacatctggtaacgtaactttttacagtcctagtgtaaataat
caaatttactatgttggaaaatcagtaacaattgatgctgttgttcctcaacaatttgct
ggtcaaggagctgttataaacttattcttccctaattcaacgctagctgctagtattcct
actaccgttaatgctactggtggaatttatgtgcccaatgcttatacatttcctcacgta
ataggaatttggcaaattactgttgaagttactggtggtgtggctgtaggtacaattgac
gttaatgttacaactcccgcagtagctccaatcatattaactctacaaaacttagctatg
tatgagaatacttacccacagtttatagagtttgctaatggtatcataacttcagtggtt
atgcaaaacggtactgtgaacataatgggttacgtctataatagtacagtaggtccatta
tctggtgctactgtttccttaactcttaatatacccactgttgggactaaaacgttatct
acgacaactgcttcaaacgggtcgttcatgttaagtttccaagttcctcaattatcaacc
actttaacgctaatatcttcctacttgatcagtggtagcttaacggtatcttatggagtc
catactgtaacttataacgtatttataaccgcaattccgaactatcttagtgtaattaat
gcgttaaataatgaagttagtacgttaaggagtgagatctcatcgttaaatagcacaatc
gctagcttaaataagagtttagctaatgcaaatactcagatatccaatttacagagtgag
ataaccacattgaatagcgaaataggaaagttaaacagtactgtaggatcgctaagtact
caacttagctcactgtcttcacagtataatactttgagcagtcaagttactgcactaaat
ggtaaaataagcaatctaagtacaagtctcagtactttaaacggagaggttgctagctta
aggagtactgttagtagtttaactacaatagcctatggcggaattatagctggcataata
ggtctaattgttgcaatagtagccatagtactagtaatgaggagaataagt
>SSO0391 Conserved hypothetical protein
gtgatcccgggttcaaatcccggcggccgcatacataatgtgattgagatgtttgaaaat
tacttcatggatgcggtaaagggttattataggcatttagcgataattgaatctcaagat
cctttagagaagattaattcattaattgatgactatttaaaggttaacaagaagccaagg
gttatatacggctttcatccttggctcgacaattcaaaagatagaatgaaagagctgaaa
aagagatttgaaaactttctcgacatagattactccaattcagagaaatatcttgggcaa
agcgcggatttggtaatattagacgcaatggatgattttaggcctaactacattgctaga
ttcgttgacatgactaagggaggaggtatagcgataatctacagcgataacatcctagag
ggtaagttgtataagaagtctttgaccaggtatggtgttgttaaagatctgtttgaagct
aggtttattgaactggctaagagatatagagggatcattttctttcaaggaaatgatagg
ataacttttacaccgtattcctcaaatgaaactcacaaaccatacaagaaaatacctaaa
agtcctaaagtttcgatggagcttcatgagctttgtctatcttctgaccagaacaaggtt
cttgaggaatccttgttcattatgaatctagggaaaagagttttagtaataactgcagca
aggggtaggggtaagagtgcatccataggtttgtttttgtcttatttaatgagtgaggga
aattttggtagtattatagtaacttccccaacgtactattcttcacaagagatattcaaa
ttcataattagagggttagaagctctaaatgttaagtataaggtaatcacatcaagggat
ggtaagataatgaagatatctacaagggattccagggtaaaatgggtttctccggactta
gctaaaaatgaggagggtgatttaatagttatagatgaggcagctgctatgggtatagag
tttttagactatatcgtgagatcttgggataaggtaatcttggttactactattcacggt
tatgagggttctgggaaggcatttttaaagtacgttgataaactgaagggtaaggttctt
ttgaagaatataaagatggattatcctattaggtatgctaagggtgatcctattgagaag
ttcttatttgatgtattcttattggatgctgaaccgcatgaagttgaatataatggtaag
ttgaaaatagttgaggttcctcaagaggaattgtttcgagatgatgatttgcttaagagc
gtttatggaatattggttactgctcattataggaattcccctgatgatttaatgctttta
ggcgatatggctttccaaaaggttatagtaggttattcatctgagaatcctgtggcagtt
tgtcaagttgtctatgagggaggtctaactgataagcaaatatgggatatttccaatggg
ttaaagaatgaggggcatttgattcctcataggcttataaagtacatgagggctttagat
ttcggtaagttgaagggttggaggataatgaggattgctgtttctccggaaaatcaaggt
aagggtatagggagtagagttatcgaagaggttattaagatggcgaagggagttgattgg
attggatcttcatttgttgcagattactccgttttacgattttggataaagaacggattt
ttgccggtttatttatcctctattaagaatgaggaacttaatggttattcggtgattgtg
attaaggctttaagcgagagaactaaggagtttgttgttaaactttccagtttattgaag
gataagctattgagaacttctcatcaagtctattataatttgaatcctcaacttattgtt
ctattattaaggaatacttacagtgaaaggatagagggagaggttccagatctatatgtt
gataagattaaggcttatactgaaggtaaggttccatataatgtcatcgctgaagctgca
catttcttagttactaaacattttttagaacttaaagccgatttaagtatagaagccgag
gcttcactagtagctagagttttacaaggtaaaagttggtatcatgcaggtttaatgtta
ggtttgagtagtagggaagttgaagataatgttaagcagagtttaggggttttgttagaa
acttatact
>SSO0392 Conserved hypothetical protein
atgagtcatgagtacataatttttgaagtaattaacggtatacctctaacccttctatcc
tcaccggggatattttcaaaaaaggaactagatttgggaacaaggatacttttggaaaac
ataaaagtagcggaaaacggaactgtagcagacgttggttgtggctacggacccatagga
atctacctagcattgaaaaatcctaaccttaaggtctacatggtagatgtcaactacatt
gcaattaagctggctaagaaaaatgcaaaacttaatggggttgaaaataggacaataata
gtgaaatcagatatctttgataacattcctatcgacgttaaatttaccgcaatttattct
aaccctcctctttctaaaggagtagattttctaaagaagcttgaagccgaagcctatgat
agattagttgaaaagggattcatacagttgatagcatataagggtgaagaaaatatagag
aaaatattcagtaaaagatttaaaattgaatccataaagagaaaaaaaggatattcctta
ataacaatagttaaagat
>SSO0393 (truB) tRNA pseudouridine synthase subunit B (EC: 4.2.1.70)
gtgttaccaataggaatagagaacgcaactaaaataatgaactatataagtaaaggagga
aaagagtacgtatgtgtaatgcaagttcactgtgaatacaataaagaggaattggcaaag
ataataagttcatttaaaggagaaatataccaacgaccaccagttagatcatcagtcaaa
aggagactaagaattagaagaatatatgatatagaaattctagacatggacaagaagtta
gtattacttagagtaaactgtgactccgggacgtacatgagaaaattatgtcatgatata
ggaataatttacggttgtggagctcatatgagagagctaagaagaactagatccgggatt
ttcacagaatccacaaatctagtgaaattacacgaactttctgaagcaatatacttatac
aagaactgcaaagacgaaacagaactaagaagagtacttataccaatggaattcgcaact
tgtgaaattccaaaaattgtaatagaagactcagctgtaaacgcattagcttatggtgcg
caactagcagtacctggagtagtagcttatcagaactttaaaaagaacgatacagtcgca
gtattaacgcttaaaggggaattagtagcgacaggcaacgcactaatggacagcgaagaa
ttggaaaacgcaaaaaagggaatagtagtcaacttaagtagagtttttatgcagagagat
atatatccaaaagcatggaaaaaacatgagtca
>SSO0394 ATP-dependent helicase
atgataaatgtaaccaatgaattcttggtaagactgaagaaacttggctatgaagattta
acgccaatccaaaaaatagcaataccaaaagtactatctggaaagaatgttttaatcata
gcaccaacggggtatggcaaaactgaggcagcgatattaccaattttttatactatcttt
aaagataaacctgaaaaaatctcaacactctatataactcccttaagagcgctaaataga
gaccttgagttaaggttaagaaggctaggtgaagcctttaatattagtgttaacgtaaga
cacggagattcctctcagaaagaaaggaaggaaattttggataaccctcctgacgtatta
ttagtaacgccagaaacgttactttacttagtgctaaacgatacttttaggaagtacttt
accaatctgaaatggataataatagatgaattacaagaaatgttagatgagaaaagagga
atagaactctctgtactaatccaaaggatcaaaaaaatagcaacaagaaataaaattcaa
ttaataggaatttcagctactattggtgatgttgaaatagcaaaaaggtacttagataga
gagggagaggtcgaaatagcgaatatcaacgcaataaaggatataaaagtggatttaata
ctccctaaggttgaaaagaaagatgcggatttagcagtaaagttgggattaagaccagat
acaattgcgagacttgagaaacttaacgaaattataaaaaacaacaaacctattataata
tttacaaatactagggaaactagcgaattcatagcaaaccaactcatgagtaactattcc
ttaaaaatagcttctcatcacggctcattatcaagagaaattagaataaaaactgaaaac
gacttcaaaaacggtaatatagacgctatagtcgcaacctcgagcttagaattgggtatt
gatatcggtagaattaatctagttgtccaatacatgtcaccgagacaagtaattaggtta
attcaaagagtcggaagaagtggacataaaataggtagaacgtctataggttacgttata
ccctcagaggaccttttcgatattttagagtgcagagcaataattgaagcattatattct
ggttatttggaaaaacccctgtttgaagaaaacccacttgacgttgcagcacatgaaata
gcgggaatggttttagaaggttataaaaaccctaaagaaatgatggagattcttcgcaat
tcattttatttcgagaacttcaccgatgagatgttcgaaaacgttatagaattattagag
agcgcaaaaatagttaaaagaagagaagacggaagcttatttccaagtagaagaatttgg
aaatattattacactactaatatgataccagattccattagaagttatatagtaattgac
catgctaccaacatgaaaataggtaccttagacgaagatttcgtagtcacactagatgaa
gatagtgtattcattttaggaagtagactatggaaagtcgtatccatagagaacgacaga
atatttgtggaaagggctgagctaaaaaacggaatattgcctagttggttcggagaatca
attccagttgagaaagagatagctaggaaagtctacgagtatatttacgcagtggagaag
gaaaaaagggaaactgaagataatagcttagctgaagtagttagagaatacatgaaaaga
ggatatccagaactaagaccagatctaatccttgttgaaatagtaaagaataatttaata
atagtgcattcaccattcggctcaagaggaaacaacacgcttggtgccataatttcagtt
atgttagacgtagaaaaacagaccaaaacgacttatagggctgatccatatcacatcgca
atatcttctgtactgccaataactaaaaatgatatggaaaaaattgtctctacgctaaat
tctactcctatagacagaataattgaaatattaaagaagggaattaaagaaagtccgcaa
ttcaagtggaaattattggttgagataaagaggtttgggatgatagacccagaaaaggaa
ataacgcttacctcatccattataaaggcttatggagatacaataattggagaagaagca
gttaaggaattattagtcaaaaattatgatgtagaaataataaaggaactcaagaattac
aactggaaaatagtagaggtttacgaagcgtcccccttagctaaacaatttctagataaa
atccttaactacacctcgttcgataaagaagaaaaaccattaatgattgaaattttcaaa
aagagattagaaaacaaggagctgaaattaatctgtctctcatgtgggtgggagggaaaa
tactctataattaactcacctagcaaatgccccaaatgttcctcaattttcttaactgca
actaatccagatgatagcgattccgtgaagatagtgagaaaagcaataaaaggtgagaaa
ttaacaagtaaggagagaagacagttagaagacttgaagagagttgcctccttcttccca
gattacggtaagtacagcctaatagcattagcaactaatggagttggaccaagtaattta
ggcaaagtattgagtaaattaaatgaaggagaaaatgagttttacatggccttaatagat
gaagagaaaagatttataagaacaagaaaatactggcac
>SSO0395 Hypothetical protein
atgtatgagaagagacacattgttgctaatatattaatgcttattgtagcttatctagtt
gataatttaatgtattatttgacatcagcaggtaatttaagccagttagtaaataatctg
tctacattactattaattattcctatattagtagtgatattttcagtattcataacttta
atgttttcatccataatagtctcattcctttattacgtaacagccatagcttacgcgtta
gtaatttctaataacgtgggctctacccttattttatctacgttcttaaatttgttagga
tattatgctcttgctactattattatcggagttatattgggaatttctagaagaagtttt
ccagatgagattttgttaaatgtttcacggcttaatgtgagtgttaataagaagaatgct
atctatgggggattgattgttttaatttctttcctgattttctatgaggttttatccagt
ccattcttgtttgtaggtagcatagcatcattcaccttactattctttatttcaaatgac
tctatttttccgttaattatcttgtcgtggttctcatttccattcctatttacgcaatta
tctgcgtattctgttaacgagaaggggatagagctcggttctattgagggagtgttggct
ccttcattagttaataggatatctaatactaagtatggttggaagaaattttctaacttg
aagtttgttctaaactttgatggagcaaagaactataacatagtgatactaggtacaagt
ggatctggaaagtctagtttagctaagagtattattgggaaatttacagatgctagtttc
ttggtttttgatctacatggagagtatgagattgaaaaagcagaaagaattgacatctct
aagaattcattaaatcctctttcgttaaatggcgcatctcctaggcaaagggcattggaa
gtggcttatatgctaaggtccatttttaaacttggtaatttacaaactatagatattttt
aatattataatggatacctatgccgaaaagggaattgatgaaaacgatgagagcagttgg
aatttaacaccacctacttttagggatgtattattaatgatagagagaaggaagaaatta
gttgataattcacaagacctttctaggctatcttcaattgaaccgtatatacaatttttg
gctaatcaaattttaagtggtaatagcttaaatatgaaaaaaattttcgagagtaatata
attctggatttttctaaagttactacagacgagctaaaatatgttttaattgaaacgata
cttagagattttagaaattacatatataggcgtgggatatctggtttgtggaaatttttg
gttatagacgaggctccttttatactcagtaaagagactggattagagatagttgagaga
ttattcgcagaggttaggaagttcggagtcggaatgattcttatatctcaattaactgag
aatatagaaaatattgtccaaaattcgagttatatctttatatttaatgttgttgagcca
aaagagttagattacttaagtagggtgttaagtggaagcgacagagataaatacgaggct
atttatcaagctattcgatctttagaaaggggttacgtggttactgtaagcggggataac
agagctatacttttagtaaagcttaattctttaaaa
>SSO0396 Hypothetical protein
atggtatctggtatgtcaacagatgaggaaaaggaagggactagtgacgaggaggttaat
gaggaaaaggaagttgaggagacatcggaagacgagtttccaaaactttcaatacaagat
atagagctactaatgagaaatactgaaatttgggataacttgttgaacggtaagattact
ttggaggaagctaagaagttgtttgaggataattacaaggaatatgaaaagagggattct
aggaggaaagctaaaaaggctgttagtaaaaaagttaaaaagacaaagaaaaaagagaag
agcgtagagggt
>SSO0397 (pcnA-like) Proliferating cell nuclear antigen putative homolog (PCNA-like)
atgtttaagattgtttaccctaatgcaaaagactttttctcttttataaattccattacg
aacgttactgattccattattctaaatttcactgaagatggaatattttcgagacatttg
actgaagataaagtgctaatggcgattatgagaatacctaaagatgttttaagcgaatat
agtattgatagccctacttcagttaaattggatgtctcttcagtaaagaagattctttca
aaagccagctcaaagaaagctacgatcgagttgacagagactgatagtggattaaagatt
ataataagagatgagaagagtggggcgaaaagtacaatttatattaaagcagagaaaggt
caagttgaacaactaactgaaccgaaagttaatttggccgtgaatttcactacagatgaa
agtgtacttaatgtaatagcagctgacgtaactttggttggagaagagatgaggatttca
acagaggaggataagataaagatagaggctggtgaggaggggaaaagatatgtcgcattt
cttatgaaggataaacccctaaaggaactttctatagatacatcggcatcatcttcttat
agcgcggaaatgtttaaggatgctgtaaaaggtctaagaggtttttcggccccaacaatg
gtaagctttggagaaaatctccctatgaaaattgacgtagaagcagtaagtgggggtcat
atgatcttttggatagcgccaaggtta
>SSO0398 (trzA-like) N-ethylammeline chlorohydrolase related protein
ttggcatatggaggaagaataacactaaatgtaagaatagctctcgtaggagaagagcta
gaaataagagagaacgttaatatagaaatagaagaaggtataataactcatataggaaat
ggtttctcatctgaaggcataacgtttaaaaacggaatcttaatccctgggatagttaac
gctcatgtgcattctgccgacttcatatgccaagaaatgggatacaatatgccaataagt
aaagtcgttggagatccgcatagcgttaaatacgaatgttttgcaaaaaacacaaaagaa
tccatcatgaactccatagagagatttgtcttaagagcgagagaactaggttcaaatgta
atgatagactttagagagcaaggattagagggaagcttaatttcaagtacaattaagaag
aaaatggctacgaacggggtgaagtattactttctaggaagacttgaagaagatgagttc
aaggatatccgtaatttaaatagtttatataaaatagctgacggttatgggttatctagt
gcttttagcacatctgaaatagagttaataaaacacgtatttaacaataaaattaggtct
gttcacgtatccgagaccataaaacattggttaagagatgacttagagtacgttatgaaa
agatatgaaccaaacctaataatacatggtacttatttaagtgaagaggaaattgatatt
atgagatataggaaagcatccatagtttattgtccaaggagtaatctgtggttctctgta
gggataccaaaggtaataaatgggttaaagagtggggttaatctattgattggaactgat
aatgggggagtattagatccagacatgtggaaagaaatggagactttgcttctaatttca
agggttcaagatccactttctgaccactcactacaaatattgaaggcaagtactattaac
gcttataagtttttaggaattagaggatggatagaagaggggaaccctattgaagctggg
ttactagtccttgagggagatagcacgggcatattaaactcaaataataaatatattgga
attataaaaagaggtaataaaataatttataaccttggcgctatccaaaagatcata
>SSO0399 Conserved hypothetical protein
gtgaagatattagcgataaagcttttagattatagagagtggactgaaaggttagggtat
gatagagagtggttaatccaaaaaattcaaaataaatttatgatgaaaattcatgaaata
gcctcccaatataacacatttccccttcaactcagatttgacaatttcctaatgatagct
gatgggataactaccactcaactagcatacatgataaatgatatgcaagagaaccttcca
gtaaggataaagtcttgcctaggttatggaaaaactccactagaggcgcaatggaacgcg
tcaatttgtctaaataatcaagacgataatgaaattaaggaatatacagacgaaaaaata
gccgctttgcatttcgatataaattttaatacggaaacgttaaaatacacatctgtatac
gactcatttatagagataaccaatatatatgtaaacttatcaagatttttatacaagata
ggcgggatactgcaatatctaggcggggataattatttaggctttatatcgactgagagc
gtcaataaagtaatcgaagaatttagtgatgataacaagataaaggtaggaataggaata
gggaaaaatgcgagaactgcaataagattggctactacttctttagaaaaaataagaaat
aatagggaaaaaacttggcatatggaggaagaa
>SSO0400 (ribH) Riboflavin synthase beta chain (6,7 dimethyl 8-ribityllumazine synthase) (DMRKL synthase) (EC: 2.5.1.9)
atgcaggagaaatcgattagactaggtatagtagtagctgaattcaactatgatattacg
cagttgatgttacaaaaagcattatcacatgctagattcttgaatgtggaagtaaaagtg
gtaataaaagtaccaggcaccttcgatatgcctcttgcaattaaaaaacttcttgagaaa
gacttcatagatgctgtggtgactttaggagcagtaataaagggagaaactaagcacgat
gagctagttgcaagccagactgctaggaaaatagtcgatctctctacggaattcaacaaa
ccagtgacgttagggataattgggcatggagcaacccacgaacaagctgttgaaagaatt
gaagaatacgctaccagagcagtagaggctgcaataaaattagttcagagaactaggaaa
ttagatgaattaaaagaaatcaaggaaacggtgatcatagag
>SSO0401 (ribC) Riboflavin synthase (EC: 2.5.1.9)
atgacgagaaaatatggaatagcggatactacattttcaagagtagatatgggaagtcta
gtatacaaggtaataagaagcgaagacagtgaagcggatatcgttaggtatactgtacca
ggtattaaagacctaccagtagctgcgaaaagattaatagatgaaggatgtgatggtgta
ataaccttgggatgggtaggcaaaacgatgttagataagtacagctacttagctacgagc
ataggcttaataatggttcaaattctaacttctaaacacgtgattgacgtaacagtacat
gaggatgaagcagatgatgaggagaaactaaaggaaatagcaattgatagagccactaaa
cacgctaaaaacttagttaagctagtaaaggagggcaaaaatgcgctaactaaatacgcg
gggaaagggttgagacaggggtatagcaatgcaggagaaatcgat
>SSO0402 (ribA) GTP Cyclohydrolase II (3,4-Dihydroxy-2-Butanone 4- Phosphate Synthase (DHBP synthase) (EC: 3.5.4.25)
atggattttctcagtttacgtaaagatctagaatctggaataccgatattaatatatgat
tttgatggaagggaagaagaaactgacatggtattttacgcgggagcaataagctggaaa
agcatatatactctaaggaaagaagcagggggattaatatgctacgcaacagcaattaac
gaagctaaaacattaggtctgaattttatagcagaagagttaaaacaacacgaaacatac
agtaaactagtaaagaagccttcttatggagattacccagcattttccgtgtgggttaat
catgttaatacaaaaactggaatctctgactatgatagatatattactataagcgaatta
cataaaataatactcaaaactaaaacaaatccagaagaggcaagaagggaattttatgag
aacttcatgacaccaggtcatgtacctatactcattgcaagggatataagagagagaagg
ggccatactgaattatcaataacattgttacaaaaactaggattagaaagaagtgcggta
atagcagagatactagacgagaagtccagcatgaataaagataaggcaaaaatgattgca
aagaacttcgggcttcactttatagagggaaaagacatctttaaagaggtgatcata
>SSO0403 Conserved hypothetical protein
atgtcctctactggatataatccattcaactggaagtttgtactactatcacaagtaatg
atgatattgttttctctagtacttagctttttcccaaagtattttatagaattttacata
ctatacattttagtttacttgggtataacatcagtaataatgatgcgttcgaatccttta
cttagagagaggagatccttaggtgaaatagctaatgctagaaccttatatgaagagaaa
aaagcaagtgaactcgtaaaccaagatgaggagtatttaaaggaaactactgaggtaatg
aagaagaatttctcctcaatgggtattatgttcttatacatgataatactaatattagtt
tataattatgtgataattagatttgttactaatattgataatacattatataaatttgga
ttcttcgtgttgtattttgaattgctctacggtgttagctttttaatgaatagacgtgta
ctaaagtttcaaactaatatccccatggcgcctacatcatataaaataacagaaaaaggt
attatagctactgatagatctggcgtatttttaccatcaaagtatctaatagatgcccaa
atttctcaaaatagagataaaaagtacattgagattaggtcttcatcaaagttcccattc
caggtgagactgtattcacaagatatagataaagtttccgaattaattgagagggtaaag
aaaatagagctcaaaaaacaatcctcagctgaaagt
>SSO0404 Cobyrinic acid A,C diamisynthase (CBIA)
atgaaaaggatattgttatcatcagatagaagtggatcaggtaaaacgcttataacctca
gcaataatgagagcactatctaaaaaatataaagtcagaggtttcaaagcgggaccagat
ttcatagatccaggatatcacaagattgccacaggttttccttcaataaacttggactta
tggatgatgggaaaaaataatgtaaaaagaagtctagcgaaatacggaaaggaattcgat
ataggaataattgagggagtaatgggcttatatgatggtgttgacacgctttacagcact
tatgagctagccaaggttactaagaccccaataattttaataattaactgctccaacata
gggagcactgtaggtgcaattgtaaaggggctaaaatattatagaagcgacgtaagtata
aggggtgtaatctttaataaaatagcttctgagacccattataattactgtaggaacgca
gtagaggatgttgaagttttaggctatgtcccatttgataagaatttagaaattaagtct
agacatttaggtttagttaccgtcgaagataatagagaagtacaaaacttaattagatat
gcctcagagttagtagagaaatacgttgatttagataagatctatgaaatggcttcagat
gaagatcttgaaatcgatcttccggaagataatgagagtaatggggtaaaaagaaaaatg
gcaatagcttacgatccagcatttagtttctattatcaagaaaacttggatatattgaaa
aataaatacgaattggaattcttcagccctctaaataacgaatatgtggaggatgcggaa
gccatatatatcgggggaggttatccagaacttcatctaaatgagttagaaaagtccact
agaacgaagaaatggcttaaaaatatgtcttacgcgggagtaaaaatctatgctgagtgc
ggtggactaatgtacttatctaaaaacctaatagacgaaaataataaaaaccatagtatg
actggtatttttgatattgatataaaaactaaagataaattaacaattggatatacagaa
ttagaggcagttaaagagaacttcatagttaataagaacaatgtagtcagggggcatgaa
tttcatgtgtctaaacccataagcgttaatgaaaaagaatttgtatttaaagttagaata
gggaaaggtattattaataaattggacggcgtaaaaagcaataacactgttgcaagttac
tctcacttacacttttctaactttcagctgaggattgttttt
>SSO0405 (pcnA-1) Proliferating cell nuclear antigen homolog (PCNA)
atgatatatcttaaatcttttgaaaggaatataagattgattaacatgaaagtagtttac
gatgatgtaagggttcttaaagatatcatacaagccttagccaggttagttgatgaagcg
gtattaaagtttaagcaagacagcgtagagttagtcgcgctagatagagctcatatttcc
cttatatcagtaaacttgcctagagagatgtttaaggagtatgatgtaaatgacgaattt
aaatttggctttaatactcaatatttaatgaaaattttgaaagtagccaagagaaaagag
gcaatagagatagctagtgaatctccagacagtgttatcataaatattatagggagtact
aatagagaatttaatgttaggaacctagaggtatctgaacaagagataccagagatcaat
ctacaatttgatatatcagcgactatttcctcagatggttttaagtctgctatatcagaa
gtttccacagttacggataatgtagttgtagagggccacgaagatagaatactaattaag
gctgaaggtgaaagcgaggttgaagttgaattttcaaaagataccggaggtcttcaagat
ttggaattctctaaagagtccaagaattcatattccgcggaatatcttgatgacgtctta
tctttaactaaactttcagattatgtgaagatttcattcggtaatcagaagccccttcag
ttattctttaatatggagggaggggggaaagttacttatttattagctccaaaagtt
>SSO0406 (metE-1) 5-methyltetrahydropteroyltriglutamate- homocysteine methyltransferase (EC: 2.1.1.14)
ttgataatgaatgtgaaaaaagccttagtgggtagttttccaaaaaatccaaaattaggg
aaagtaatttcatggtacaatacaggcaagataaataaggagaaactagagaagcatata
agtgagaatataaaaaaattgtttgagctagctggaaatatcaaactagagtatactacc
aatggactttttaggtgggatgacatagtggatgtaacatttggttttattagtggtact
gaaaagggtcccctacaaaggtttttcgataataacttctattatagacaacctataatt
aaggagaaaataaatgtaaagaagagagaggaaaactctttcctacaagatttggaattc
tctaggaaaattaaggaagaagtaagtttaccttcaaagttaaaggccgtaattccagga
cctttaacgtactatgtactatctgataatcggtattacaatagtccaatagaactaatg
atggattatgcatcagtggttaattcattatcacaagaactttcgagtgtggtagatgct
atagaaattcatgagcctgccatatatactaataacatcaagagagatattttagagaaa
ttaccggagatatacaaaagcatgttagataatgtaaaaatagagaagcatctaataacc
tattttgaaatcaataacttaaagaggctagatactctattctccttaccagtagactat
tttggtatagacgtgatagagaacttgaagaaacttgggagagtatatacatatttctcc
tctaggaaagtatacttaggtatgttaaatgctaggaatactaagatggagaggataact
acaattattagagtttataactccgttaagcgaaaaggtgtaagtgatgtaattataggt
aataataccctatttgattttataccagaggtagttgttgtaaagaaacttaaactttta
aagaaattagaaaaggtggaaatcaatgag
>SSO0407 (metE-2) 5-methyltetrahydropteroyltriglutamate- homocysteine methyltransferase (EC: 2.1.1.14)
atgagtaagttacctttacttcctaccactgttataggaagctatcctagacctaaatgg
ttaagggaatccataaggctccataaagctggtaaaatgagcaatgaggacttacaagag
gcctttaatgatgctgtaatagcagtttttcaagatcactataaggcaggggtggacgta
cctacagatggcgaagtcagaagagatgaaatggttgaattttttgccgagagaataaaa
gggtttaaattctatggtccagtacgagtgtggggaactgcatattataggaaaccctct
gttgtaagcaaaattgaatatagagaaccaatgttagttgatgagttcacttttgcaaaa
tccgtctcttatactgataacttaaaaataacaataactggtccttacaccatagctgaa
tggtcctataacgagtactatagaaataagaaagacctagtttttgatctagcgaaagcg
ataaatcaagaaatcaaaaatttagtagaagcaggtgctaaaataatacaaatagatgaa
cccgccttacatactagaaaggaagacgtaagttggggtgtagaagcagtaaatgaggct
gtaaaaggtgtaaatgctaagttggttatgcatatatgctatggtgattacagctttgtt
gcaccatactttaacgagattaaagttgatcagattaattttgcattaaaaatttacaac
tacaagcctttagagcttttgaagaagtatggtttcgataaggaacttggcgctggcgtg
gtagatgtgcataatagaaaggtcgagacgtctgaggaagttgccaatgatataagaaag
attttagagtatttcccaccagagaaagtgtggataaatccagactgtgggctgaaatta
ctttctagaaaaatagcctatcagaaactagtatccatggtagagggaacaaaggttgtc
agagaagaacttaaaaggaaaggatatagtgtagat
>SSO0408 (rpS13E) SSU ribosomal protein S13E
atgaacaagaggagggctaaaggtaaatcgcattccataaggcctgctagagctggagca
cctaaatgggtaaggttaaccagagaagaagttgaaatgctagttgaagaattggcaaaa
agaggttatactccatcaatgatagggataatattaagagatcaatatgggattccttta
gttaaacaaatagtcgggaaaaaggttactcaaatactggaagaaagaggtttagctcct
caaatacctgaagatcttttcaatctgataaggaaggcagtaaatgtaaggaggcatatc
aatgaatatccacgtgataaaacagcaaagaaaggattagaagagattgaatcaaaaatc
aggcgtttaactaggtattataaaggtattggaaaactaccacaagaatgggtttacgat
cctgcaaaggccgagctattagtagctggtgcaagt
>SSO0410 Conserved hypothetical protein
gtgctaggagttttgttagttttacatggtagcaagataccagaatggaaagacgttggt
attaagtatgccgaatatttatctaaatattttagtttggtggaatttggtttcttagaa
tttaataaacctacgctaagcgaagccctaagtaaccttctcgctaaaggcgctgacaag
atagtagtagttccattactatttgcaaccggaactcatttcagaagagatatcccaagg
ctactaggtatagacaacgatgaaaagaaaatacgatacatgggaagagaaattgaaata
acaatagctgatccattaggatttgatgagaaaataggagaggtattggttaaaagagta
aacgaaacttacaacaaaaactac
>SSO0411 (rps6E) SSU ribosomal protein S6E
atgccggacttcaaaattgtcatttcagatccacaatctgtagagcctaaaagaataaag
gtcaaagtaaaggcaagtgatcaagttaaatcaattactggggaaaaagatggaaaagcg
gtaccacaagctaaggttaatgaaaaaactaaacaattattaaatgttgatacgctttta
acattagaaataaccaaacaagaaggcgataaaaaggtaaaggtaaaaggtcattttaag
gtagatgtagataacagtgtaccagataacgaagtatggataagtaaaacaatggcggag
aaatttggagctgaggattttgaagcctttgcatataggactaagacgctacaaataagt
gttgatcaaaacaaggcaacgaatctagtcggtctaaaaataggcgatgtattcgaagct
aatcaactaattgggttaccagttaagttgaagataactggaggatcggataattcaggg
ttcccaatgcgatttgatgttattggggcagctaagcgtaaaatattactaagtgggcct
cctggattttacccgaatgaaaatggagaaagaagaagaaaaactatacgaggaaataca
attagccaggaaatagttcaaattaataccataatagtaagg
>SSO0412 (eif2G) Translation initiation factor eiF 2 gamma
ttggcatggcctaaagttcaaccagaagttaatataggtgtagttggtcatgtagatcat
ggtaagactacactagttcaagcaataacgggaatttggacatcaaaacattccgaagaa
ttaaaaagaggtatgacaataaaactgggttacgcagagactaatataggtgtttgtgaa
agttgtaaaaaacctgaggcatatgtaactgaaccctcatgtaaatcttgtggatcagat
gatgagcccaagtttctgagacgaatttcctttattgatgccccgggccatgaagttcta
atggctacaatgttatctggagctgcattaatggatggcgcaattctagtcgttgctgca
aatgaaccttttccgcaacctcagactagagaacatttcgtagcattaggtataatagga
gtgaaaaacctaattatagttcaaaataaggtagacgtagtctccaaagaggaagcgtta
tcgcagtataggcaaataaagcagtttacgaagggaacttgggctgaaaatgtacctata
atcccagtaagtgcacttcataagattaatatagattctctaatcgaaggtatagaagag
tatataaaaactccttacagggatctctcacaaaaacctgttatgcttgtgataagaagt
tttgacgttaataagcccggtacccaattcaatgagttgaagggtggtgtaataggtggc
agtattatacaaggtttgtttaaagttgaccaagaaataaaagtattaccgggcttaaga
gtggaaaaacaaggtaaagtatcttatgaacctattttcacaaagatttcgtccataagg
tttggagatgaggaatttaaagaggctaaaccaggaggtttagttgcaataggtacatat
ttagatccctcattgactaaagctgataatttgcttggcagtattattaccttagctgat
gctgaagttccagttttatggaacattagaataaagtataatctcctagaacgtgtagtt
ggagctaaggaaatgttaaaggtagatcccataagagctaaggaaactttaatgttgtct
gtaggttcatcgacgactttgggtatcgttacctctgtaaagaaggatgagattgaagtg
gagttaaggagacctgtggcagtatggtctaataatattagaactgtcataagtaggcaa
atagctggtaggtggagaatgataggatggggtttagtagagatc
>SSO0414 Conserved hypothetical protein
gtggagaatgataggatggggtttagtagagatctaaaagtactagttgatactaatatt
ttattgtacgtgtatgatggtttagatccatttaataaggtattagaatttctagattat
aaaccgtctttttttattcattctacagtcttaagagagctagatattttatttgagaag
aacaaaaaaggatttattatatcatctagaattaagatagccagaaaatatttggaagta
tataaaaatttatggaatttaataaatgattatgatgatttacctacagatgaagcatta
ataaggaccgctcttaagcataatatgtttatatttactaatgataaggaattaaaaaat
gatgcaattaaaaagggtataggagttttatttcttcagaataggagtaaaattataaaa
tccttatatcctatc
>SSO0415 (rpoE1) DNA-directed RNA polymerase, subunit E' (EC: 2.7.7.6)
atgtataaacttattaaagcacgtagcattgtgaggattcctccaaatgaatttggcaag
ccgttaaacgagatagctttaaacgaactaaggcagcaatatcaagaaaagatcctcaag
gatttaggtctagttttagctatattaaatgtgaaaaccagtgaggaagggatactagta
tttggcgatggcgctacttaccatgaggttgaattcgatatgataacctatgtaccagtt
gtacaagaggtagttgagggtgaggttttacaagttgacaactatggcatattcgttaat
ttaggtccaatggatggtcttgttcacatttcccaaataacagatgatacactaaaatat
gacaatgtaagaggtataatattcggagagaaatctaagaaagtgatacaaaagggtgat
aaggtaagagcaagggtaataagcgtcgcatctacggtaacaggtcggttgcctagaatt
gctttaacaatgaggcaaccctacttaggtaaactagagtggataacacagactaagaag
>SSO0416 Conserved hypothetical protein
atggaagtacgcaataataataaagtaaatctatgctttagttttgataatttaagaaat
gaactttctaggccatatggtattctttttataaataacaaaatctttttagagtttata
tctaaatcgatacaacgaggttctaggataattactgtaggagattacgtaagtagagta
ctagaagaaaatggcatagttcccttcttagaagtcatagatggaaaaactaagagaact
ataacacagaatagagccattacaagaaataaggaatataaggtaacaaatgaggcaggg
aaaattcgatttgaaatatttgaaatcatggagaatatcctaaaagatagggaaggtgga
gtagtttttgtagatggagaggaggacttactcgttattccggtcacattaagtgcaaat
catggtgatatagtaatttatggacaacccaatgcaggagcagttgtaattattgtaaac
gagatgataaggtggagagtaagagatatattagaaaaagctatagtaaaagaatgt
>SSO0417 Phosphonopyruvate decarboxylase (EC: 4.1.1.-)
ttgaagcaatataaaattcttttaatagtcgcagatggtttaggagatagaccggtatct
aaattaaatggattaaccccattagaagctgccaataaaccagccataactgacttgctt
aaaaactcaatgattggcttaatggatccaatatcaccgggtataattcctgggagtgat
acttcacatctatcaatatttggcctagatccacatgtttactataggggaagaggggct
ttcgaggcattaggagctggagctacgcttagccacggagatgttgcatttagaggaaat
ttcgctacagtgaataatgatctagttgtagttgataggagagcaggaaggaagcttgaa
gaaggagagcagctagtaaaggaattaaacgaaaaaattaaagagataaatgacgtaaag
attaaattttataaaggaacagagcatagaatagcagtagtattatccgggaaaggaata
agtgataaggttagtgatactgatcctcatcatgagggcttgaaagttctagaaagtaaa
ccattagaagattctaacgaagctataagaacagccgagatcatcaatatacttacgcgg
aaagtttttgatgtattaaattcctctgaaataaataagagaagaatagaacaaggagag
aagcctgctaacattgtgctattgagaggagccgctcattacgttaagttaccgccattt
tcaagctataccaaacttaaagctgcggctgtttcggctacagcactcataaaaggaata
tgtagagaactcggtatgaacgttataacgccatcgggtgctactggaggtatagatact
aattataacgccaaagctaaagctgcaatagaattattaaaggagaatgatttcgttttc
ctacatattaaagctacagatgcagcatcacatgatggattagtagaagaaaaagtaaag
gcaatagagaggatagatagagtaataggagctattatagacaatatcggaagagataat
ttaatattaatgtttactggagatcacgttaccccagtagaaattaaagaacatactgga
gatccagttccagtacttctctacgtaccttatccaattattaacgataatgtaggagat
tttaacgagaaggaggctagaaagggaagcctaagaataagaggattagacgtaacaaat
atattgttaaactactctaatagagcagagaaatacggttca
>SSO0420 (topR-1) Reverse gyrase (EC: 5.99.1.3)
ttgacaagcatcaataaagtcccaccctcaatttatactaggtcatgtcccaattgtgga
ggaaatatatcatctcagagattatttaatggttccgtatgcgaatcatgcctaaaggat
gatagagagtttagtaatttatctgatctcattaatatcctttctgaaaatagtaatttg
aaaaatcttactcaaatacgtgatgtattagaagagtacaagaaagttgaagaaatattc
ggtaaattattaaataattcaaaacctataggtcctcaaaggtcgtggacaataaggttc
ttaagaggagagagttttgcaatcatagcacctcccggtttaggtaaaacgacctttggt
ttaataatgtccctatataatgctactcgtaataggaaatctatcatcattttcccaacg
aggaccttaatctcacaaacagtagataaattggcaaaattttctgaattgtactcatat
tcgcctaggatactttataataagcaatctcctactcagactgagaacatattagaccaa
cttaagagtgggaattttgacatattcatttcaacgaatagatttgtaattcagaattta
tctgagttatcaaatataaagtttgacttcattttcgtagatgatgtcgacgctgcgtta
aagtctggaaaaagtgctaaggcgatacttcggttggtaggatttactgatgaagacatt
caaacgaccatgaaattacttagagaaaatattggggaggaggagaagtttggaaaaatt
caagagattagagaaagtaggttaaaggacaagatagtaattttctcctctgcaaccatt
agtagaggaaatcccatactctcatcgcttatgggttttagacccgggagttctgtgata
tatctaaggaatatttatgactcttatattgatctaactcaaacttgtaaaggacaagat
tttgaagagtgcactcttggtaccgttatcaaacttcttaaaagacttaatgatggtact
ttgatttttgtacccatagataagggtgcccaatatgcagactatctagcttcgaatttg
agagatcatgggataaatgtggaatctgttgcatcatcttctatctccaaactggagaaa
tttgaaagaggtgaggtaagctctttagtcggagtggctacacattacggagttttagtg
agaggaatagacttaccatggagggtaaaatattcaatatttgtggggataccaaaattt
aagttcaaaattggcgaatatatgcatccattagcgttaaccagattgctaagcttagta
tacttagtgaagaatgatgataaagtaaggggtctacttagttatattcgtaagaggtta
agaaaaataagccctgcggccttagcgatgttagctaaggatataagagagggaaagatc
gatgatgagaggttaaaggaagcatataatttagttaatgagtatctaaaagataatgag
tttttgaaaaaagtatctgatgttggagatttggtaatagaaggggattatattctaatg
ccagattacctaacctatattcaagctagtggtagaacatctagactttacggcgctaat
ttaactactggtctttcagtattattaatagataattctagattatttgagttacttaat
aaaaaattaaatttaattttagatgaagtaaaatggtattcactagatattgatgcagat
aaacttggacaagtaagtctaagcgatatctcagctaaaataacagaagaaagagagagt
ttaagtaaaatcaagaaagaaggaaacgtcgaatcatcatcccttagtgttaagactact
ttatttatagttgaatctcctaacaaggctaagactatttcaaacttcttttctagaccg
tctacgagatcatatggtaagcttagagtttatgagacagtacttggagatagagtctta
attgtagcagctagtggtgggcatatttatgatctaataacggaagatgaaagtgaaaag
caagatgacaactacgtgtatggagtactagtgaaagatagtaaatttattccaatttat
tctactataaagaaatgtgaaaaaggtcatcagatagtaaaagatctaagtcaaaataaa
tgccctatttgtggatccagaatagtaactgacaaaacagaagtagtagatatattaagg
aaactggctcttgaagtagacgaagttcttataggtactgaccctgatactgaaggggaa
aagattgcttgggatatatatctggctatccgtccgtttaatggtaatataaaaagggca
gaatttcatgaggttaccagaagagcgatacttaatgcaataaagaacccgagggaattt
aacgataacctagttaaatctcaaattgtaagaagaattgaggatagatggattggattt
aaattatcacgaaaactacaaacagaattttgggaacaacactgtacatctatatctaag
aaaaatagcaaagatgaagaatgcaaagaaaatcgtaatctaagtgcgggtagagtccaa
actccagtattggattgggtagttaatagataccaaaaatataacgaaaataagaagaag
taccttattatagagtctcaagataaatcaatctttccctttagtgtattggctttaaag
aagaatggcttatctaaaaatactcaaataattatacatctagaagatataaatataaaa
gaagaggaatttggacccttgccaccatacactacggatacactactatctgacgctgct
aaccttttgagaattcccgcatcagatactatgagagtagcccaagatcttttcgaatta
ggtttgataacttatcatagaactgatagtactagggtatcaaatgttggtataagtgta
gcagaaacttatcttaaatctaaacaagttgacatttccaaaatatttagaccaagatct
tggggagaaggaggtgcacatgaagctataagacctaccaaacccctagatgagacaatg
ttaaaggcatccatagaacaaggggacttagaactatccaaacaattgacttttaaccat
tttagagtatataatctaatatttaggaggttcattactagtcaactaccaccactagta
gtaactaaacagatagttaggataagggcgtatactaaggacaacattgaattggaattg
gatgagaataagaaggaatttgttattgggtataaattaaaggaaggagatgaatttaga
caaacattacaagacgctatttatactctatttaggctttatcaacctttagatgaaaaa
atgaaagggaaagagctttctgcaacaataacaggcacattaaataagagtgatgtgcag
ttatatactgaaggagagttgataagtgagatgaaaagtaaacaaatcggaagaccgagc
acgtacgcagtaataatctctactttaaagaagagaagatacattatagaatcaaaaaat
ttgaagaaaataataccaactaaattaggtatggcagtaaaagagtatcttatggaaaat
tataaacagatagtatctgagaaacgaactgtgaaattactggaaaagatgaacgaggta
gaggagggtaaagttgattatttagtactcttaaaagaattatataatgaaatacaaaca
attagt
>SSO0421 AAA family ATPase
ttgtcaacttcccaatctcgtatagttttaatgagtaagacttattttaaacgtttcgga
aagatgaataatatgtcccaacaattgaaattgagagtggtagaggctaggcaaagagat
gttgggagaaaagtcgccagaataacggattacactataagcagactaggcatagaaaac
ggtgactatgtagagattattggaccttctggttctgcgttagctcaagcattaatagga
gacggaattgcagacaatgagataagagtagatggttacattagaagatccataggagtg
ggtattggagatgaagttacagtaaagagagcacaagtacaagatgccactaaagtagtt
ttagctccaacacaacctatatcctttagtcagagtttcgtagaatacgttaaagactgg
ttaatggataaaccgataagcagaggagaaacaatttctgtacctacttatgttggctca
atagattttgtcgtagtttcgactcagccttcacaatcagtaaggattactggtaggaca
tcattagagataagacaagaaccagtaaaagagtctgcagcagtacctaaggtaacttgg
gaagatattggcgatcttgaagatgtaaaagagaaaataagagaaatagtagaactacca
atgagacatccagaagttttccagcatctaggaatagaacctccaaagggtgtactacta
tatggaccaccgggagttggaaaaaccttattggctagagcactggctaatgagataggt
gcatacttcacttcaattaatggaccagaaataatgagtaaattctatggggaaagtgag
caaagattaagagaaatatttgaggaagcagaaaagaattctccagcaataatattcatt
gatgaaattgatgcaatagcaccaaagagagaagaagttactggagaagtagagaaaaga
gtagtagcgcaattgttaactctaatggatggaattaaaggaagaggaaaagtaatagtt
ataggagcaactaatagaccagatgcagtagatcctgcattaagaagacctggcagattt
gatagggaaatagaaattagaccacccgatgctaaggctagaaaagagattctacaagta
cataccagaaacatgcctctagctgaggatgtagatttagataaaatttctgagcagact
cacggttacactggagctgatctcgcagctctggctagagaggcagctatgaatgcattg
agaagatttataaatgaacgcaagattaatctagaacaagaacaaataccagtagatgtt
ttaaaggaattgaaagtaacaatgcaagatttcattgacgccatgaagttcattcaacca
acactccttagagaagtatacgttgaagttccgaaggttaaatgggaggatattggagga
ctggaagaagccaaacagcaattaagagaggctgtggagtggccattgaaatttccagaa
atgtttgaaaagcttggaattagaccacctaagggtatattgttatttggtccacccgga
actggaaagacaatgctagcgaaggctgtggcgactgaaagcggagcaaacttcatagca
gtgagaggaccagaaatattatccaaatgggtaggtgaaagtgaaaaagcagttagagaa
atatttaggagagcaagacaaacggctccttgcgtaatattctttgatgaaatagattcg
attgcacccatgagaggctttacacatgattctggtgtaacagaaagaatagtaaatcag
ttattgtcagaaatggatggaattcaatcactaaatagagttgtagttatagctgcaact
aatagaccagatattttagatccagcattgctaagacctggtaggtttgatagattaata
tatgttccgccacctgatgagaaggctagaatagagatactcaaaatttacactagaaca
ttacctatagattctagtgtaaacctagaggagttagccaaaaaacttgaaggatatacg
ggagctgatatagaagccttagctagggaaacaacaatgaaagtactgagacaaaagtat
tacgattgcttaaataaagccaaaaaggagtgcaaagatcaagagtgcactgataagact
ataaagagttgcatgagcaatctagaaataaaaattactatgcaagatttcctagatacc
atgaagattgtaacgcctagtctaactaaagctgatattatgagatatgaaaacatggta
aaagaaataaagagatcggtgattggt
>SSO0422 Conserved hypothetical protein
atggtgaaaaagtttatgcttatagctttagtccatttaaggcttaaagaattgtcaagg
aaacataatctagagaaagctaaaaaactaataagacaagcaaaagataaaggtgcaaaa
ttagttatactaccttctctgttcccttctggaaacatgtttgaaatatacgataacgac
aaaaagctaagaagttttattaaaaaccttgcagaaaaaattcctggtaacaatactgat
actctaataaatctcgctatggatggggaggttcatgtaatagttggtcctattttggaa
caagctggccctaaaatattccttacttcccttataatatcgccacaaggagagattata
gggaaatataggaaaactgtgttatctgaaaaggatataaggctgggcatatcggcggga
aaagaaccagttaatgtagttcttgatagaaaatatggtattatcgctgaggacgatatt
ttctcgccagagatcagcagactactagctatgggaggttcagaaatagttattggtaca
atgaaggccctgggaaaagagcagcaggttataaaacatcttgccatagcaaggaccata
gagaacggaataccttatttgatagtaggggaaagtatagaggatgaagagggagaaatt
ataggatactcgccaactttcattacctctccagataatttgataagcaaggaggctgaa
gaagatgatagtttactatttgtcgaaagctcaatcttgtcatcgtcaaaacaaacgtca
ttaacttatctagaaccgataataaacggtctttgtaaaggtgtaaaaaagattaaaggg
gaggcaaagaagagatctgcttctacaatggaagaggag
>SSO0425 (rps25E) SSU ribosomal protein S25E
atgggtggagcttcgaagaaacctatttcaacaatggaaaagagattaaagaaggaagct
gaaaaacaacagaaggcagaggagaaaaagaagggtccgtctaaaactgggaaagagata
attagtagagctgtaactatagatgaagaaactaaaaagaaagttctagatgaaataaag
aaggagagtatcataaccccgtacgccttagctaccaaatcgggaataagcattagtgta
gctagaaaaatactaaaggagttagaaaaccaaaacgtagtaaagttatattctaagaat
agaagattagaaatatatatagcagcatct
>SSO0426 Conserved hypothetical protein
atgtcatctgaattattagaagagaccataagcagagtatcaaagtttgcttcaattttt
ggaatatcaaaatcggaattaaaagtttattcatatctcttaatatatggacgagcaact
gcgagagaagtctcaaacaagttaagcttaccatacactaaagtatataatgtcctatct
aaactagagggaagagggtgggttataaaaatagataagagacccgcagtgtacgaggca
attcctttaagagatgtttggaataagattaaaattacttttcaagaaaaattggacgaa
tttgaaaaacaatttatcgagccgatatctagtattttctcctcaaatatggcatataat
atagttgttataccaagagataatattatggataatgcactaagactactcaaggactac
agcaagatgtatttagttgcaatatcctatcaagagttcgtaagaagcgatattatagat
atattaagggctaattcgcttaaagcagagactaaaataatagtcgacaaaagcgttaat
ttaccagatatctcatcagctcaagttaagagagctcaatcgctatttggcagtggtata
atcacatctgactcaattctcctagtcataaagaataatgatatattaactggtctattt
tcaaatcataaatatctaatagacatcggcacagtatattttaatcacttatggtctaca
ttaccggga
>SSO0427 Protein L-isoaspartate methyltransferase
atgatgccattaaacgaaggagatccggtagtaatttggatagatccaaaaagagtatat
atttccaaactggaaagaggcaaaaggcttgatactgataagggagtagtattttacgac
aatttaataggtcttgaatatggtacctcactaaccttgaaaactggtgttaaagcctac
ttactaaaacctactatccaagatctctactccaaagggttaaagagaccctcacaagtt
ctatatcctaaagatataggatacattttaactaccctttcactaaatcaagtaaagaca
gttatcgaagctggaactggttctggatttcttacaatctccttagctttaagtttaagt
gagaacgctaagatctatacttatgatataagagaagatatgcaaaaagtagctaaattt
aacgcaaatgtgttgggtgttcaagataggatagtattcaaattgaaggatataagggaa
ggtatagacgagaaggaggtagacgcaatttttctagatatgcccgatccatggaacgcc
ataccaaagctttatgagtctctgaaaccttcgtccaccataattatatttgttcctaca
gtaaatcaaatagagaaaacatacttcgcaatgaagaattctggaattatagatattcat
gtagaggaacttatcttgagggagtatcaagttaaagagaacgctataaggcctagaaat
ataggtatcatgcatacgggttttattattaggggaagaaaatcaata
>SSO0428 Hypothetical protein
ttgatgagtgaagttaagtttaacgcatattctaaagcgataatggagtttgaggatgaa
ataaagagaataaagaaagagatagcagatgatagtaaaagattaatcaccctttcggat
tcttatctttctgagttaagggcaactgctgagaaatcattaggagatgttcagaaatta
ttgaacgatgagaaaaaaaggcagttagatgagataagaaataaatatatttcagaacga
gaaaaacaattagaggagataagaaaagaggctgagaagaatatcgataaggttgtaaat
gaggttataaggcaactattaggtgtctttaaa
>SSO0429 Hypothetical protein
atgagttatgcgatctattcttttatacattcaatttccagaacgcaaaaggtttcatta
ttaacaaaaggtttagttaatgaattaataagtagtgaaagttggaataatgttgcctct
ctgcttaaagaaaggggaataattgaggaacaaccagctagtttagaagattttgaatac
atgctcaagtctagatctcttacactattagaaaagataaggaattacttttcaattttt
agagtaacctataatatagttgacctatatatttatatgatatctctagacgaattgaaa
aacataatagttagtatagttaacggcactggtaatggaaatagtaataaaataagattt
tttagaaagtactttgatcaaataccatcttcacttgaggaattaatgaatagttttaag
ggaaatgtatacgctaatgcactttcatacgccattaaggatggacagggaaaaaatata
tcctatcttctatcgctacttgatatctatttcataaagaaactatcagagattatagaa
ggtttcaagggagattggaaaagccttgctgaaaatataatatgttattataaagattac
tattcaatatcattggcaattaaacataaaacagtagagaatactgtttgtaaaatcggt
accgagatacttaaagatctctcttcttccacaagtgatgctgaaacacttgatatttta
agacgaactcaatactcaaagctacttaacgtaaatagcacttatggggcgctcgctagc
atgtatagaatagcgagaatcaacgccaggaagaactcagagctagtatttatgagttct
ccatttaaccctgccttagcattagcattagcagaactaatacgtcttgatacggaagat
ataataagtatagcgaatgcgaaaagcctacgattaaaggaagaaaaaattaagaatatg
ctatccttcgagatcata
>SSO0430 Oxidoreductase
ttgcttttcgtttaccttaactctcataactatcatctttatttttattatttaaaatgc
aatgataataatggtcgatattacatgctctacagacgcataggtgatactaacattacg
gtatctgaaataggtataggggtatggagtttggttaccgattggtggggagctgataca
aataaggcggaggatataataagaagggcgtatgaagtcggaattaatttttacgacacc
gcggacacctatggagagggtaagggcgaggaaattattgcaaaagttttagagactaag
agagataatatagtaatattaactaaaataggatatgacttttatcataaagagggaggt
aagatacgacaaagatttgatataccatatcttgaatttgctttaaagagatccctagaa
agattaagaacagactatattgacatacttatgattcacaatcctaagatgaatgctatc
aaaaatctagagatcctatcttttcttagatcgttaaagaaagatggaataataagaatg
tatggtgtcgcattaggcccaacattgggttgggaagaggagggaattgaggccataaat
atgggttacgaaagtctcgagtatatatataatatcattgagcaaagaccagggaacaag
ttcctaaagtacgagaaagtaggccatataataagggtgccgcatgcttctgacgttcta
aatgaggacaaatggccactaatttctgatcctaagcttcataggtcgttaaaggatatt
aaatggctaaatgaaggaatcaagagaagcttaaaattaaaggaatttgcaagttctaaa
ggaatgacgttatctgatctagcactgaagtttatcctctctaataagaacgtatccaca
gtgattcctaatataacttccataaatgaattggagaaatatgtaaaagttgagaatttg
tcaattcttactgaagatgatttaaaatatattggagaatactataggaaatattatgaa
gatctaaatgaggatagtataaaagaaactttaaggtataag
>SSO0432 HAM1 protein
atgttgaggagaggcgtaaaaataggagtattaacgaataatgaaaataaatttatagag
ctgaaggaaattgcaaagaattttaatatagagttagagcatctgagaggagagaaaata
gaaatacaaagtgatgacttagaagaaatatctagaactgcagcaaatttggcatatttg
atatttaggaggccattaatagtagatgatagcggattattcgtgcaagcattacagaat
ttccctggtccctatactaattttgttaagaatacaatagggcttaaaggtatactaaaa
ttgctcgaaggaataaaagataggtctgcctattttatgactgcactaacgtttactgac
ggaaaaataattaaaacatttattgggatcgtaaagggagctatttctgaagagattaga
ggtaatttaggtttcggatttgaccctatatttatacctgaaggagaaaagagaactttc
gcagagatgtcattagaggagaaaaataggtactctcatagggcaagggcttttgctaaa
tttgcagaattcttagagagttatactgaaaaagaa
>SSO0433 O-sialoglycoprotein endopeptidase (EC: 3.4.24.57)
ttggagaaattaaggttaattaagcgtggcgcagaatccaacatatatgaagggtatttt
ttaggcatacatgcaatatttaagcaaaggatcaagaaaagttatagaaatccagaacta
gatcacaaaattaactatgagaggacaatactagaagcaaagataatttatactgcactg
aaaaatgacgtgaacgtacccgcagtactttttatagatcctaataattatttattggta
attgaatatatagaaggagagatagtaaaagatattataaacacaaataatcctacacaa
ttgttgcctaatattgggaagagaataggggaacttacgggaaagttgcataatattgga
atagcacacggtgatttaactaccaataacctaattttaagctctacaaatgacgatatc
ttcataatagatttcggcttatcaagaagaactcaagatgaggaggatttcgcaacagat
ttgcatgtatttctgagatctttagaaagtgtacattctgattttaaagatataatatac
gatgcatttatagagggttacagaaaaatcatgggaagaaagactgatgagatattagaa
ctagtaaaggatattaggatgagaggtagatatgttgaggagaggcgtaaaaataggagt
attaacgaa
>SSO0434 O-sialoglycoprotein endopeptidase (EC: 3.4.24.57)
ttgagagttggagctacactagcgagagcaatagcattgaaatataataagaaactagtg
ccagtaaaccatggtataggacatattgaaatagggtatttaacaactgaagccagagat
cctctaatcttatacctctcaggtggaaatacgataataaccactttctataaaggaaga
tttagggtttttggggagacattagatattgcattaggaaacatgatggatgtatttgta
agagaggtgagcttggcaccaccgtatattataaatggaatacatgtaattgatatttgt
gcagagaagggaaataaattgcttaaattaccttacgttgttaaaggtcaagatatgtca
ttttccggattacttacagcagctttaagggttgttggcaaggaaaagttagaagatatt
tgttactcagtaagggaaatagcatttgacatgttgttagaggctacggaaagggcatta
gcgcttacctcaaagaaggaattaatgatagttggaggagtagcagcaagtgtgagtttg
agaaaaaaattagaagagttaggaaaagagtggaatgtacaaatcaaaatagtacctcca
gaatttgcgggagacaacggagcgatgatagcctatgccggtatgttagctgcatctaaa
ggtgtatttattgacgttgataaatcatacataaggcctagatggagagtagatgaggtt
gatattccttggagaaat
>SSO0435 (rps24E) SSU ribosomal protein S24E
atggagtctcaagctaaagtgaagatctcagataaggctgaagggattatagaaagggat
atgcaaaattctgtcataggtaggcgtgaaatctcattaaaagtttatcatatggggagc
ggaaccccatccaggaaagatataataaaggcaataattcaagctttgggttcccaagaa
aacttagtagtggtaagaaagatatctacaagctatggagctggcataagtaacgtgaaa
ttacatatttataaatcccgtgaaatattagagaaagttgagccaaaatatttattagat
agagatgctggaactaaacaaaagaaaggaggaagcaaaggtggccaaggagcaaaaggt
>SSO0436 Thiazole biosynthetic enzyme
atggaagttaaaattaagcaagtagatgaagtcaagataagtaggtacataattaaggaa
acaatggaagattggtaccaatttgtagagtctgatgttgtaatagtaggagcaggacca
tctggattatctgcagcttactacctagctaaagctggattaaagacgctagtgtttgag
agaaggttaagtttcggcggaggaataggcggaggggcaatgctattccataaattaata
atagaaaagcccgcagacgagattctaagagaagtcaatataaggttaaaggaagtagaa
gagggagtttacgttgtggattcggctgaattcatggccaaattagccactgccgcgata
gatgctggtgctaaaataattcatggagttaccgtagatgatgtaatatttagagagaat
cctttaagagtagctggagtggcagtagagtggacagcaacgcaaatggcaagccttcat
gtggatcctatatttatttcagctaaagctgtagttgacgcaactggtcatgacgctgaa
gtaatatcagtagctgcgagaaaaataccagaattaggaatagttattcctggcgaaaaa
tcagcatatagcgaaagggctgaagaattaacagtaattaacactggaaaggttgcagaa
ggtttatacgctaccggaatggcagttaccgaagtaaagggattacctagaatggggcca
atatttggagctatggtactttctggtaaagcggtagcgggggagatcactaaggatctc
ctaaaaagcgaaataagggct
>SSO0437 3-octaprenyl-4-hydroxybenzoate decarboxylase
gtgttatcaacaatggttagcggaatggttaaggaagcaggaacaaagaacaggagggaa
aaaacaaagaggattattatagggataagtggggcaagtggaacaatatacggtattagg
actgtccaatttctaaatgagcttggttatgagatacatatcataatttctaaaagtgcg
gagaaagtagcacaaaaggaactaggtatcaatttaatcaatgaactgaagaagtattcc
tcttatatttataatcaatcccagatcgaagcttcaccttctagttcaagcttttccata
acttcaaaaggtatgattatcattccatgtagtattaaaactcttgcagaaattgcaaat
ggtattggatcgaatcttctatccagaactgcattaaatttcatcagaacaaataaaagg
ttagttctagtaattagggaaaccccattaggtgctatagaacttgaaaatgccctaaag
ttagctagattgggggtttatataatgccagcttctcctgccttctatatcttaccaaaa
aacattgatgacatgattaacttcattgtaggcaaggctttagacttactgggaataaag
catgatatatacaagagatggaaggga
>SSO0438 Hypothetical protein
ttgaggaacggaaatagaggctttgaaagacagccctcctttactgatgagcagaaacca
atgcctttaggagataagtgtaactatttgtgtccatatttcaggtgtaataagagagca
ctattagttcaagtaaaatacgcaaaagggaatccatacaaagtcggctattgcagatgg
gtaggagatgtatgtataactggtgaatgccaatacgcttattgtgaaaagagagcacta
ttacctggtaacaaatgcgcatttgccattaacaagaagaatgaaagggataatgaaatt
gaaaaagaacttgaaaaagaggattacgacgataaaatgaaagagataatatctaagaaa
tttggcaaaaaaggattagatgtctta
>SSO0439 tRNA intron endonuclease, putative (EC: 3.1.27.9)
atggtaaaagctttattggtaggatctaaagtactagttccaagtatagatgagtcaaga
tacctttattcaaatggtttctatggaaaacccataggaatttctaagccaaaaggccct
aaagatatagttagacctctggaattgtcactaattgaaagtgtatatctaactaagaag
ggtttaattaatgttgtggataaaaatggcgaccttcttgagtataagaaattatatgaa
tatagtgcaatgaagattaataaattcgagatcttatacaaagtttatgaagacttaagg
gaaaaaggatttatagttagatctggagtaaagtatggagcggactttgcggtatataca
ttagggccaggattagaacatgcaccctatgtcgttattgctgttgatattgatgaggaa
atcacacctcatgaactattgagtttcggtagagtctcacatagcactaaaaagagatta
gtattggctctagtggatcgtaaaagtgaaggtataagatacataatgtttaaatgggtc
aaaatg
>SSO0440 Hypothetical protein
atgggtgaaggaatagctacacttgcaatagaggagcaattgcaacaaatatcattaaaa
ttattggatgaaactagagttttgtatgaattcctatctaataccagtaattcaaatgta
aatgcaatgcaaatctattctaaggtaaacggtataaaaaacgatatagaggttagcaaa
tacagattaggtgaatatatattcaaaataagagaaggattattagataaggatttatat
gtagaaatattgaataatttagagaaagtttcacaaaacctagacgctgctacatatagg
ctaagtgttatactatctaaacaaatgaatattgacaacgtaataaatagattacttata
gttatctgtgaaaaaataattacatctattacctatttcatagaggcattaagattacta
tctgtcaacccgaaaaattcctatgaaaatgcacgtaacgtaataaaattggagcaagaa
atagatgaattgtataggagtttagaattagcactatttgagaagaagctcgctgacttc
tcatatataatgttacttaaagatatagctgacagattagaagatagtgaggatctattg
aagagttctgctgacaatataacctatatcgcatatgagaggatg
>SSO0441 Hypothetical protein
atgaatgaaagtgatatggtaataagtagagtattatttgattttgaaacaataataaat
gatcatactgaatatttgaatgagttagagaatttggtagcttttcccaaccctgacata
ggaaaagctactagactggttaggaggatgagaagagttagaaaagaactcttccaagga
ttagaagttataatccaaaatatagataaaacaaccgataatcaaattaaagaagaagcg
cttggtttagttaattatttggtaatagtgggattaaaggatgaaaaagaacttctaaat
aatctgaataattatttgaaaggaaagggggtaaatattgaaatagataaagatttagaa
caaatagaaaagattatgaatagtgtgtcacatcttaatttt
>SSO0442 Conserved hypothetical protein
atgatagtaatgagtagtaacgagaatgaaaaggaagaggagaaaaaggttgatataaaa
acccttgttagtgttatacctccagcttcagcattaaaggggaacaaagccccaccaaag
gagaaaagaatcaagatcagaaaaagaaacgatgttgataaggggtttgcaataatttca
tcgaaattagcaaaagatctagggattactgataatattgaaatatcagttaaagggaaa
agaataagattaaaagctatattgcaagaggggataccagaattagaggtctgggctaat
cctcaagatctggttacattgggcatagaagataatagtacggtaactgcgagggcttat
aaa
>SSO0444 (glyS) Glycyl-tRNA synthetase (EC: 6.1.1.14)
gtgagtgaagtaatagataaagtgttggacttagctaaaagaagagggatattttggtta
tcgtatgaaatttacggaggagttgcgggattctacgacataggaccagtaggtgtaagg
attaaaaatagaatagtagagctatggcgaaaatatttcgtgaaggataatggcgatttt
gtagtagaaatagaaagtccaatgataggaccagctaaagtgtttgaagctagtgggcat
gtagaaagttttacagatcctatcgtggagtgtaataattgcaaaagaatatatagggct
gaccatttaatcgaagacatattaaagaaaagcgtagagggtcttaagccagaagaacta
acgaggataataaaagaaaacaacataagatgccaatattgtgggggcgagttgggagaa
gtaagattgtttaatttactttttaccactaacataggtccttatactggtaatttaggt
tacattagaccagagactgctcaagggatgttcactgcatttaaacgcgtatacgaggct
actaggcaaagattacctattggaatagctcaaatagggaaagtaggtagaaatgaaatc
tcacctagacaaggactaataagaatgagggagttcaccataatggagattgagtttttc
atagacccagaggataataatattgaaaatataccgttgtatagatttaaggatactaag
ctcaatattttgactgcaagtgaaaaggaaaaagatggtaaaccacaagagttcaagtta
gaagagagcgtaagagaaaaaatcattatccagccttggatggcatattggatggctgta
gcatcgagttttgtcaaggcgttaggtattaatgaattttattttgaggaaaagttacct
tacgaaagagcacattattctaaacagactttcgaccaaatagctgtaattaatggtata
aaggttgagatttctggtcatgcatatagaggagattatgatttatcaagacatatgaaa
tatagtggacaagatttgactattttcagaaaatataaagaacctaaaatgattaaaaag
aagactgttatagttaacaatactaaattaaaggataaggaactaagaaaaaagatcatg
gaactgttaaatgggaaatccgccgaggaaattgaacaaatgattagaaacaacgtgatg
atagatgacaaacctttaagtgagttcataaatattgttgagagagaagagaaggttcac
ggtgagcacttcataccacatgttgtagagccttcattcggtgtggaaaggacattattc
ttaacgatattaagtgcatacaaggaaaaagagggcagagttttactatccttacctaga
catctggctccttatgacattgcagtttttccactactggagagagaagaactaattaga
aaatcagtggaaatacgagaaagtctttccgaaaaatatgaagtgttatacgacgattct
ggaagtattggaagaagatatgccagagctgatgagattggtataccttttgctattaca
gttgatcctcagacactagtagataacagcgtaacaataagggatagggatagctggaag
caagttagagttaaaatagatgatcttaagatttctctagaaaagttatttagaggggaa
gcctttaataagattggaattgaggtgaatgatagtaatgag
>SSO0445 (speB-1) Agmatinase (agmatine ureohydrolase) (EC: 3.5.3.11)
gtgagcgatggaagattactttatttaaatgagaatagtaggaaatttgctggatttaac
aaggaaaaatccccatttgtaataattggaatacctatggacattacgagtagttatagg
cctggaagtagatttgctccgtcttcaattagagaatcggctcaatatattgaattttat
tcaatacgaaatgatgtagatatgggggaaataggtttcaatgatgtaggtgatataatt
ctacatccttcaaacgttgaggagaatttaagtagaatatccagtgtgattagttatttc
caagaaagtgggaagatcactatttctataggaggagagcatacaataaccgcgggaata
ataaaggggactaagagagaaggattatgcctagttagcttcgatgcacatttagattta
agagacgagtatatgggatatagatatgatcacgcttgtgttatgaggagaatatctgaa
tatggtgtgaaaattattgaagtcggtactagggcagttagtaaagaggaaatagaatat
gctaaacaaaagggtatactcttcttcacccctcagcaaattagacttttaggagtcaag
gaaactgcaagaagaataattacctcaacgcaagaatgtaaatcgctctatatctcagtt
gatatggatgggatagatccagcttatgcacccggcgtagcaacaccagaaccagatgga
ttagaccccactaacctgttagatattattaacttaattgcagataaaagagttataggg
tttgatattgtggaagtttctccttcttatgacacctcaggaataactagtgtattggct
tccagaataattctggagacagcagctacagtttataaagctagatcgctt
>SSO0446 (TFB-1) Transcription initiation factor IIB (TFIIB) homolog
gtgttgtatttgtctgaagaaaataaatccgtatccactccttgccctcctgataagatt
atctttgatgcagagaggggggagtacatttgctctgaaactggagaagttttagaagat
aaaattatagatcaagggccagagtggagggccttcacgccagaggagaaagaaaagaga
agcagagttggagggcctttaaacaatactattcacgataggggtttatccactcttata
gactggaaagataaggatgctatgggaagaactttagaccctaagagaagacttgaggca
ttgagatggagaaagtggcaaattagagcgagaattcaatcttccatagatagaaactta
gcacaagctatgaatgaactagaaagaattgggaatttactaaacttaccaaaatcagtt
aaagatgaggctgcattaatctatagaaaagcagtagagaaaggattagtgaggggaagg
agtatagaaagcgtcgtagcagctgcaatatacgctgcatgtagaagaatgaagttggcc
agaactttggatgagatagcccaatatactaaggctaatagaaaggaagtagcgagatgc
tatagactattacttagagaactagatgttagtgtaccagtaagtgatcccaaggattac
gtaactagaatagctaacttgttaggtctaagcggagctgttatgaaaacggcggctgaa
attatagataaggcgaaaggttctgggttaactgctggtaaagatccagctggtttagct
gcggctgcaatttatatagcatcattactacatgatgaaagaagaacgcaaaaagagata
gctcaagttgcaggtgtcacggaagttactgtgagaaacagatataaagagttaacacaa
gagctaaaaatatcaatacctactcaa
>SSO0447 Hypothetical protein
atgctgttatacgtcgtaataaagactcctaatttgcttcagtttccagaatttattcct
aaaaaggttacagttaacattctggatataagggttgatggggagaaaggtaagctactt
ctcgagatacgtggagacgaaaccagcgctaagcaagtttgtgaagaacctattaaagtt
tcaaagtataaatttatctgtacaaattatatttcaagtgagttacttaagattttatcg
caatatactataatgaatggtgctttaacagatgatggaattttttggactttaatacta
aacggttatacagagcttagggaattacttaactcgctaatagacattacaaaagaagtt
agagttttaaaagttgtgaaagctgaaaagaaagatgcaataactgcaaggcaggagcaa
atactaaggattgcattagaagctggatttttcgactatcctagaagaataggattaaaa
gatctggctaaaaagttaaacatcagtccatctagtctaagtgaaattataagaagagct
gaaaagaacgtaattacagcttattttgaagagagggaacta
>SSO0448 (hisC-like) Histidinol-phosphate aminotransferase, putative (EC: 2.6.1.9)
atgaaacatggaggatacccttggaaaaatggaaaaccagctttagacgttaaagatttt
agcgtgaatcttaatcctatgggtgtacctaagttcattgaggaattaattaatgaagcc
gtaaaacttaaagtatacgcgtattatcctcctcaaaaccttagagagataaaaggtata
attgccgaaatttacggagttaatgaagatttagtaggagttttcaatggtgcttccgag
gtcattagtatacttgacgagaacttcactgttccacagcctaattacagtgaatataaa
tttcatagctattattttgcagaagaacatgaagacgaatttgttttcgagttaaatcca
ggtaggatattaactagcaatccaaataatcctaccggatctttaatcaaattagacgaa
attgaggaatttcttataaatgagaaaaacgaacttattctagatgagtcatttattgat
ataagcttggcggaaagcgcgactaagctagtcaacgaattcaacaatttgacaattata
aactcatttacgaagagccttgcaattccaggattgagatttggtttttcaataggacat
aaaagtaaggaactggaaaaacgtgtaccaatttggcggattaactctattacctattat
gttatatctaatttaaatcctaaggaagtaaggtctttttttgtgaatagcaaaattaag
gtgaaggaaatttacgataaagtagatggcgtgaagaagctgttcaaaatgtataaatct
tacgcgccgttttttctagtagaatttaaaattcccacgagcctgattaacgatgaacta
attagaagatgtaaatgctatataagggatgctagtaactttttagggttgaggaatacc
catgccagaatagctttgaagaatgaggttatagaattgattaataatataaatgaaatt
atatctgaaaaagaaagt
>SSO0449 Conserved hypothetical protein
gtgtcattactaatcaggctcgctaagtttgctttagttggtggtttaggcacaattgta
aatgaagtcacttacgttttagcctctaagactataccaattggggtttctctagccatt
gcaatcgagatttcactcatctttaatttcgtcttaaatgatatatggacattcaaagat
aagaggaataattcgtaccttaatcgtttattaaaattccatggatcttcttaccttgga
aatatagtccagtatattgttgcattggttttattggtatatttgttgcatatttcttct
atttctgatgcggtgtttatattgttctttagtaaactcgctgcttcaaccttcacccta
gtcctaacaaatttcattggaattgtatccgggtttgtagtaagatttataactagtcta
aagtatgtatgggct
>SSO0450 (alaS-like1) Alanyl-tRNA synthetase truncated homolog (EC: 6.1.1.7)
atgacagaagaactctatctaaaggattcttacattaaagaattcgagggaagagtagtt
aggatagaaggtaactacgtaatacttgataagacagctttttatccaggtggaggaggt
ttagataacgatactggattcctagtcaatgagaaaggggagagaataagcgttactgag
gtaaaaaggggagaaaacggagagattttacataagatagatcaaaatggttcccttaat
gttaatgaaaaagttataggcacaatagattgggacagaagatatagaatgatgcgatta
cataccgcttcgcatatagtcgctgcattggcttatagaaaattcggagctttgataacc
ggagggcacattagcccagaacaagctaaggacgattttaatgttgaaaataaagatacc
cttattgagttaataaatgaagctaacgaaataatcaaaaaagacatagagttgaagatc
tattttctacctagggaagaagctctaatgataccagctatagtgaaactagctggaaga
aatccaccacagattcccatatggcgaattgttgagattccgggtatagatatccaagct
gatggtggacctcacgttaagaataccaaggaaataggagaaatagtattacttaaagtt
gaaaacaaagggaaagggagaaagagagtttactatactgttaaacca
>SSO0451 Conserved hypothetical protein
ttgtttccgtcagtatttatctttactctattatattctagttctttccacctaagatct
aagtatattaccacgttatcagttgatacgaagatgtcgtattctggatcttcatcttct
ttaatgaacgtgtttggcatattacttatttccgattctaataatttaaactcttcacat
tatgtgtttgatcttataagagttgatgaggtaagatatatattagccatgctcggaaag
gattttcagaaaatgtggggttatgaggaaaataaatttaaaataaagggctctaaagag
cccttaaaatacaagttggttcaagctcactataaaatcagctccatgataagtaggctt
gacgcttacatttccagaatgcaagaaagagataaaatattatttgaaagagtcgtagaa
gcacaaatgtctaaggatacacaaagagcagcaatgtatgctaatgaggtagctgaaatt
agaaagatttccagacaattattaacaactcaaattgccttagagcaagtacaacttaga
ttagagacagtaactgagttaggagatgtgttcgtaaacttgatcccagtattgggtgtt
attggtgaattgaagtctgccttaagaggtataatgcctgaagtttcgttagaactgaca
gaattaggagaaggattacaagaaatagttaccgagtctggagaattcacaggtatggga
tcttacgcagcagcatcttcaccagaggcaaggaagatattggaagaagcatctgttgtt
gctgaacagagaatgaaggagaagttcccagacctacctgtcggtaccggattagcctct
aaatctaattcc
>SSO0452 (trpS) Tryptophanyl-tRNA synthetase (EC: 6.1.1.2)
atgtattttcttactacaatgccagatgaatttactgtaactccttgggaagttaagggt
aaagttgattatgataaactaattgttcaatttggtactcagaaaattacagaagagctg
aaacaaagaattaagaacttagctggggatttgcatgtcatgctcaggagaaacgtattt
ttttctcatagggatttagatttagttttaaatgactatgagaaaagtaaaggattcttc
ctatatactggaagagcgccttccttaggtatgcatataggacatctgataccattcata
tttaccaaatggctacaagagaaatttaatgctaatttatacattgagataactgacgac
gagaagtacatgagaaatccagaatttacattagatcaaactaggagttgggcttacgat
aatattttagatataatcgctgttggctttaatcccgataaaacgttcatcttccaagat
acagagtacataaggaatatgtatcctataacagtgaaaatagcaaagaagctgacgttt
tcagaagtaagagctacttttggattagacgcatcctcaaatataggtctcatattttac
ccagccctacagatagctcctaccatgtttgaaaagaagagatgtctaataccagccggt
atagatcaagatccctattggagattgcaaagggatatagcggaaagccttgggtattat
aaggctgcgcagatacatagtaaattccttcccccactcacgggtccagagggcaagatg
agttcttcaaacccagaaacggcaatatatcttgtagatgatcctaaaaccgtggaaagg
aaaatcatgaaatacgcattttcagggggacaacccacaatagagttacataggaaatat
ggcggaaacccggaaatagatgttccctttcagtggttatattacttctttgaggaggat
gataataggattaaggagattgaggaggagtatagatcaggcaagatgttaaccggtgag
ttaaaacagatattaatagacaaactaaataatttcttagaagaacacagaagaaggagg
gaagaagcaaaagaacttgtacatgtatttaaatatgatggtaaattagctaagcagatg
tgggagaagattcacgaa
>SSO0453 Conserved hypothetical protein
atgttttcttcctcgctcacgagttatgtgtatactaaaccaattatattaatcttttcc
caaaatctatgtaagatgataaaaataggtacatgtggatttacgagaaagcatttcaat
tattttgatgttcttgaggtccaagagactttttacaacttcttatcagaagaaaggcta
aataaattgaaggaactttctatacggaataaagttgagctaactattaaggctaatcag
ataattacacatgaatataatagaattacatataagagatttaagaaaattattggggac
gtcaaaaactacggatattttagaccaactaaagaagttatgcaagctctggaaatcaca
ttaaatgaagcaaaatttttaaattctaggattataatatttcagacacctccatccttt
gcaccaaataatgaaaacataaaaaatcttaaagactttttcagtattctagataaatca
tttatctatggttgggagcctagaggagaatggaatcaaaatcatgaagttctgcttaaa
atattttctcaaattgatgtaattcacgtagtagatccattcaaaaacaagtcagtagat
gataagcaaattagatattttcgacttcacggtttaggatccagcgaagttaattataga
tataaatacactaaggctgatttggagaaactaaaggaatatgtgttatctgaaaggaaa
gagctaatttacgtccttttcaataacgtttactcgtttgatgacgctttaagttttaaa
aggatgattgaagga
>SSO0454 Hypothetical protein
gtgagcgaggaagaaaacattgaaaaagttaagaaaatgtatgaagaaggattaagtatt
agagagattgcaaatcaattagggttaagttattccaaggttcgtagaatgctaattaag
gctaaggttaatttcaggggaaaagtgcctaacgataaaatacaaaaaatcatagaaatg
ggtaaacaaggttatagtgcaaataggataagtagggaattaaatatcaactttaatacc
gtattaagaattcttaaaaaatacaatctaggtaaaaagagaagaaagttggatgcaaag
gaaatagagaagataagagaagagtatattaaaggaaatagtatatataggatcgcaaaa
gagctcaatatttcaactaatctcgtggtgtatcacttaaagaaaatgggtttatataga
cctattcgtgaatcttctcccacatctgct
>SSO0455 Conserved hypothetical protein
atgttactcacttacttgggcttaggaattattcttggtttatccatggctgcacctccc
ggaccggttaatgcaatgatcgcaaatgagtctatgaaatcgtggcttcatggaagtagt
attggggcgggagcaatgacagctgatttaattttctttataatagtttacttcattcaa
ggatacatccctacaccaattagaaatgccctatatataataggtggtattttcatgtta
tatttatcgtacttaacaattagagctaaaatgccttctaagtccataaaaggaaattat
ttcataggactttccatgggtttaactaatccataccaaataagttggtggattactgtt
ggaatttccattatcaggtccctttcaattttaataataccgggattttttgttggtata
ctaatatggataatagcttttccgaaggcagtaaatatgttaggatcaaaatacgtcaag
tatgtaaaggtaatttcatctgtaatattagtcatattcggtgtctacttattatacgag
ggtattctaaatgttatc
>SSO0456 Conserved hypothetical protein
atgttatctaagcaggaaataagagaattaatatggagaaaattagaggagggaaatata
gcactgtttccgaggccagtttacggtaggattcctaattttaaaggagccgaagaagct
gctttaaacttagtaaagtgtaaagagttcgaaaacgccgaaataattaaggttaaccct
gattccccacaatataaggtaagagaaattgcgttgagacataagaaaaaggttctagtc
cctactcctagattaagaggagacttctttttattagatccttctagaatttcaccttct
gatataccaagagcttctagaatatccggctttgaaaaatatggaataaggataagttta
gaagatatagtgagggttgatttcatggtagctggatctgtggctgttgacataaatgga
aatagggttggcaaaggtgaaggatatagtgagttggagtttgcaattttaagggagctt
ggtaaggtagatgagaatacccctattgcaactactgttcatgatgtacaaatagttgat
gagataccctcagaaccttttgatgtaccagttgatataattgcaactccctctaggctt
ataagggttaataggaaaagagaaaaaccaaagggaatttacttagaatatttaagtaag
caaaaaatagataatacacctttgttgagggaatacttaaagaaaagaggatataatagt
atg
>SSO0458 Transcriptional regulator, putative
ttgagtattgaaattagcgaaaaaagttttttattgaaaaggttcttaatagtagcctat
ggtctatcagaggcagatgtagatgccttcataaagatagtaagtagtgagactggaaaa
gatgtagatgcaatagctggagaattaggaataagcaagagtagggcaagtctaatacta
aagaagttagctgatgctggattagtagaaaaagagaaaactagtgtgagtagaggagga
agaccaaagttcttataccgtatcaataaagaggagctaaagaaaaaacttattaaaaga
tcagaagaaacttgtaaagatttacatactattatatcctcttttctt
>SSO0460 (mrp) MRP protein homolog, conserved ATPase
atgagcagtaatccttttagaattcaaaatcctcagccacaacctcaaagacagcctcgt
gatttaagaaaggttaaccaacaagttcaagctgttgatctaaaagtacaaatgaagatg
aaaaatataaaatataagattggagtagttagtggaaaaggtggagttggtaaatcattt
gtctcatctaacctagcaatggctatagctgcgagcggtagaaaagtaggtatagtagat
gttgatttccatggaccatcagtgccaaaaatgttaggcgttagaggacaaatgttaact
gccgatgataagggaataaatccagttatagggcctttcggaataaaagttgtttccata
gattttctattacctagagacgatacgccagtagtatggagaggagccataaaacattca
gcgataaaacaattcctaggtgacgttaattggggagaattggactatctgataatagat
atgcccccagggactggagatgaagctttgtccattgctcaattagttcctggcattaca
ggatttgttatcgttacaataccatctgaagtttccacattagctgttaagaaatcaata
aatttcgctagaactgtaaacacaaaaatattaggtgtagttgaaaatatgagccatttt
gtatgcccaagtgatgggaaagtctattatatatttggagaaggtaaaggtaagaaaatg
gcagaggaaatgggagtagaccttttaggtcaagttcctcttgatccttccatagcagaa
gctaatgatgctggagaacccttctttttgaaacatccagacagtccaacttctaaagaa
ttcttaaatatagctgacaaagtaattaaaattgttgaatccaatcaa
>SSO0461 Conserved hypothetical protein
atgataataatagtgactggcacacccggtgtgggaaaaaccgtagcttcaaagaaactt
tctgaggcgcttaatctaaactatctttctctttcccaatttgttatagaaaataaactt
tatacggaatatgatgaacttaggcaaagttatataatagacgaggataaagtaaaggaa
gaattagagaaaattatttcaactagccatctcgtgattgaaactatatacccttcattg
gtatctaccgctgacttagtagttgtccttaggaagaatcctttttctctatataatgaa
ctaaaaggaaggggttgggctgatataaaagtagctgagaacgtggaggcagaaattcta
ggagtgatctcacaagaggctagagaagcctttaaggataaggtgtgtgaagtagatacc
acagaaatgagtacagaacaaatattaaataaaatactaaataaacaatgtgatggacca
atagaatggttagttgatacaaaagtacaaagatttttagaggaattagataagattatt
agctcctatgagaatgatatc
>SSO0463 Conserved hypothetical protein
atggaacatgatagtgtgggcagtattgataatcattgcattcgcactaacatttctata
atggtgaataaagtgataataaaaaaaataataggtatatcaacttttttcttaatgttt
cttgttactttgggttttatggtaggtttattagcaacttttatagattctacctcatta
tattatctagaacaattaaactacttagtaattaaagggtattattccgaactattcaca
tcaatatttataactaatagctttgttgattttatatttaattttatttcattatatgtt
atatatttaatttttggtagtagagcgggaaaacatgaatatggtatatttatcctagct
ggtattctaggaaatctactaactgtaatattctatagtccttttacactaagctcggga
gcgtctgggggaatatttggattattaagttactacacgttttacgatttcttaaaaaag
gataatctaggggtttatggtcttgtatttttagtatcagtatttggagttagtgattta
atattccctaatgtgaacgttgttgctcatatcggaggtattttgggaggtattatgtac
gcagttgtctattaccttataaggagtggaaggacaataaaa
>SSO0464 Conserved hypothetical protein
atgtcttgggatataagatacttagaatggagattcgccaacctaaatgagatcacttcc
tttttacttgctgccttatctttagcagtagcttatatacgcccaacatcaatactttca
gatccaataggtagtataatcataccatatatcgtagcattattagctataataccacat
gaaataggccacagacaagctgcgagaagatatggttgtttctctagatttactttaagt
ttttcagggttttggacaacgttaatactgaatataattggtagcttcgtaggtatctta
gttttcttttcgggatacacatcaatatcttgtggccttcttaatagagacgttgaggga
aaaacagctctagctggacctctaactaacataatagtaggatttgttggccttattggt
gcatcgttagtgccttttagccttgttggcttatttttctttgaattagctaggtttaac
ttctgggtagcattctttaacttgcttccattctgggttttagacggattaaagatcttt
agatggaacatgatagtgtgggcagtattgataatcattgcattcgcactaacatttcta
>SSO0465 Hypothetical protein
gtgagattcgaagtcactgtagattacctacaaggtatagggagaaaggtacttacaagt
gatgggcatgtagtagaattaaatccttcgcttgaaaaggaattgtccttaataggggtc
tcatcgaaactttttgcagagggactaatagatgctgtaactcaaaataatggaacttat
tcttttttcttgccagctaaaaagataagtgatgagtgtgagaacgtcctaaggatattt
gagatatggatatccacaactaatcagacaagaaaaatgttagttataattataaacgtt
gaaggaaatgcgcaaataacgttattgagacctgaactctataacgatttctctaaggac
ttaattgaaattttagcaaaaagatatatttgtctaaaaattacgatgccatttatgtat
agatcagtaatctttgatacctttaattccttcaaaagattatttgacataatatttgaa
gggataataaacttaagtggaaatatttacatggcaaccatcagtaatgacaaaaaagcg
ttattatggaaaatagatagtacaaacattcgatatgtaagcaataatttaataccctca
gagttgttaagattaataaga
>SSO0466 Integral membrane protein, putative
atggttaccaatgtaaaattggtatttccacaatactttttactgtatataaagtctagg
aataatgtgaagaatggccttgtatcgttggtattatggttattactgattatgatatta
ttgcattttgcaattaaaactcctagtttatttacgtattcggattccccattcttgtca
agcagcgtacaaagtgtaagggctgataagatagtaaccaattactttcacattggcaac
gttgataatctgtatattattatcaattcctcgtcttataaccaagctttacaagaaatt
tattctaatttatatctccttaataacgctacggtgataactcccaacggttacgttagc
atgcttaagacagagtatctcagctaccttggcttaaatgagaagaatttctcatctacg
ataagccagttgtatgagaatttgactcgtttgaaactttatttaatttcaaattttcaa
tactttgaatatcagttaaatattacatttggtcttccacttcataatttcactagtaac
atatgccctacctataaggaaaattttgataaagttaatggaagtttactagagaaagct
agatatgcgggatacttaacctttaaagatccatttcttttctactttggatttaataat
tacactaattacactttggcattaaagtttttgatacagtttaataactacactagtcta
atcgaaaggatacttaaaactcaaaacataacgtctgttaatgaaagcaatgtgattttt
aataatataactacagcctttaactcatcctttcataagggtactttatggcttttcatt
ataaatgttcctagcaatgaaagcctaacaaatattaatcaatttactgaaagtctcaga
aacgcctatgtaataggtcacctagcgtattatgcacaatccgcatattatactcaaagt
aacgttgaaattatagatataactacaattattcttgtaatgatattactaatactgtta
gttagatcaattgttccaattctgattttaatatctagtgctggtactagtcttttatta
gcttatggtctcatgtacatggaaacgcttctaggttataagatatattatatttcgggt
ttggttgcacctccaattgtatttggtcttaacattgactatggcatattactcatatat
agatattttgaagaaattaataaaaataatttagatgctctcctatatgcgcttaaaaat
tcaataaaaggtatactattaagtggtattagtatcacgattgggttctccagttttatc
ctttccccttctgcactacttcaaaacataggaatagcgttagtgacatcttccatttca
gcattaataccagcagttttctttacgtacacgttattgctcttaatccctcaaagatat
cttagttttcctagacgaaaattaccgagtattacggatataaggcaaaggtacttatat
aagctttccaactttgcagtaaggcacaataagttattagtaattcttatgctagtttct
atcgttatctttatcttttattttccttctatacacaccaacgttaatatagatgaaata
ttacctccccatgcaaattcacttgtaggtacaaaggttcttaatcaactttacaattat
agtatagactatattatattgtatggaagccctaaggctaactacactctcatttataat
ttaactaaaactcttatagatcaaggtaacttagtttatggaccaatgtccttaggttct
cagatcattgtcaataatagcaacttatatgatcactttcatcaaggaaattacaccttg
ttgataatttacctaaagtaccctgtatttagcaatggcgctataaatttaacaaattgg
ctcataagcaagggattcctagttggaggggataacgcacaaagaatagatatcgttaat
aataccgttagtacttattttagctatactttaccacttactataattttaattgtcatt
tacctcttcatgattctcggatctattctacttcccttgaggttatccttaactgtaggt
ctaagctcattattgggagcatttacagtggcattagtatataactcgccatattggcta
tccccacttgtaatttttgcccttcttttcagtttaggtatagactatgatatgttcata
atcataagattatttgatgagatgaaaaacgacgatgacataaatagtgctatagtaaga
tcggtagaaaatactggattagtagtaactacttgtggtttgattttagccggagccttt
ttctcattgatggtggcaaatatgagattcttacaagaaataggtctaggtgtaggagtc
tcaatactgtttgatacttttgtagttaggcctattctagtacctgcaattatttcaatt
ctgaaaaaatataatttttggccatttaaggcgagaaaatttctttatact
>SSO0467 Hypothetical protein
atgaatatgtcatcaaatattgatagtggtgattttagcacaatagtaagattgagatca
aacaaaaattactttctgaatagagagttaacgtttgccgcaattgatggaaccttctct
gacattattttggaaggagagaaaggaggttatatagtaataggcataatcaaaggcaga
atatttaaggattttaaatttactatagaagatatttcagttgatgatgagctgtgcatt
tgtgaagcagagaagagaatgagagaactagaatactacaatataaaggaaaatgaagtt
gatctaatatttttcgatagaaaactgtcatttgataaatctttaggtatttcggttcct
aaaaattccattggaattgtaaaggattttgatatagtaaaaagagaaaatttgaacaat
gtagaaaaccccccttggctagtaattaatgaaaaacatgatgaaacgatttatggatat
tttaaactgtttccctcctcatgggtattctacatagagtctcaagtttttgtagaaaat
ccggaagaattgctttctctaatctataatctaggaagggagccaataccagaagcttta
gggtataattatccattgtttttagctgataagttagtgaaatattacagaaataaatta
agcaagttcataaatgtcaccagtttgcaaagcaatattagatacagagaatttagaagt
tggattgagagattaagaaatgatggaaagtatttt
>SSO0468 Conserved hypothetical protein
ttgtttgatctcaatcttactattgtgctaaaatcaccactatcaatatttgatgacata
ttcataacatcaattagggtattagaggctaaaagacttagggaactacatatgagtcaa
acgagaattgctaatctattaggagttagccaaccagcagtgaaacaatacttagatgaa
gacgaaaattcgtacattaaaagattacagaatttgggattaacacgtgaagaaatagac
gattttctagataaacttacgcaattactaataaatggtgaccctaaacaagtaatgcaa
tatatcagtgtgtttttcctttccaatttaagtaggctaaaattctgtaaataccacaaa
atgattgatagtgaaattcctgttgattgcgacatttgtaaaagtttgtacaaggagaat
gaagaggaaatgatggaacttgcactatcaatgcttcaaaacgagtctgtagcggaatta
atcccagaagttctaagcaatttagcctttgcaaaagccaacgctaagagggaagaagat
gtgcttgcaattccagggagaataactaaaattagaaacctaccaacacctgcttctaaa
ccaatgtggggaggaagcaagcatttagctaaggtactattatcagtgatgaaaaatcat
cccgctgtgaggtcagttatgaatatcaagtatgatgagaaagtggaaatgatattgaag
gaaattggctataaatttaagaaagtaggtcctcagaacgacctaggcaatgaaagaata
gccgaaacaatagctgcagtatttgatgaaggtacagatgtggtaatacatttgggcggt
actggtattgaggccaacacttatgtttttggcagagatccattagatgttgtaaaaaag
attataaatatatcagttaagtataaagaaattttctcgcct
>SSO0469 Conserved hypothetical protein
atgatggaaagtatttttgaagtagaagagggaaagctaagagaagccaaaataataact
aggcaaacttctgatggcaggggtacaatatcttttagaaattatatagtagaattcccc
ttctcgctaaaggataaattaggtataggaaaattgcttgctgtaaatacaataaaggaa
aattactatctgattttagaagttgcagatattattccgatgcattatggtatgataaat
ctggactctacaatacctaaggagattagaaatgaaatcatgaaaaaagttagtgaaagt
tggtattcgaacgatgagaaagaaatatggatagattcaataacttatcctttgggatat
attctcgaaataaattcgaacaatattcaatttaaaaaaggatatttcccacctctattg
ggttcctcagtaaagattttaaataaaaaggcgtatgcgtcatttgtctgtgcaaatagt
aatgtaagtttaggaaacattctacatgaacaactttctttagatataaatttagaaaaa
gcaataaagtatcacctaggtattttcgcttttacgggctcgggtaaatcaaatttagca
tccttgatagcaagaaaagtgttagataacctacccgacactaaagttgtaatatttgac
gtatcaatggagtacgcaatacttctcttagataagttgcttgaagttccatctagagtt
ataagcttagatagagttccccctaatccagctgatgcgagtagaaaatttttaagaagt
cacgtgattcctgacgacattatagatattagagataagataaaaaaaagtgcagaaatt
ctacatcaaaatgggaaaatgaaacagttatacgttccacctgaaggttttacttactta
acttatgccgatttaatagatctagtcaaaaagcagatagaagataaatatactgcaata
tcgcagaaaccactactctatactttcctaagtaagttagataatttcatgagagaaagg
aaattgacagtggatgatatcatagatgactctattaataatttattggatgaaatagaa
aacttaggaaaagatgcgcatttaaaggagaattcgtcactgtttacatttatatctggt
ataagagcatacatctcactcggcatcagagaaactgaagattatgatatagaaaattta
gcgattgaaattttggattcttccagggactcacctagattatttattttagaactccct
aacttagaagagggaaggcaagtagttgcgactgtaattaatcaaatttacaataggaga
aagagaatgtattccgacaatcctaaagtactattcataatagatgaagctcaagagttt
ataccttatgataccaaacagaaagataaaagtgaagcctcaagcactgccatagagaaa
ttgcttagacatggaagaaagtatcacttacattcactaataagtactcaaagactagct
tacctaaacactaacgcactgcagcagttacactcttacttcataagcacacttcctagg
ccgtacgatagacaattattagctgaaacttttggaattagtgatatgctcttagataag
accctagaactggaaccagggcaatggttattagtaagctttaagtcggctctccctcat
gatgttccagtattctttgccgctgagaacaatctagatttattaaaggatagaataaat
aagcta
>SSO0470 Conserved hypothetical protein
atgtattacgggagtataattacagtcttatcgtcagataagaataaactaactgggata
gccgaaaaactaggtaagcttcatgaaaccgccaagacaaaaatatattatagaaaaaag
ggggaatacattagatcaatcctattgactacagagtatccggaaaaaattatagattta
gctgaagcattatcactctcgtcgactgcaatattatatataccagaaactttaacgtgg
atggatggagagctagcacttttaattgattctctaaatacgcataacaagatagtaata
tccaacttagatcaaggtaaaataaataatattttaggctctttaagctcctttactaaa
ttcgatctatataatgatattccagacttaagcgagaccgaagaggaggataagggaata
gtatatgtagatagagtattcacagtcaaaggtgttggaaccgtagttactggattctca
tttaccaatgttgaagttcatgagaaattagtggcgttaccttataataaggaggttgaa
ataaagagtattcaagttttagatgaggatcaaaagagtgtttcaaccggagttagaata
gggtttgctctgaaaaacgtaaaagaagaggaaatagaagatttactgtatttggttaag
ccaaatgttaaggttgtaaaggaaatagaaggacaaataactaattacaaatggtccact
ataaatcaaggtcaaaatcacataatagttaagggtcatggaattgcagctaatataaaa
gtcgataatcaaaaagctaagattatgtcatctgttccaatacctattgttgacaatagg
atacttgtcttaaacgttaacgtcagacagggaaaaccaagagtcgctggatatattagt
tta
>SSO0472 (adh-1) Alcohol dehydrogenase (Zn containing) (EC: 1.1.1.1)
atgattatactgtaccttatactaatgaaaggagcaatattgtataaatataatgagcca
ttaattattgaggataatattcaaatagatgaacctaaggtaggtgaaacaaagattaga
attgaggcaactggcttatgtcattcagatgtaaatgtatttgaaggaaaaactccagtc
cctccaccagtcattgcgggacatgaaatagctggtgttatagaggaggtaggaaataac
gttacagactttaaacctggcgatagggttatatcagcatttattcatccctgcggtaaa
tgcaaaaattgtataacgggaaaggagaatttatgtgaagtctttgcgaaaaatagacta
aatgggacattactagatggtacaactagattacactttaaggatggaactccgataagg
gcatttttaggaggaggatttgcagaatacgcaatggtaccttatactgcattaactaaa
gttccggaagatttggatttaagaaaggttgcagtattgggttgtgcaggtttaactgct
tatggtgctgtaaattccgctaaaatagagcctggtgaaacagttgctgtaattggagtt
ggcggtgtaggattgtctgtgatacagatgttaaagattgctggtgccggaaggataata
gcagtcgggactagaaaatggaaattggaaaaggcgttagagctaggagctagtgatgta
gttaactctaaagagactgatgttgttagagctgttaagaatattactggaggagggccg
gatgttgtaatagaagtagcaggaactacggaaacagtgaaaatgtctttagatatggtt
agaataggaggaaaggtagtactagtgggattacctccaactactgctgaaattccaatt
aggatagcaagtatagttagagggggtattaaaatcataggagactatggagggaggcct
agagtagatatgcctagacttattgaacttgtaaaattgggaaaatatgaccctactgcg
ttagtgactggaaagttcagattagaagaaattaacgaggcagtaaaattattggagcaa
ggagaggcaataagaagtttaataattcctaac
>SSO0473 DNA repair protein rad25
gtggtacgattacgatactttaaatgtttattactatccgatttttcagctcccggttta
agctggaatgatgagtttaagtgctatataggccaagcaaacaagtatcgagaagtcctt
tattactataagaggtctcacgttgaagttgaggatagcgtcctagagttattacctttt
cctttgattgtagatcgaataaaattaagggaatatcagcaagaggctttgaatgcatgg
ttaaagagtaagctagggataatagtgattcccactggaggtggaaaaactgtaatagga
ttgaaggccatagctctgattaggcttgctacactaataatagtgcctacaatcgattta
ttacagcaatggtatgaaaatataagagagttacttggagttgaggcggggagggtaggg
ggaggatatgatgaacttaagggaataaccgtaattacgtatgattcagcgtacactcag
ctagagaaaataggaaataaatttggattagtaatttttgatgaagttcatcatctacct
tcagaaggatattccataatagctcaaggtttagctgccccatatagattaggcttgact
gctacgccagaaagaagtgacggaagacacaaactgtatccatcactcgttgggccctta
gtatataggattacagtttctaacctagtcggaaaatatctttcaagttttgaaattcaa
cgtatatacgtaaatctcactgaagacgaagagaaattatataggcactatagaggaatc
ctaaagaaatttttatctcaacgtaatcttaagttaaagtcattgaatgatttcaatagg
ctacttaggctagcagttaaggataaggaagctagagaggcattattagcatggcatgaa
gctctcaagatagctgtaaattccaaggcaaagttagagaagcttaaagacttgctcaag
gagctaaatggtgagaaaattataatatttactagaaatacgtcaatggtatacgagata
tcaagactattcttaattcctgcagttacatacaagacgaataagcaagaaaggatagag
attctggagaaatttagatctggaaaatacaatgtaatagtaacttctagtgtcctcgat
gaaggtattgacgttccagatgcttctattggtatagttctaggaggttatggaacctct
aggcaattcatacagaggttaggtagaatcttaaggaagaaagagaataaaaaagctaga
ttgatagaaataataactaaaggtactagtgattataatttaagtaaaaggcgaagacaa
aatgctaacctc
>SSO0475 Conserved hypothetical protein
atgctaacctctgatctagctaggtttaagatagaaaatcagaggataattccactattt
gctacagattctgacatagatgtagcaaaggaagtcattgacatgtttaaaataggagca
aaagttggtgatattctagaagatttaaaatatttatctaaaatatatgattataaacta
gtcaagggattagggaaaatttatctaagatattgtatcgttgaaagtgcgactaagatc
gattatatagaattgcgtaggcaattatttagtaggggtccagtattagaggagaacgat
aaggagagagtattaaaagaggtcggtgacctttttcacgttgatcccataaaggctatg
tatgaagaccttgacgttgaaaagaaaatagtggaactccctaaattttctccagaagat
ctattaaaaatatataatctttcccttttgcaaaccattattttcaacgcgtataaggtt
acagtttccgttagtgatggctggaaagaaatcgcgagaagaataaaaatgctaggatta
atgtatttagcgtatgaaaatccgcttagaatagagatttttggtccattgtccctagta
aagatgacagagaaatatgggagaaatttagctgcattagtaccgtttttagtctctaag
aataagtggactattatagctgatatagttttaggcaaaaataaaagaagaacctataga
ctggaactctcgagcggctattctaaactctttaagtatattaatgatgaagagatggaa
aagaggtttgatagttcaattgaggaaaagttttacgaggagttcagaagggtcataagg
gattggaatatagtaagggaaccagaacctatagtgatagaaaaaaggctttattttccg
gatttcgtacttagtaaaggtaatatcaaagtgtatgtagagataatgggattttggact
aaagaatatgtaaattctaagatagagaaactgagaaacttcaaatatccgattttagtt
ctcttgaatgaagagctttcatacgaaaattacataccggatactttaaatgtaataaaa
tttaagaaaaaaattgatataggtaaactgtattcagctttaagaggctttcaagcaaat
gttaacgaggatatcgacttaagtgatgttaatgacgatattatcttgattaaggagctg
tctgccaaatataatgttaatgagaagatagttagaagcaagttgatgcaaagacctgat
tatatagtacttaaaaattacgctataaagaaaacgtttatagaagagctaaaaaaggaa
gatttctcaaatacgcaactttcttcattagttaacaaatatggaaattatatagttgac
attatagattatctaggttataaaattgtctggaaaaacatttccgatgcaattgtagaa
aagatcaaagaggtt
>SSO0477 Conserved hypothetical protein
atgaatactttttatagtaggaaagtaaaatataatattatggcatgggagatcatatta
accgcggataaagggtcttttacagattatgggggttcaagtgtattaggttatgtagct
tgcatgccatcaagactaatacccaaattctttatggatagattcttcactccagatgtc
ccagtggattctgaaggaagagcaatagtagcaccgtacgctcttagaaaagtagaaagt
acgcttgttcatgcgggattcgatagcgttgtagtaatacctccgcacagactagagaaa
gcaataaaccagaagactaaagtagtgggattaacagttcatgatccctttggcctaaat
ccagttagctttaagttaagtatgatatttggaggtggtcctacatggacagccaaatat
ttcgaagaatttggagaaaagatctcgaagcttaagtcaaagtataattttaaagtaata
gtaggtgggccagggagctgggagttaaccaaggagaataaggattgggcagatgttata
ttcataggagaagctgaagcagatctaccacgagttgtaaaatccataattgatggacaa
gaagtccctaaagttgtctatggcaagaatccaaaggtaaatgaaataccaccaataata
aaccctgcaagactaggggaagttcaaataaccagaggatgtccaagaggatgtcaattc
tgtccaataacccctgaaacctttagaacgataccattagacgttgtgaagaaggaagtt
gaagttaacatgagggctggtgtaaagagggttgaatttataactgatgatgtcctactg
tacggttcacagaagttgagggtaaatcacgaagctattacaaagttgtttaccgaaacc
atgaatatgggagtagatgggatatggtttccacatatctctgccccagctgttagaagt
agtccacaaacagtaaaggctatgtctgagattgcaagatatgatgaggatagagctgct
gctccagtggttggactagagagtggaagtgagaagatactaagtaagtacatgagagca
aagccattcccttggactcctagagagtggaaagatgtcatacttgatgcgactgcgata
atgaacgataattacatctatccttgttacactatgacaataggttatccagaggagaca
aatgaagatgttgatcaatcaattgatttagttcagtccataattgatcataaacttaaa
gcttggatattcccattgccggtcatacctatgggagtttcttatataagaaataatcca
tttccagtgttagaaaaaatgcccaccagatattgggatgtactatacatatcgtggaaa
tacgatttacagataacgagagagatgataccaattctcactggaggtatcaagaacaaa
ttcgctcaaaggactgtccaatacatgatagacaaaatattctacagcattgaatgggta
tttaaacaactaaaagagacacaagggaaatatgcgtacactttcgcaagtatcaatctc
aataacacgacgggagtgataaaggcgatctactggttattcaggttagcctttaaacct
ctt
>SSO0478 Hypothetical protein
gtgagaaagttaaaaagggaggcatataaattaaataatattaagatgttacagcaagat
gttaaatattctgaagaagtgatagaggctgaattttcagttgaagggtatagcctcatc
gattataaaagatcttatacgttaagtcgagctttagttaatggtaaatggatagtttat
gatggtaacagattagagagtagtcaaaaaataaaggagtttgaaatttgtgaagacttt
tatcatgaatcagtgaaggcgtggccgaataaggaaaagtattccagactcttcactaat
attaaattaaatgaagatgaccaactaaaagttataagcaagaaaatttcaaagtctatc
ttaattcacgatgttaaggagtgccgcgaagaaaaagtagtaaactatgtagagtataac
gatttaaatttctcatatgctggtaaccctaaagatataccgtcaattgtagaatattta
agggcaagtcagtcccaacttacttctccatctagacaagtcttaactgagagtggcaga
ctaactttcatattagattctgaaatagtagcctccattttccattacgttcttaggaat
tttttaaatggtaactcacctaagttgaaattaaatgaaaaaatatcaagtgaaattaca
atttatgataatccattaaattcattctcctcatccttttcagtctttgatgatgaggga
gtaaaaacaaagaagaaagagattattggagatgggataattacaaattatttaggaaca
cttacttcaaagtacggtgaagcagggaacgcacgaggtattttaccaaaaccagattat
ttctccttagaagtaaagcaaggagactggtctcttaatgaactaattgatgaaagtaga
ggggcgtacattgccatgggtgttaagaagtcggaattaatacgtaatagtattagaata
actccgagaagtgtagttaaaataggccaaggacaaatattctttagggagattgcaatt
ccacttcaagaactggttacaattgatgctgttactagagagaatagaggggtatttatt
gacgaggaacatggaggtgtaactccatacgtaagaatgaaggtaagagcgatattgtac
>SSO0479 Conserved hypothetical protein
gtgtatagaagaaagcctaatccttatgtcaaattgataaatggagataagattattgat
gtaggttgtggatctggtcaaaattgtgaccaatttaagggaagactagttatttgctta
gatctttcactaaatcaattaaatcaagctcgtaaaaaaggatgtcaaaatttagtacaa
gcagatatggaatatttaccatttagagattcatcagttgattctctagcctatatagcg
tctcttcatcatttgagagatccatctcaagctttaggggaagctcaaagggtgctaaaa
gataaaggtgaaatactggttactgtatggttagtacaactaaagtttttcttcttaaga
agatatataatcaagagaagtctcataaacggcaaagaggttagacgtttctatagactt
tattacccttgggaattaaagcgaataatggaaagcaagggtttcgttacaaaaatctat
aagttatatagagtaaatagtttattgccaaataattccctttattacggtatcaaatca
actgct
>SSO0480 Histone acethyltransferase, putative
atgcaagtaataaggaaaccaactagaatgctttctggcgttacgatagtatcgataatg
actcacccgcattcttgtccgcatggaaagtgtgtattctgtcccggaggagtagatgtg
gataccccccaaagctactatggtagagaacccactttaatgagggcaatagaaaacgat
tatgatccattccatcaagtacagtcaagattaagacaatatgttgagaatggacatact
ccaagtaaagtagagttaataataatgggtggtactttcctatcattacccatagattat
caagattggtttgtgacctatgccttagaggctatgaatagatttcctagttatgataaa
ccttcttttgtatatttagaagatgcacaagtgaaaaacgaaaaggcagaagtacgttgt
gtaggaatgacgattgaaacgaaaccggattgggctaaggagtggcacgcagatcaaatg
ctaagattaggtgcaaccaaagttgaattaggagtgcaaactgtatacgatgacatttta
aagttcaccaataggggtcataccgtaaaagattccatagaatctactagaatactgaag
gattcagggttcaaagtggtctatcatgtaatgcttggtcttcctaaatcagatcctgat
aaggatctggaggcatttaagacaatattttctgatcctaattttaggccggatatgttg
aaaatatatcctaccttagtagttgaaactgcgccgttagcgaatttatggagaagggga
ttatataagccttatggtacggagactttaattgaattaatatctgaaatgtatagatat
attcctaaatgggttagagtgatgagaatacaaagagatattcctgctaatgtaatctta
gatggtaacaaaaagggaaacttaagagaattggtagagaaaaaggtcttggagaaagga
attaagattaatgaaattagatttagggaagttgggatgatgtggcaacataggggatta
ttaccagatcatactaaaattcatctttacaaggaagtttatgaagcaagtgaaggtact
gaaattttcctatcttttgaggatgaaaaagagattttaataggttatttacgattaaga
ataacatcaaataaggctcatagaaaagagatagatggaaagacggccatagtaagagaa
cttcacgtatacgggatagaagtacctataggaagctgggatgaattgggtttccaacat
agggggtatggaagtaagttattaagcgaagctgaaaagattgcgagagaggaattcgat
atgcggaaaatttctgttttatctggaataggtgctcgagaatactatgctaaaagaggc
tatgtaaaagaaggtccttatatgtctaagcagttgatt
>SSO0481 Hypothetical protein
atgagaaaagcagtaatatttgacctagatggcactttagcgaatacggatgaagttcac
aaattagcttgggaaattgctttacgaaaactgggatatgacgttaaagtggatattaga
tatttgcttggtaggaaaacgatagacatagcaaagattttgattggggagagtcatgcg
gaaaaattggcttctgtaaaaaccgaaatttataacgaattagtgaaaactttggcaaaa
cctaaaccttgcgtaatggagctaataaatcgtttgagagatgtggaaatacctattgca
gtggtaacctcgtcgatgcgtaactctgctgttcaagttttaaaggtaattaatgtagaa
ccagatgtcctaattacaggggatgatgttaaactaggaaagcctaatcctatgccggta
atagaggcaattaaaagattaaatgtagatcctaatgaaagcgtaggagtaggagataca
atctatgatgtaatggcatactattcagctggaataagggagattatagtggtaaggagt
agtgttcctctaaatgtagaagaggcaagaaagtacgatgcaaagatattggattcatta
tgtgaaatatcggattggtttgaattattt
>SSO0482 Conserved hypothetical protein
atgaaaacaaagtttttaatctcacaatacgacttttcttataaggatgggaaaatgtta
acaaacccttacgattggatcataatactagtagtaattgctgtactattctttggagca
tccaaaataccagaactatttagatcgatggggagagctgttggagagttcaagaagggt
agagtagaggccgaaatggagttgcagcaaatgcaagcacaaaaccttcaacaaccgtta
gttcaacaacagcaacctaatgttcaagacctagagaaacaaatagccgaattacagaaa
cagttagaggagttaaagaaatctaagcagaatcaa
>SSO0483 Hypothetical protein
atgattagcaacttaagtgactttttagtagtggtagttgtgtttatactgttgatggcc
ggagataaaaatgctggaaataccactaagtcaatagggaggtttttaggtgaaataagg
aaaagacaaaacgaattcaagaacgagttaatgagggaattgaatagtgtagaggctact
aataacactccttttactgggtctaatttcaaatacgtaaaggttacaaatcaagaaaga
gttaaagaattagaggctcaaataaaacgattacaagaggaattggagaggctgaaagct
agtgacggaaagaac
>SSO0484 (tatC) tatC protein
gtgacggaaagaactagagaggttgaaaagcttgaagaaagacctttaatagaacatttg
agagaattggcgtacagattaaggagaattttaattgctctcgcaataacttttatgata
tatttcatgctgggtttagaattagttagagtatatttaccttatccattctttggtctt
aaatacgttttagcggaagttcccgttttatacccatctctatttgatagtatatctgta
caactgacacagcttttcatatataatgagctacctaaaggcgtgaaattgataatcata
aatttgttcgatccacttttcgcatccttttatatttccctgtatctggcaatatttact
acaatccctatcattgtaagggaaatttgggcatttgtagctccaggattatatgaacat
gagaagaaacttttcaagagtataatatttcctgcctttttattgtttgccttaggttct
gcctttgcttactttcttcttattcccttaatgttaagaataatactcttatatgctact
gctttaggttctgcagtggagccaactttaggcctaaggtcctttgtaagtacagtaatg
acattgctaattgctactggattgtcttttgaactacccttaataatgggcggcttaacg
ggcgttggagttgtaaagtcaattacgtggcttaaaaattggagatggggagttctagta
tcctttattatcgcatggataatttcaccaggtacaactggaggtataatagaaacagta
ataggaataaccttatctaccctatattttattggtgcattaataagtaagtttatggaa
aagggtaggaagaaagaatcccagaaaactttggaaagaatt
>SSO0485 ABC transporter
atgccaagcgtaaaagcgattggtacgatagtagctataattatagtagtgagtgtaatt
tccgtctactattattacaagagttcttctacattacaaccggctactgttaacaataat
cttagaattgtatcattagcacctagtgatacacaaattctaataagtttaggcttaggt
aaatatatagtgggaactgattactattcataccagttattgcaatctcttaacctcaca
aaggatataccatctaatattacagtgttttctcaaatatctcctccaaatatttctggc
ctgctactattacatccaacggttattgtagttgaaaaagggcttataggaagttacata
gagcaaatgaaagaagctggacttaacgtcttaattacgaataatgattttgcaagtacc
tattcccagatagaaaattgtatattaaaagtaggagagtattttaatgtaactagtaaa
gctcaacagttaatagattggatgaatcagaaaataagcgatttctctactgcaggaaat
gtaagcgtagcttatttattatggatatgcccagatttaagtttctacaccgctggcggg
aacgtttttataaatagcataattgttcaagcgggcggtattaacgtttttgcgaactac
tctggctatccattattaaccccgtcaccactattgataataaaaccctctgtcgtaatt
gcgcaggaagtatataatttaacttacaccaactacttaatttcccaatataagggaata
aatagtagtaatctctatataataggaaatctagcaactaacctattaaatgaaccagga
ccactttcggtgtattccatacaagttattaaactcataattgagggaaaggcgccacat
ttcatttcagacaattgggtgataaacaatcttaatgtaactctgccggtgttt
>SSO0486 Iron (III) ABC transporter, permease protein (HEMU 1)
atggttcgtttaagtggtatttttttaattataggatttattatttcgtttttgcttggg
ttactctacggtgatgttactataccgattagcgagattttccatcctagcggagtttac
gcttatatattgcttaacataagattacctaccttaactgtggcaattctcataggtgca
atcttatccacatctggggcagttcttcagatgttattgagaaatccactcgtagatccc
tatataagtgggacagcatctggtggggcttttggggcagttcttacgtatttactgctg
atgcttaatttgcccttttcatggataatatacttccaacctttggtagcattcttcact
gcaacgctagcaaccttgataaccataatgattggaaagaaatcaggatatcttggtctt
gtgattggtggtgttttagtctcgttcattttctcatctctggtaacggtcatattatca
gtaatgagcgctaaatatcctcaaatacccccacttaccttttggctcttgggagatatt
agcgtagttggctggtttaatgccataatattatcattatttgccattctcttactttac
tttagcctatcaaattctagattgatagacttactatcaataagtgatgagattagttat
tctcaaggggtaaatcctaataagcagagagtcttctggctattattcataagtcttgta
gtagcttactgtgtttcaatagccggtattataggatttttaggcataatagttccacat
attattaggagattaattggaggaaacacaagccagctagtgatgtattcctcactatta
ggttcaacaatcttaattctaagtaacattttatctcatggtatatttggttattttatt
cctctaactgcgcttctttcaatcatgggagctccaataatgatattcgcgttggtgaga
aaagatgttaacgttgaggaatat
>SSO0487 Iron (III) ABC transporter, ATP-binding protein
atgttaacgttgaggaatattagtgtaagattaggaggcaaattaattttgtcaagcatt
tcttttagtgcagtaaaaggtattaatgtgattttaggaccaaatggaagtggtaagact
acgctactaagagcgataattgggatgataaagtatgatggtgaaataagagtcgatggt
gaaatatcatacgttccagctgagtttttctctcctagtatgaaagttctagatgtatta
aaagcaggtagaaaaagggctaattatgaatcatatataaaggagttaaatgtggagaag
tttcttgagagagatttctccaccttaagctctggtgaaagaaaactaatcttagtaaca
aaggctctagctgagggagacaatgtaataatggatgaacctctttcaaatcttgacgtt
aaaaataaattctttgtgatgaatattttaaagaagtttaaccataagacctttctgatt
acttctcatgagctagaaactttaaggtatgctgataaagctatcgtgatcaataaagga
aaattggaatatgatggaggagttagcgatctttctgacgatctactttccaacgtatat
ggtataaagttcaaaaaaatacaagttgacggtaaaacattctttaatgttacggga
>SSO0488 Phosphate ABC transporter, ATP-binding protein
atggaagctggaaaaagcgcagaggacgtatttaacatatctagactatatttatatata
aacgataaagctatactgaaagatatcactattaaaatacctaataattcaatatttggt
ataatggggccttcaggttctggaaagtcaacattattaaaagttttgaatagattaata
gagatctatgatagtaaaataaaggttgatggaaaggttctatattttggcaaagatatc
tttcaaatagatgctataaaacttagaaaagaagtaggaatggtatttcaacagcctaat
ccatttccacatcttagcatttatgataacatagcatatccgctaaagtcacacgggatc
aaagagaaaagggaaataaagaaaatagtggaggagtgcttaagaaaggtagggctatgg
aaagaagtatatgataggctaaatagtccagcttctcaactctcaggtggacaacaacaa
agattaacaatagccagagcacttgcgcttaagccaaaagtacttttaatggacgagcct
acatctatgattgatatagttaattctcaagctatcgagaaattaataacggagctaaaa
aatgaaatagctatagttattgtgtcacataatcctcagcaagtcgcaagagttgctgat
tatgtagccttcttatacaatggagaattagtagaatggggatcttctaatgaaatattt
acctcgccaaaaaacgagttaactgaaaaatacgttataggtaggataagt
>SSO0489 (pstS) Phosphate binding periplasmic protein precursor
atgaaagggttttcaactttggcagttgtgataatattaataatagttgttattgcagtg
gcagggatttttttcgtgataaattcccaaggtggtcataacactacaactacttcaaca
agttcatctttttctacttcgtcacaagcttcatcatctcaaactacagcctcatcacaa
atttcggcaagtattatagctggtggttctacttttgttaatccattaatgcaagtgtgg
attaaagatttccagtcaaattataatggaattcaagtaacttatagtgcagtgggtagt
ggagcaggagtgaataatttcttacaaggtgcctatgacataggagctacagatgttcct
ccgcccagtaatttgtatcagcaattaactcaaaaatatggtgaagttctcacaatccct
gatgttgtaggtgcagtggatataatatacaatattccaagcttttctggtaccttgaac
ttaacagctgatgttttagcaaagatatacttagggcaaattcaatattgggatgatcca
gcaataaaagcattaaatccccactttaatttcactcatcaaaaaataatagcagttcat
agaagtgatggaagcggcactacctttatctttacatattggctttacacctcatctcaa
tcttggaggagttcaaatgttagttatggttataccgttaactggccggtagataaactt
ggaaacggattaggaggtaagggaagtgatggagttacagcatatgtttctcaaaatcct
tattcaataggctatgttgaggcacagtacgcaatagcgaagaatttaactccagcggcc
gtattaaatccatccacaggcgattatgttttaccaactcaagcttcaattgagaccgca
attcaaaacgctaatttatcttcgcttccttcttcattgacaagagatttgtctcaatat
ctttcagtcttcttaaacgttaaagcacacaacgcttatcctatagtgacgttttcatgg
ctagttattaaggtaaattataccgataagtctaaggcagaagcgatttacttatttttg
aagtatattgcaactactggacagactgaattaccatcggggtatattgaattaccatca
aatattcaacaattaattctacaaaatcttaagctaatatcatataataatacgtctgtt
tataccttggtgagc
>SSO0490 (pstC) Phosphate transport system permease protein
atgataacaattaaaagaaaaagagaaaaatttttttattttctacttataccttcatct
gtagtagtctttacttttatattgatactgagtgtattagtgtataattctattcctatt
ttagagaaagttggtctttcgatttatactaaaaatatatggaatcctatttacgatcag
tatggtggtttagcagcgatttacggtacgatagtaacaagtgtgttaagcgtaatgata
tctatcccatttgctactgctttttccatttttgttaatgacatttctccaaaaaaagtt
aaaagttttctagttaacctgtcagatcttctggcggcttttcctacagtgctatatgga
ttctggggtcttctatcacttggcccatttttatctcgcacattatttacgtttctaagc
tctcacgttgggcttcaccaaactactaatggacctagtatattactggcctcaataata
ttggcaattatgataacaccttttgcatcttctctcataagggaagtttactttcaagtt
cctaggtcctttgaggaagctgtgtattctctagggttaggtaagtgggagttaattacg
ctgaagctttcctacattaaaaaggctttcttgggcgcatatgcattagcatttggaaga
gcagttggagaaactgtggcagtaagccttacaataggcaatgtattaaacatttcaccg
aacctatttgaaccgggttatacgatatcatctttaattattagtcagtttggaactgcg
tatggaatccagtataatgcaatgtttgcacttgcgttatttcttgttgtaataggattc
atatttgtaataatctctaaattaatcgtgaggatgagatct
>SSO0491 (pstA) Phosphate transport system permease protein
ttgagaagaaaagatactgtaattgtctcccttataacattattagttatattattttta
cttcctataacatttcttttatacactgtagttgtaaatggatcaaaggttataattagt
tatggacctagattttttatagatttgcctccaaatcccggcgagggattaggcggtata
ggtccagctctagaaggctctttatacatggtctcattagcagtgctaatctcagctcct
atctccatatttactggagtttttttatcgttcttcgaaaggtcaaaaatagctagttta
attagagcaagtttagagctaatggtggaattcccaactattgtcataggtatagtcata
ttcacaattctagttgtagaaattggtttaggattaaatgggattacggccgctatggca
ttagcaattgtcatgttgccctattcaactatacaaattagcgaagccctaagaatccca
aagaagctttacgaagaggtcgcctactccctcggtttaaccacctggcaagtaataaaa
ttagtcatgtatataggaagaagaggaataataaatggtctattaataggcttcgcaaaa
ataataggcgagactgctcccataattttcctcacttcttccactgctaacctttatata
aagacttttaatacagctgttactggaattccagtaatgatatataattatgcgtttagc
ggctactcaaacttaaacgaagtagcttggggagcatcttttgtattaataattcttgtt
acaataatatttgtcgtagttagaaaaatggcaaaa
>SSO0493 (thrC-1) Threonine synthase (EC: 4.2.99.2)
gtgattagtagtatggtaaaagaggtttgtatgaaatgcagaaaggaaagggaaagtata
tacgagattaagtgtaacaaatgcggaggaccattcgagatcctgatagattttgaattt
gataagaattctgagagaggttttccctatagtgaaaagattttcccttacatcaaacat
ttcatatccctaggagagggaagaactccattaattaaaaaggggaacatatggtttaaa
ctcgacttcttaaatccatcaggatcatacaaggatagaggagcagtgactctggtctct
tatcttgcggaaaaaggtgtaaaacaaattagtgaagactcttctggaaatgcaggatca
gcaatagctgcgtattctgcagctgctggtattgaggcatacattttcgttcctgaaacg
gcaaaaggaggaaaacttaagcaaatagaatcctacggtgctcacgttgttagagtaagg
gggagtagagaagatgtagcaaaagctgcagagaattctggttactattacgcatcacat
gttttacaacctcaatttagagatgggattagaactctggcatatgaaattgtaaaggat
ttagattggaaaattcctaattatgttttcattccagtatcagcaggaactttactttta
ggtgtttataaggggttcaagcacttgctagattctggtgtcatatcggaaatgcctaaa
atcgtagcagtccaaacagagcaagttatgccactttgtgctaaattcaaaaagatttct
tacacaccaccagacaaggttacctccattgcagacgctttagtatcaactagaccattt
ctactagattatatggtaaaggcttctagtgaatgcatagttgtaagcgataatgaaata
gtagaagcttggaaagaattggctaaaatgggactgctggtagaatatagttctgctact
gtatttgctgcttataagaaatacagtgttaacgatgcagtattagttttaaccggtagc
ggattaaaggtatta
>SSO0494 Conserved hypothetical protein
atgaagatttttgttggaacctctggctggacgtatgactggaatgatgatgatacttta
gagtggtatgttaagaatagtgggcttaacgcagtagaggttaatatgtcgttttatcga
tatcctacaagaaaacaagttgaaaggtggagtaaatttaaggagattagatggatagta
aaggtaaataggagaatcacgcacatgaaaaggctaaaagattttcagtcttggaaagag
tttcaacaaatagttgactcattgaatccagatttttatttgtttcaattaccaccaact
tttaagaggaattcagaaaatgagaagagagtatttcaatttgctgaagtattaaaggat
aaaatggccgttgagtttagggacattcaatggtacttaaagccccttaatgttacttgt
gtaattgtctcaatagattcaccaataggtacttatgttataaagaataacgattacatt
tacctaagattgcatggaagagatgtttggtacacttatgattactctgagaaggaacta
aaggagttagcagataaaataatctcgttgaatcctaagtacgtttatgtgttctttaat
aacaatcattggatgcttgataatggtagatatatgcttaaaattttaactgagaaatct
>SSO0495 (proC) Pyrroline-5-carboxylate reductase (P5CR) (P5C reductase) (EC: 1.5.1.2)
ttgaaaattatggaagatttaactattggaatattaggagctggtaaaataggttctgca
atagtaagggcaataaggctaaagtatcctagcatccacgtaattgctactgcgagaaaa
gatgagactttaagaaatgtaaaagatctagaggtagagactactaaggataataattat
gcagttaataaatcagatgtaattatcttaagcgttaagcctcagcattttcctactgtt
ctaaggcaagttggcatagagtcatggagagataaggtagtaatttcaataatggcagga
gttaagttatctacattatctaccctacttaataatgctgaggtttatagagccatgcca
aacattaatgcaatagtatataagtctactactacaattgctgagaataacgggaaaagt
agagaattagtggagaacatatttaagacactaggtaacgtatactggcttccagaagaa
tacttggatatttggactgcactagtaggcagtggtccagcttttatatctgaaattata
gatgcgttaagtttaggtgcagttgcttgtggaatgcaaagagagatagcctacaatgcg
gttttggatatgataagtggaactataattatgcttaaggagggtaaaatagatcatcct
atgctattacgtgatcaagtgactacgccagtcggtaccacaataaggggactcatggtt
atggaagctaagagcgttaagtcagcgttaattgagacaatagaggcatcatataagagg
gcagttgaaataggcaatgagattgacaagagtattaggaataatagcaaa
>SSO0496 Hypothetical protein
atggataagcgtatagcgacaatcatattgagtatagtaaatattataggtatatttgaa
tttccattatacgaatcgttcatagggttcttctttatttcctccgccttgtctatcctt
tatgaatctcaactgtccttgattgtaccaacagttctattcgcatcattagttttatta
catattattactatccaattacaaaaactgattatattatctattctgatgttgatctcg
attattgggaaaaataataaatggatttattcaattcttataacccttgcgccgggttta
attataaataatctctacctcttattaattgtattggcattactgattcccctattaata
aaacttggaggtgaaccaagggctataatcatttcgggtattttatatttaatctattcc
ggtataatatttccaaataatgaagcactagctaatcagatttcacagatatcatacttt
tatctaatgtttggaataatagggataattgttgaagacaaaagaattactagaattacg
ttaagaaaaattctcccatatttgtctttcattcccgcatcttttgcatcaataatgtta
ggatacccaagcgattcttcctttatttattggtcagcaagctcattttatttctcccac
ttatacttaccttggatatacgaaataggttataattcaaatcagcacttaatagcaagt
tggtttttggcttatcttttaacacttatcataaagaaccctttgataacagcagaagtg
tttctgggaatttttacattcttatccggtttaatatcatattatgtctttaagaggctt
aatttgaaatatccactacttttctcattgctatatcagattaatatatttaatcctata
atatctcactcaatttcggttttttcatacgcatttctacctttagtcctattctttgca
tataataagaataaagtactctattcaattctaacgctaactgcagcatcttctatcccg
atcttcatatctactctggtaattccattagtataccgtaggtattacttcctattatat
gctctaggtgttaatgcgttttggctaattcccttcttaatctttggttacgataaattc
acatttaacgtatctaacatagaaattctcatctcaattatcttagtttcaatatctgtt
cttttatatcaactgagatttaaaaatatcgaaatactatatatgatttttatatcattt
gttctattaatattaggaataaatactggaccattaattcttcttgctactattttaaca
ttaggaagtttaagggatattagtatcctttacctgaccttgttgagtggtctaattatt
ttatccgctactagtttttcatacggcgtaatttcgggttatgcaaatactacgttttac
acatacaatctgcctaatttacccaaacccggagagtatgggtttggaattacgacgtta
gttaatgatcttaatctcaccgctagtggaatgcccaccgaatcaatatcctacaacgtt
aggtactttatatataactcacgtgttattgagaatcccctatactttggatttccaatt
ccagcgatacctaactacactccacaattaacattttcatacatttactcaaattcttca
gttaaggtaatttactcaccttttaataaaccattaggccttatggtttactctaacgtg
acaccatcaaaaatttcaatagtgtttccaacgcggattgagaacattagtggaataaaa
ggtttagtaaagaactatacaattcagattattaccaatacttccttaaccataatagga
ggtaaagtaactgtagataataagtcaatcttttcatcctactataagcctaaaatagta
acaagtatcatgattggtgaaattactgaagttatagattcaaattattcaatttacctt
ccgatacatgagagcttaactattaacggaaaagtagtaaatcacccaataattctccct
ccaggtaagtataccatagtgatttctgatgaaaagattgaatatgtgagctatgcttca
atattcctaactatagtatctttagtgctattaataagaagggggatgaaagta
>SSO0497 Hypothetical protein
atgaaagcactactagcattcatcgtattattactttccctttctgcactgataacctca
tctttctcgatagtgataatatcacctaacatagtaaagattttatcgtatgcacaagtt
gggaataatatttacagtagtccattatggtccaacggaactgcaacagtgattcataat
acgacttatgagttagtagtaggttcttcttacagttatactgtacaagaagtaaatttt
tccaattattataacttcaattactcaactaagtatagctatttatcaggcgttcaagca
ggggctataatactaggtggaaatgtagatttgaaaaaaccagcaaatcaacagccgtat
gtattaatttattctgtaacttctggccaattactagtaaagacccctaacactaaattg
agaattgtactaaataatctacctattagcgtaagtggttttctttccattcaattttca
aatgtaaatggtaatttaacagttgtctatatttcattgaacggcaacatttctagatta
gtttatataactcctataccttggtctgaggtgaaatatgcaggttggtttcaaaattat
ggtctttcctacatatattacatcacactaggtaagtttgcagaaagtcaaccgatgata
gctggagagacttacttatcaccagatattgttagctctccaacatggaaacttggagtt
gccaaaattattaacataaccccaaattacgaaactgtagaaggtctagtaagtggtagt
tacgtgattcagttctacaatatgtcacgattaaattatctcattctgacggttaacttt
acatattataatggaagtaatgtcgggattgaacttttaggaagcaatttgaatttgaca
aaacctgatctctcacaaaaagtttatgctctgttatattcagtaaataatggagaattg
caagttaagttaccaaactcagcttttaagattatcaacaacactttaccagttattaga
ggagggttattgaatatagtgtttttgaacaacaataataatataagtctatatgaaatt
attaacggtagtagaacatattatttaaacattactacaccaataccttggtcaaacata
agttatattggatggagaaccgataatggtatctcaagaattttctttgtttctccaaat
ttcataataggattacaaagtcttttaacgttcgaatttttaggaaataacggcactact
gttccgaatcaagaattctatatctatattggcgataatttatcatccttgcaactttat
tataaaggttacacaaattcagatggtcaattttcacttccattaccaataatatttccc
tcatcaacgtcttatgaatacgtaaggatagtttggattaactcatctacgaacataacc
ctaataataccattaataaaaggcgggagtaatttctatattccagccaatattatatca
gtagaggaaaaaagtatggatgtgaatatcaactattatacactattcttatttattgta
ctcgccttcttattaggtgcatatatttttactaaaggaaaacgcttc
>SSO0499 Hypothetical protein
atgaaagaagaatcctatcggctcctcgaatatgtcgtagaacacggtctggagggaact
cttaccgccttggagactaataaggggataccgattgttctagtcaaggaagatcctcat
acgctaactacaattctctgcattgatggtatagctagaaggataacaaaaagatttact
agaaccacagttcacaaggcaatatacgagctaatagatgagatagaaagcatgatatcg
caacctatagaagaattaaggatctcgcaaaaagtctccttcgagaattgcatagaggaa
agaggagaagaaaagccaaagagaaaaaagagagagacaccgagactaccatcaattgac
gaatataagagaatcgaaattccacaaaaacacgttattcctttattgtacttaggtgat
agaaaatacttgtctttaatattggaattaggcataatagatattatagaatcgctatct
tcttcaccaattattattgaaaacaatcaagttacaccatataaaattagagatatgaga
gcagtatacaacgtcctttcgttatttaaattggatagatttaataattcgaatccattc
tctacaattagtttaaatagaaaattcctaactttcttcactgcgctatacaacgatgtt
gaggtgttaggtcaaacttctatcagtatgttacagagaaatttaaaactagtaaagcat
agagtgaagatgttctcagcaagtaaaaaaggtaatttacataccgaagaagttgagata
ctaaataataaaaatagtttagagagaaatgatatcagagttggtttgttcttaagaagt
aatgatggaaatactgttcagattggcgatataaatcttggagaacttcatgaaaagaat
gtatttacagtaaatgaatacatatattcttcactatatatgatggaagacgatgattat
ttattttttgataatatattaatgaagttactaaacacttacatcgcaaagagtaactac
tctaagttaactagggatataatagaaagagaaactaacattaattactcgataccaata
gtgatgagaacaatggcaaatcgtatagaactggctaatccaatcctatactggtattct
aaagagattttaaacagtgatgaaatatgtataaattgtcctattatcgaatatgttaac
aagtttaacgagtttctaaataattacgtaagattaggatatttcagaagcgttttcctt
>SSO0500 Hypothetical protein
atgtatacgatattagcttatactgacactatagtttttaatgttattaggaaagctgca
tacgaaaatttttgtacagtgtatactattagatcctattcaccttcaaaactagtagct
tccgtaggtaatattatgattattgtgagtaggaataataagagcgctaccataagtgta
aaatgcggaaacgcgaaaaaatcgttttatatcaaggtaaacgaaaataggataaatttt
gatggaaatgaaatggacactaacttatttatttatcatatttcatcaattgagaatgag
ttatatgaatatgtaaagattataagcgaaaaatgcaatatgcaagagatttgccataaa
caaaagaagggaataaaagaaattttagttgagggtaaaaagataaatattggtgaagag
attaagcatagtctagagcaacttttaacaatactctataagagagaagtttctgttgaa
tgtagtaaaagttccttatgtattaaaaaagttatactaactaggaggaaagtttacata
caactagtggatagtgaaaaggaaaattattggtatcttgagctgaatgatttaataaac
aaaatgccagagcacgctcaggagattcttaatattgaaggacaaattcgcgctcaatca
att
>SSO0501 Conserved hypothetical protein
atgcaaatattagtagaactacatcccaagaaaaaaccggaaaaattactaaatgaaata
aaaattttatcgtcgtttgatggatttgatataccggactcacccatgggtatgccatca
cctataccgacttttgtggcttctttaattagatattctctatctctagacagaaaaaca
ataatcataaaccaaaggctattagatgtcaatgaattatttatccgttcattatcaata
accgctaagatgttagatgcccaaatagctttcacaaagggggataaaccgaaatacgga
aaagaagtgggttatttgtcatcagacgaggctgtgaatttggcaaaagaatatggtgta
aaaagcggaatgatgataagtttaagaaaaaatgagaatgaaattatggccagattggat
tcaaatgccgatttcttcctagttcttagaatgaaagatgtagatcagattaagtattat
ggtccaaagcttattgaaagagcaataccttacttaatagtaatgactgataagaataga
gaattagtaaaaagcctcgatcaaccttcttttgtagagaatgagatattttcaattatc
aattcgcttgatagtataggagtaaagacagtcttaatttcatctctaggtgatttaagc
ttcttcgaaaggttacacgcaagacta
>SSO0502 Conserved hypothetical protein
gtgagtcaagagaaaaaagccaaaaaaattattcttcattatcctgatgatacaccagct
ggatatatagagtatgctgagggttcttcctcaatttatgataatgagggaaattttttg
tttaaagtggaaggaaaatttccgccacagcccaaaaaatcgtcagattattcatggata
gaaaaagttttagagatgggattacaagattcaaggaagagatttatactttacgttgca
tcaagatatttagtaaatgtaaaaggcgttaatgaagatgaagccttacaaacattaaaa
gagttctattacaaactacaatctgggaaagtttacgagtcttggttaaaatctgtaata
aacggagttaagaagaaaggattgcttccttggtcgttaaagagaatagaggagagggat
aaggaaatgtacaatgagataataagagtattaaaaaatagc
>SSO0503 Conserved hypothetical protein
atgataagcatatccacactactaaatccaccggaaggattaaccatttcagaaattctt
ctaatctcagtaatattaggtatgctacatggtgcaactcctgatgaacatacatggcca
ataacgttcagctatgcaataggtaaatatagttcaaagggaggaatgaaagctggattt
ttattttccttaggttttactattcaaagagcatttttaaccacaataggttttataggt
ctagcagcaatctatgaaaaatacaatttggatggtccagtatataccattgtcggtatc
gttatggctattgcaggctcttatatcctaaaaggaagatatttgcatctaccaatagac
gttctatttaaaagcaaatatcataacacaaaaactactggagcagaattgcacgacgtg
cctttaaagatgactatagttcatggtctaattgctggttttggttttggagcttatgct
agtataataacgtttgttttagcgcctcaactaccctcaatagtttacgcaccattacct
ggattaatgtttggaatagggacaatgattatgcaaataatctttggggctatatttggc
aatatattacgagcaaagaagttaactgaggaaaaaatatcatacgttgcaaggaaaacc
gcgggaagaacgctttattatggtggcttagtatttactatagtaggtttgctcataata
gggttccccattattgataattttgcaatatcgactggaaatccaatacctaatcttgat
gctatagatataggatttctattagtgatcagcgttgttggtatcataggtataagtagt
ataatactaggaattaaagaggctactaggttatctggtacaaaccagaaaccgggtagc
ttatctggatacaaaaagtct
>SSO0504 (leuS-1) Leucyl-tRNA synthetase (EC: 6.1.1.4)
atgtatagtgatttcttcaactccatagcttttaaatggcaagcggaatgggagaaaagt
aaagtattcgaaacaaatatggactactctaagcctaagtttttcataacggttcctttt
ccttatacaaatagtccaatgcatgtaggtcatggaaggacttatattactgcagatatt
tacgctagatatttaaggatgaagggttataacgtattattcccatttgctttccaattt
acgggtacacctgttttagctatagctgattcaataagaagaggagaggttgacgtgatt
gagttctttaagaatgtctatgaagtaccacaagataaaatcaaagagctggaagatcca
tataagttggctgaatattttaaagaggaaatgaaaaatacagcgaaaagcatcggtatg
agtattgactggaggagaacctttacaacaactgatcctagatttgagaagttcatacat
tggcaactaggtaaactaaaggaactaggttatctagtaactgaagatgatgttgttgga
tattgtcctaatgatggtttcccagtaggtatgcatgatacaaggggtgacatagaacca
gaaatcactacgatgaatgttatcatgtttgagggcagcgattcctataatttcatggta
gcaacttcaagaccagagctaatattcggagtagtagcactaatggtaaaccatgatgct
aactatgtggttgtcgaatatgagggcaagaattttataatatcggaaaaggcctacaag
aaattatcctttcagaagaatatgaaattagtaaagactatcactacatcagatatcgtt
aaattatatgcaataaacccaataactggaagaaagcttgagattatcaaaaacaagtac
gtggatccttccctaggaactggagttgtaatgagctatccagctcacgatccatttcac
tatttagcgatgaccgagactaataaggaatttgaagtaataccagtagtagagactgaa
gaacttgatgagatacccggtgaaagtgcagttttgcaaactaagaatccatatgcatta
aaggacttcatggaaagtatatacaaaaccgaatattataagggatatatgaaggatata
atattgtctttagtccctgatttcttaaaacaatacgtaaaggaaaacatcgtcggaaag
caagttcaagaggctagaaaaaatacaatagaattattgaaatccctaaatatctacgat
actatttatgaaatctccaatggtccaatttactgtagatgcggatctgaaatcgtgcct
aaaaggataaaggatcaatggtttatagcttatgataatcctaagtggaaagcgtcagca
cttaaggctataaataatatcgaattaataccgaatccgactaagaccgagctagaaaaa
attgtatttaatgccagaaaagaacctatagggagaagtagaggcataggggttaaatta
ccttgggatgagtcacaaattgttgaaagtttaagtgattctacattatacactcttcta
tacaccgtgatctataaaatgcctattaacatcgaaaaggagatctttgattttatcttt
ctaggaaaaggagatgctaaagaacttgaaaggaagtacggtacagatcttatccaacta
agagaggaattcctatattggtatccggtggatcaaagacataccggaagagatttaatt
caaaatcatataccattttatatttataaccatcttgcaatttttggtgaaaagtaccta
cctaagagaattgtaatcaatggctttgtgagagttggaggaagaaagatgagtaaaagc
ctaagaaacatttacacattatccaaagcaatcaaggaatttggcgtggatccggtaaga
atagcgttaacctcaacttcagacctactgcaagatttagactttaatgagaatttggta
aatccaattgccgagcaactgaagaagatttatgatctaatagatagattgttgagcata
aatactgagattaaagagttaaggacagcagacgaatggatatcctccaaagttagggat
ataatagaaaaggtgaataataatatcacatcttttaagtatagggatgccgtgaattta
cttctatatgagatttacgagattttaagagattattttgatctagttgaaatacccaat
caagaggttataaggaaaatattatccatatggataagggctcttgcaccatttgtacca
catattgcagaagaattatggcataaaatttcaagtacttttgtttctttggaaaagtac
ccagaaccaaatgaattaaatctgtatccagatgccatactagagatatcctacattaat
aaaattatagaaaatgtaagggaactggaggatattgtacataaaaaagccgaaaaagta
ataatatacattaacgagagcgagaaagtcaaagaattaatgaaaaacgcaataaaagct
gttaacgaggaaattccattaagggaattcactgcaaacactgaagataagattgcagaa
aaagtttacgttgttgtatcgaaattagacaaagctataagagattatctactgaataat
gaaatagatgaagagcaaataatagtaaagaatatgaatttcctattaaggagattaggt
gtttcagaaatagtaatatacaacgcagaagacccaacggtaccggatgtaaaaggaaag
aaatctcaagcattacctttaagtcctgctattgtggtagaa
>SSO0505 (iunH-1) Purine nucleosidase, putative (EC: 3.2.2.1)
atgagacactttataatagattgtgataccgctgaagacgacgtattaagcctatatctt
ttattaaagaacaacattgacgtagttgcagtaactattgttgaaggtaatatatcgtac
gaacaagaggtaaagaacgcactatgggctttagaacaagtcaaccgtgaaattccagtt
tatcccggtgcgaataagccattattaaaaaattacataacagttgagaaggtacatgga
aaaggtggaataggcgatgtaacggttgaacctaaaaggttaaaagcccaagagaaacat
gcggcattagcgatcatagatttagcaaatgaatatgcgggagaattggaatttttagcg
atttcacctctaactaacttagctttagcctacttattggataattcgatcgtaaagaaa
attaagaaagtctgggtaatgggtggtgcagtattcggaataggtaatattacaccagta
gcagagtttaacatttgggtagatccagatgcagctaaaatagtatttaacgctggtttc
gatattacaatgataccgtgggatgtaataatcaattacccagtaacggatgaagagtgg
aatgtaatcaaaaatatgaagactagaatgagcgaactttacgtttcaatgtatttacac
tacagacaatactcttcaacggtacagaagataaatggtcatcctcatcctgatgcaatt
acaactgccatagctatcgatggaagtatagcaacgagaagagaaaaaaggtttgtagta
atagacaacaccgataatattaccagaggtatgacactagtggatagatttgatgccgac
actagttggtctgacaaacctaatgctgaaatagtttatgaaataaataagaaaagcttt
atggaaaaaatttatgatttattaaattggttt
>SSO0506 Conserved hypothetical protein
atggaaagaatagtggaacttgaagaacaaataaaaaaggagaggaacaaagagaagaga
aataccctatatatttcgcttatccaagaatatcacaatttatataagaaatataagaat
actgagttcttggatcgagcactatccattgcaaacaaaattgaaaagaaaaaccctact
gtcctaaatattttggggctaatatacctagaaaagagaaggccagatatagcaatttta
acctttaaagaactacttagcaattacaatctaaataatgaagacaaaaatgtaatctta
tacaatttatctttagcttattttcaaaaaggggagctattaaatgcgtataacacatta
aagggattagtattaaactcgagaggagagataaatgttctaagtaagaaattattagtg
aaagtttgtctagcactaggagaaatcagatatatagaagaggcgagagaattattggag
gaatttaatattccctctgaggagcttgcaatagcatatgcagcactggctaaatactat
aatgacaataaactattaaaaaaggctaaagatatcgccatagttttaggaaatgaaaaa
attctagctgatatactttcaatatcagacgacgaggaagatttaaggaaagcaatacag
atttatgaaaaacttggagatcataatagtgaattgaaaccattatataagctatcgaat
aaagatccatccttatttgcgcagatattggaaaaaataggaaatcttgaggatagtaag
gacaagcttgtcatcctttatgacatctataggaggacgaaaattctacaattccttaaa
gaagcaataaaaaccgctgaaaaacttcaagattatcttttcctagctagggcatattca
gagttagccaattatgaagaagaggtaactaatctgagaaaagccatttcgttctacgaa
aagtacattgagaaaagccaaaag
>SSO0507 Hypothetical protein
ttgagaaaagccaaaagtaaaaatatattcaccctctcttcttattatttcatgataaaa
catgctgaatacaccaggcatggaatcacagaacccctaatgctaataatgctctataaa
aaagttgaagatggcaaaataatatctgcgtttagattttccgtgtataaaaacatgata
ataattgtatatgaagaagataagctatctgggggagaagttctagacttcgatatatat
aatatgacgaatttgataaataaaattaaaaagtattatgatgaatcaattgacgatata
gttatatttggggagaaacaatatgtagacgaatttctaaacaaattcctaagtgatgag
gaagaagaaacagagaaaaga
>SSO0508 Hypothetical protein
atgagaacactcccaacccgcacatcttgtatctcagcaccagcctttcgggatatagac
ccacatttggtggtgcatcatcagattatattatgtgattttttcatattgacctatata
aactttacggtttatcggaaactgctgataacggctgaaacacaagagatagaagagctg
accaagttaatcagagtctactttcaattagacgaagtacttagcttcgtattagaggaa
cttgaagatgacgaggtcatagcagagctctctgctacgaaagataagataaggaaagcc
attgagaggatgataagc
>SSO0509 First ORF in transposon ISC1173
atgaacctcgtagccctcgcacaacttatactattcgtcctaagaaatttaaaccttaag
ccccgaaagcacaagccagaggaaatcgcattagccattgcagcttacgtgatgggagta
cagatcacgaagctcaatataccgccctccacgttgtattactacaccaagaagctcggg
gtaaagaggaggaaggacgcgagaccgagatgtccttcctgcaactcggatagcacttta
cggttttctcctcctcttgaacagttttttgatcccacccgcctcacggtaaatactttt
tatcaatctggccaaccttttggccccgagtaccagacccgtggagtacttgaagtattg
gacaacgaggagagagagccttcaaggccacgaagcctgagttcc
>SSO0510 Second ORF in transposon ISC1217
gtggtagatccgtacccgttagcgagttccccccaaggggagtacctggtggagtacttg
gggactcccataaagttacttgttatagatgactataagggttacgggaggaggtatttc
ttctccaccgaccttaacgacacggctgaagatatcataacgacctgggagaaccgttgg
gacatcgaggtcttgatcagggagctcaaggccttgggactcgagggtgggtccttcttg
acttgggttaggaactcaggcttcgtggccttgaaggctctctctcctcgttgtccaata
cttcaagtactccacgggtctggtactcggggccaaaaggttggccagattgataaaaag
tatttaccg
>SSO0511 Second ORF in transposon ISC1173
ttggtcataccaaaattaaaggctctaattttaaaaagtttttatgggcctcttgaactg
ccaggattttccgataaatgctactcggatcgcgtgatcaagaacggttcgtccagagga
aagagcaagtacaagtgcaaggtctgcgggaggaccttttacagaactgcgagtcacagg
atgagcagggagcagagggagagaatcttgagggagtacaccaacaggatgagcttgagg
ggaatatccaaggttgagggaaggcccttgaccacggtctacagctcggtgaagagggca
gccttgaaggcttacgttgacttgtcgatcttgcaagcccaattgaaggccttcaggtcg
aagttcgcggtcctagacgagagctggacttacgtccgcgtgagacgcggtcccagacga
cagaacctctggatctggaacgctttgatcgacggagtccccttctttgtcaccggtgac
agggactacaacaccttccgtcttctttggctgtcactccccaagtgcgaggtccactac
accgacgactacccaatctatcaagtcttgtatcaccacgttgtgggcaagaagtacacc
cacaccgtggagagctacaactcattctgtaggtcgcacttagttcggctagctagggac
acgaaggccgtaaacaggagcagggcgatgattgactacagcctggacttgttgaacgtc
atgtacccgcaagctttcacagacgagaaaactcccttgaacttagcctatttgagcgga
gtacagtatattagagatcatctaata
>SSO0512 First ORF in transposon ISC1217
atgaccaaagaattgacgagggaggagtactataaggcattggaaaaggcagttaacgag
gtcatactatccatgactggaacgaggaaggacgttgcaaagaggctcgtcctgggggcg
gttgtgggaagaaatgctaccgagatagctcaggaggccgagatggactacgagaccgtg
ttgaataacttagacaaagcagctcaagccaaactaatcgaggtcgtgaagaagttagtc
ggggatcatcctgtccttctcatagtggacgacatccacgaccacaagctctacgctagg
gccatgccggtctccagaaacggggcgcagatcttctactgtagggcgcacaagaggttc
gaacccgcgatccaactccttgtgattggcatcaaggatctggtgaacaaccagatctac
gtgatccacataattgcctacataccccgaaaggtggaagaggagctcaagcgtaggggt
gaggaggtgaagttcaggaccaagatagatgccctcttggagtttctctcctccctctca
ggtttgaatgtgaaatccaaggtcttcgactcgtggtacgtgaactcgaggactctccaa
gggaatactgtgggggaactcaagtccagcgcgcgagtcgtcgagggtggtagatccgta
cccgttagcgagttccccccaaggggagtacctggtggagtacttggggactcccataaa
gttacttgttataga
>SSO0514 Third ORF in transposon ISC1229
ttgaaggaggtgaggaaaatgatagagggtaatgtgcctcaagaccacgtgttactcacg
attcccggaatagggaaactggcagctgggattataattgggattgtgggtgatattagg
cgcttcccaagacctgaatccttcgttgcttattgcggtttagacccggtggttgagagg
agtggtaggattgaggttagaaagggtatctccaagaggggtaacaagtatttgcgtagc
ttgttttatttcctcgccgagactcaatactctcgtaacccaactctccttaagttctac
gaagctcacaaggacaaactgaagggtaggaaactgtacactgccttagctaggaagttg
cccaagtatagatggagtgtttggtataataataagccttatgaggtgaag
>SSO0515 Transposase ISC1359
atgaaacatgagaatacaactaaaccggcgaagttcaaccgggacttcgccaggtccgcc
ctcaagataatttactcggtcctcactaaaatacttttccctgaggaactcctcagtgcc
ttgcttaaggcgagtgggagctacttgagcaggttggggaaagatgggagaagagcgttg
agaaagttgaacgcggttcaagttgaggacgtgagggatgcgttgaggaagatgggaagg
atgacgttaaggggagtcagggacaggagggtagcagtggacttccatgccatacctcaa
tatcacgctgacaagagtttcttgagtaggataaagccaactaaggggacgtcgtgggga
ctggttcaagctgcgatcttcctcctggggaggacgaggagcttcttggacgtgatccca
gtgaccgtgaagaacgtagctgaaggtttcaaggcggtgatggaggtaatcgtgaaggag
ttggaggaggacaagctgaggctcgtcatggtcttcgcggacagggagttcgcggtgaac
gaagtgattaggttcctcttggagttgggcttggacttcgtcatatctgccaaggcccag
atgtacaagaagtacaaggggatgttgcaagatgtggatgtgagttttggcggagttaga
tatactggatttctctgcgtgagacatgggagtggagcttatctcattattctgaggaag
gaagacggcaagattattgccttcctcgtgaggaaggagatggatctttatgatgccata
gtccttgccgagatgtatagggagaggtgggggatagagaacgccttccgctctcttgag
gagttcaggatcaggactaggacttgtgacgtgaggaaggaattggttctcgttctgctt
tcctatcttctcttgaatgtctggttcttgatccgctcttggaggaaggtaaagttgtgg
gagttctcggtctccctctcgaatctcctcgatcgggaggtaagagtggaacaagaacgc
gcgttccgtgaagtgaagacgtcattcccccagactccagctaaccctatgcacctcctt
ccagctacg
>SSO0518 First ORF in transposon ISC1229
atggtcgatctcgtaactgaagcaaagtcttcgggcgagggcgtgacgagcccctacagt
cagactgaacattgtgaaaatattcacgaatataggtgtgacacaagggtaggggtaatt
ggaatagacgtatcaaaagaacacttggtaacaagtaaggggagggtgaggaaattcaca
aacaacgagaagggctacgaagaaatactaaccatgaagccaaacatcatcgtgatagaa
cccacaagagtatactcaacaagaccttgccaatacttcaaagaaagaggagtgaaagtc
ctactagtcagtactaccttgttatggaaagaaaaggatgtaaggggaaaaagattttta
cgacgcagaaaaact
>SSO0519 Hypothetical protein
atgaagtggtttcttctattgttgttagtgtttggagtattagggattataccaataaca
aatggagtcattacgggaccacacccgcaatttgattctggtggaggctttgctggtcct
ttcttcacttactctaagacgatgacgatacaaagtgggcaaagtcaaacgaagaataat
ggctcaacgctttcttctgcacaatggcttaatccaagttacgttagcatttacaatact
tattatttgcaaatcttaccaaaccaagaatacataagtaataatgtgtctttttcccta
agcgcaagtcaaattgcaataaatgttactttcttgttagcatcatcaagcaatagtggt
gcttttggttctttagcaataggatatggcacttacattccttcaacattcacaaacgct
ttcgctccttccgttccttcttctgggataacggtatatttgatgaaaggcggtatgaat
acatatcatctattcgtttattttgacggtgtgaaacagttaaacgtctctgtaggatct
atttcaatcggggaacaaataggattagggttttattatcttccggcatcgaaccaatta
tatgtttattattataatggaagtgttaaaactttttcattaactccttcccaagtagtt
ggtacaaatgtgttgggagtgttctcaaacagtcatgaaattcgaaaaacgtttgtaaaa
atattggag
>SSO0520 Hypothetical protein
atgaagaaatcagttttgactacattagtaatagcccttgttcttctcggtacatcgctc
tacctatactcagtaaaccaccccgaaaaaacagtaataactataccatcaccgtatacg
tatacggtgtcaataaacactacaacgctgacagcaccaataggagtaccattcgaaggt
cctattatagcaaccacttttatacacaccaattatactccgccaccttattatgccagc
ctatggcttgaaacattagcagtcggtatagtactacttttaatatcaatccttcttcta
agacgtaaattc
>SSO0521 Hypothetical protein
atgaaaagatctattgttctgctttctatggtttcgatcgtattaatagtattaggaggt
tatctatttgctatagataagcctactgtagtataccccgagataaaaggtcagataata
actgagactggcgtgccgaatgcttattggtggggctacccagccattatagttacacct
caagaactagctcagctaaaacaactagccccacatatagtcccaccaccatggtatgct
acactatggccaataccactagtcggtggtattgttggattgatttattcagtagtaaga
ttgttaaagaag
>SSO0522 Hypothetical protein
atgaaaagacacctactattagtggccccactattcctattattaatttctctaaacgca
ttagcagtaactgcaaatcagttgggtgcgtcaacaatactcactacttacaatagtgac
aattgggctggtgttgcttacgctgacgaatggcgttcaggggttactaactattgggca
gtagtacagtgggctagcgagagtatatatgttggaaatctatcattcgcctatgccggt
tacacaaatcctaatgcagtttctatatgggttggtctaagccccgccaaaataggagtt
ggcactgacgcttcaacttcagaagtaacaaataccttcgcccaagccggatatgttata
catgtttattcaaacggagtagtgacagcggagtattttgttatggttctcaataacggc
caaatacttcctaattttgttgaagccccagtacccgctggcgtgccagcatatctagac
gtattcttagacaatttgtttaattatacggaattagctcagttctacgtattttacaaa
aacggaagctattggtctacatctgtgtacatatctacaccatttaatacgacagggtca
gctatgagtatagttgaagcacctcaaccaactgaaaatgggaacaaccactttgagttg
ccacttatgcaaggtgggatgatacattttacgttcggctatgttggcccaaataagaat
gactatagtggccccggtaatgcaccgtcaggtactacaatgtatgctgttctcttcaat
cttaatgaagcatcatattacaacacagctgaagctgtaattgccaatgggtgggctaat
agtcttggtggatgggattacctataccaattcatctatcctgatttaggaataactacg
acaggtcta
>SSO0523 Hypothetical protein
atgagaatccttaaaatagtatgggttctcttcatcctactaaacgtttatgatgttgta
atatccgctatatatgcgataccgggaactataacagatggtgcagtatgggaaacgaac
ctcattatatcgctttatgcttattatgaaggctctatctcgtttgttttagcagtatta
atgttaatatcactcaaacttctgcttttcactggagtttactggtatacaaagctcttc
gacctattgaaggtaagtaagtacaaatggctttcattgctaccgtttatcgcagtatca
ttcctcgtagacttaggtagtacatccgttctcatctctcaacacataccgcctttc
>SSO0524 Transposase ISC1234
atgactcggacgttaagaaacgtcccaaacttgatgtactaccctcttcccccaatagag
gatatgccgtggagggaaaaatggttaacggagatcaagcccgtgctggacaccatggat
ttggagagggttcttggcgagggcgcgctggtttacctgaagttgttagtcgtcatggtg
ctctactcttgctcctatagggacgcggtgaaaatggtcaacgtgaacgtggtcgtggcc
tggttcgtggggaggaaggtggggaagagcacgctgcacgacttcgtgggcaggttgtac
ggggtgaggaagaagttgttggagatttccttcaagcttgaggagaagtgcctacccagt
tacctccctgcgagcgcgcatctcgtggacttcatggcgtggctagtggactccttccta
ctggacttacctcctgggaagaggagtgtggagacctttcgggagaaggcggagctggag
aggagggaaggtaacttggagagggccaggaagctgctctccctggggagaaccaagagg
aggttcgagggaaggtggaccaagaagagaggggtctcgcactacgggctcaaggcagtg
gccgtgatctccgtctccctcttcgtgaggtccatcacggtgaagccagccaacttctcg
gacaagaggttcaagtcaccgctcaaggggattaagatcgcggacaggggattctctccc
tccccgacacagctcatagcgcgggagaagcccttcactaccctgagggtccacgtggag
ttcttcggcacctacctgaacgcgttctggaggccctacgggaccacgacctggaggaac
gacgtcttccttcacgtcctgggagtgatctacaacatcaagatgttcctcgcgatccaa
cggaggactcctccaggacgtagagccgttcagctc
>SSO0525 First ORF in a partial transposon ISC1439
gtgcaaggattttcctataaatgctactggaagagaaaaggaataaagatgagatccttg
gacttcgtatatcccttaaggttacccctcctagtggagatagcagatttgagaagcgac
agtccatcacagttcctacttaggagcgtgagggaagtaagccaatacatggaaatagat
tacgttgtagctgacgccggattcttgaacctagacgccatcaaggaaatgcccgtgaag
accattgtgagaggaaagtcaaacttgaagagatccaaggaactatctaacgttccatta
gttgagaagagatacgaggttaaggacaaggtttacgttgcgtatagggtcttgaaattt
gaagggctttattattacgatgtggtttacgttaaggggaagccgaggcacttcatcttc
gtgacgaacttcgagggagatccttatgaactggcagagctctataggttgaag
>SSO0526 Hypothetical protein
atgttattagaggctcaaaaattgatctttgacatatttaagaaagataaaaatgacgag
attaaggagccattttacgctgacgagtacggggagtggttaatcgtctcccataataag
ccattagtatatatttcaaatattttgcagaaatcaatcaagaaagccggattaaagaat
cacgatctatatgtcattcaatatatcgaagatgaaaaaataagaaatttggctagtata
aaggggatgatttgtggtaatggaaatataaaagagctagatctagccactacaataaaa
aattctttaagtgatactcttacagttggtgagataaagatatttaaattgaagatttgt
gggattcttttcatatttttctacatagacgttgtagttagaaatctgaaagaaacacgg
ggttctgtaaaactcctctttccaccaattggagtaagtttatatgaaataccttatact
cttcaatcattaataaagagcgtgattgaaaaaacccttggagttaactgtagtgtttcg
gaaatagatactggtgatgggacgcgacttaaagcagtagcagagtgtagaatacagcaa
accttagagtcaatcgaacctttaaagaaagcattagaatattttagcttttctgagcca
aagatctctttaaacaggagtaatattaggcaaattgagttgcagatatttataaatcag
ctgaagactaaagccttgatacccctaatttgggatcgttttattatcgattctctgcgt
tgc
>SSO0527 Phosphoglycerate kinase (EC: 2.7.2.3)
gtggggatctttctgattaaagtgggagacttaactatacccacaatggatgatatagat
atccaatcaaaaaaagttctgttacgaatagacataaattcccccgtagatgagaacggc
aaaataattgatgattctagaataaaggcacatattggaacaattaaggaattgattaat
aagggcaattctgttgtgttaatttcacatcaaggtaggcctggagacaaggatttcaca
agtttagaggaacatgctaaattaatttcaaagtatttagatcgagaagtaattttcgta
gatgatgtaataggcccatatgcaagggaaatgattaaaaaattagaaaataatgggatt
ttactcttagataatataagattaatttcagaggagttaatagaggctccaccacaacaa
cacgtaaaaagctttttagtaaagaaattagctccgcttttcgacatttatatcaatgat
gcgttcgctactgcacacagaagtcagcctagtatcgtaggctttcctttagctttacca
tcagcagctggaagagtaatggaaagggaagtttcagcgttagccaagatttttaatgcc
gaagacacaccaaagatatttacgttaggtggtggtaaggttcacgatactattaggata
attgaaaatctagtgagaaaaaggatagctgacagaatacttactgggggtttagttgca
gaattattttctgtcgctaaaggaatgaatttaaatccaaagaatatggaaattctggaa
aaattaggtatactgagtctaattcctagagctagaaaactacttctaagtggagctcct
atcgaaataccagttgactataaggtagaaataaacggaaacgtaatcgaggaaccagct
agtaaggtcactggcattataaaggatatcggatccactactgcagaaatatactcatca
tttataaaagatgctaaagtagtagttttaaggggaccaatgggagtaatcgaagatgaa
agatttaagagtggaagtaaaagcgtcttaaaagcatcattagagggacaaggttacgtt
ataataggaggtggacacatgataagtgctttagatgaggatatgaagatagatagtagt
aaagttcatatctctactggtggaggagctctcctcttattcttatctggagaacgatta
ccagcattagaggcattatcaatgtcggtggtgaatagcggtgat
>SSO0528 (gap) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (EC: 1.2.1.12)
gtgattaatgtagctgttaacggttatggtactatagggaaaagagtcgctgatgccatc
attaaacaaccagacatgaaattagtaggggttgcgaagacatctccaaattacgaagct
tttatagcacaccgtaggggaatcagaatttacgtaccccaacagtccattaagaaattc
gaagagtcgggaataccagtggctggcacagtagaggatctaataaaaacctcagatatt
gtagtggatactacgccaaatggtgttggtgcacaatataagccaatttatctacaatta
cagagaaacgctatatttcaaggtggcgaaaaagctgaagtagctgatatctcattctca
gccttatgtaattataacgaggcccttggcaaaaagtacattagagtagtatcatgtaat
actactgcactacttagaacaatatgtacagtaaataaggtcagtaaagtggagaaagtt
agagcgacaatagttagaagagctgctgatcaaaaggaagtcaagaagggacctataaat
tcattagtacctgatcccgcaacagtgccaagccatcacgcaaaagacgttaatagcgtt
ataaggaatttagatatagctacgatggcagtaatagccccaacaacactgatgcatatg
cactttatcaatataaccttaaaagataaggtagagaaaaaagatatacttagcgttcta
gaaaatactccaaggatagttctaatctcctcaaagtatgatgcagaagctacagcggaa
ttagtagaagtggcgagagatttgaaaagggacagaaatgatattccagaggtaatgata
tttagtgattcgatttacgttaaggatgacgaggtcatgctcatgtacgcggtacatcaa
gaatcaatagtggtaccagaaaatatagatgcaataagggcttccatgaaattaatgagt
gcagaagattccatgagaattactaatgaaagtttaggaatattaaaggggtatctaata
>SSO0529 Hypothetical protein
atgagtgaaccatcttattttgtaagcttctggttaaggaaaatactagtaccagtggat
ggttctgagaatagtttaagggcgctagatcttgcagtagacttcggtatgagatatggc
tccaaaataactataatacatgtatgcagtgattgtaataatatgaacgatatacagtca
cttattgaaaaaagaataaacaataagattgaatatgatttaaaaatagttaagattaac
ataaaggagtctagtgtttcaaatgagatattaaaggtaataaatgaggaaccatatgac
gcaataataatgggtgcaagaggaacttcactaaatagcgatataaatataggctctaca
gcgttagcaatatcgataaacgctccagtatctgtgatattagttaga
>SSO0530 (glyA) Serine hydroxymethyltransferase (EC: 2.1.2.1)
atgtcacttcctaaagaattagaaaaagttcttgaaattactaaggcacagaacgtatgg
agaaggacgcagactttgaaccttattgcatctgaaaacgtaatgagtccactagctgaa
agtgtgtatatgagtgacttcatgtccagatatgcagaaggtaaaccatacaagagatac
tatcaagggaccaagtatactgatgaaatcgagactcttactatggagttgatgaatgag
ataacaaactcaaaggattgtgatctaagacctactagcggtaccatagcaaatgcggct
gtgtttagagttttagctgagcctggagataaggcattaatagcaccagtccaagctggt
gcccatgtcagtcataccaaatttggaacattgggagctttgggtattcaacatattgaa
atgccatttgatgaggaaaacattaacgtagatgtagataaagcaataaagatgatagaa
gaagttaaaccaaaattcgtagtgctaggaggcagtctttacctatttcctcatcctact
aaggaattagctcaacacgttcacgctgtaggagctaaattggtttacgatgctgcacat
gtttatgggttgatagagggtaaagtttggagtaacccactaaaagatggagcggatatt
atgactgtctctacgcataagacttttcctggtcctcaaggaggagcgattttctctgat
ggttcagaagtttttaaacaagtctcaaagacaatattcccatggtttgttagtaatcat
catttgcatagattaccagctactgcagtaactgccattgagatgaaatattttggcgaa
agttatgctaatcaaatactaaggaattcgaaggctctagcagaggctttagctgaaaga
ggatttaaggtaattggagaaaatttaggttatactaagagtcatcaagtagcggtagat
gttagacaattcggtgggggaaataagatagctaagctattagaggacgcaaatatcata
gtaaataaaaatctattgccctatgataagccagaagatgtttccgatccaagtggctta
agaataggggtacaagagatgacaagatatgggatgaaagaaggtgaaatggaggagata
gctgagctatttaagaaagttattatagacaaaaaagatgttaacgaagttaaaaaagag
gtaattgagatgagaaggaatttcttggaggttaagtatacattcgatgatatgaaagat
ttagaaaagtactcgtcaaaatcattaaaattgatcatc
>SSO0531 3 hydroxy 3 methylglutaryl coenzyme a reductase (EC: 1.1.1.34)
atgaaaattgatgaagtggttgaaaagttagtaaagggagaaatttcttttcatgaagtt
gacaatttattagaagcaaatgctgcaatggttgcgaggaggcttgcattagagaagatt
gtaggagtcggtcttccctcaattggttctacagttattgattatagtgagataaaaaat
aaaaatgccgaaaatgtgattggagcaatacaaataccattaggtatagtggggccaatt
agagtcaatggtgattacgcaaagggcgatttctatgtacctatggcgacgacagaagga
gcgctaatagccagtgtaaataggggtatcaaggctgttacactaagtgggggagttagg
gctaaggttttaaaggatgaaatgacgagagcccccgtttttaagtttgattcaatagaa
cagataccgaattttctaaagttcatagaggagaatcttgagaagataaggaatatagcc
aattctacctctcatcatggtaaattaaaatccattacacctttcgtactaggcaataat
gtttggcttagattttcctttgaaactggtgatgctatggggatgaacatggttacgata
gcagttgaaaaagtatgtgagtttatagaggaaaacttcccatcagctgattgtttagct
gtaagcggaaatatgtgtagtgataagaaacagaccaatgtcaatagcctcttcggtaga
ggtaaaactgtagtggctgaggctctcatcaagaaggatgttataaggaatatattacac
tctaatgctcaactaattcatgatataaatctacggaagaattggctcgggacagcaaga
gcaggatccttatctcaatttaatgctcatttcgcaaacatagtcacagcaatctttata
gctactggccaagatgtagctcaaatagttgagagtagttctggatatacatggactgaa
gtaagaggagaggacttatatatatcagttacactgccctcgttagaagtaggaactgta
ggaggaggtacaaggttacctacccagaaagaagccctatccattatgggagtttacggc
agtggaaatccacctggctctaatgctaagaaattagctgagatcatagcttctactgta
ctatctggggaacttaatctcctagctgctttatccaacaaggagttaggtaaggctcac
gctaaacttggaagagctatgaaagtc
>SSO0532 Conserved hypothetical protein
atgaaaatagctcctcctcaagtttggagaaataaaagattcatgtataagttaacagcg
agtaggtgtgaacgttgcggacatataagctttccatattcatcgtattgcactaagtgt
ggtagtaaaaacgttaagaagattgagataagtggcaagggagtattagaatcctacact
gtttcctatcaatctagagacgggcacgagaaaggccttccaagtgttattggtctggtt
agactagatgaaggtgtagaaatagtagcacctatcgtagatgcggatttagataaacta
aaagaaggagttaaggtagaagctacattaaggagagtttatacggactcatataatggt
ttaatacagtatgggataaagtttagggtagctgaagga
>SSO0534 (acaB-1) Acetyl-CoA c-acetyltransferase (acetoacetyl-CoA thiolase) (EC: 2.3.1.9)
atggtagaggtttacttaaattcttcatcaatgattccaatagatagatattacgagtat
gatatttatgatttggtaatagaggcctataagaactttgaaggagaatacgatgtaaat
agtattgacctaattgttgttgcgaatgcctattcccaaaaactgaataacgcgtcttta
attgcaccaaagattgctgaaaagatagggaaacctaacgtaccttctattaaagtggat
aacgctgacgccagtggaggtgctgctttacttacagcttattcactgattaagagtaat
atggtaaattcggttttaatagtaggagttgagaagcagtcggattatccttctaagtat
ctttatgatgccatatccaccaatttagatgattacatgttttataatggcatctcttct
cattcagtagctgcactattaatgagacagtatatgaaaaggtatggcgttgatagaaat
tattttgcgaattgggctatcaaaatgcacaagaacgccacggaaaatccttttgcgtat
ttaaggtttcaggttgacttaaataccgtaattaattcgcagattatctcagatcctgta
agattatttgacgtcggtgcgagagctgacggggctgcaatactcttactttcaaataat
aagactgagtcagcggtaaagattaataaaatcctttccgcacaagccagatatgacttt
tctccatctttaccttctgtaagaatgttaagggataagttagaattgaaattcagtgaa
agaaccgggattgatattcacgactcctatagtattatggctgctttaatgttagaagaa
gcgggaatatttgaaagcggtaaatccttgcataatttagatagtgtgaatgtaaattta
ggcggaggattaaaagcccgaggacatgtaggtggggcttccgccatataccaattagct
gaggctcacatgcaattaattggttcgtttaaaggcaaaaaggctagtgttgataattat
atagtaatttcctcagatgatttaggtatggtgagttatggtattaatttatcgagg
>SSO0535 Acyl carrier protein synthase
atgctctctggtattcttggatggggtgcttatattccaagatatagaataaaagtagag
gatatagctaagatgtggggttatgatgaggcagttgtgaaaagcctcggactgaccgag
aagtctgttcctggtcacgatgaggattctacaactatagcttgggaatcatcgataaat
gcaattaagagagctcaagttgatacttctaagataaggctagtcctttttggttcagaa
tctaaagtttacgctgtaaaacccacttctaccattttaatagacgcactaggcattaac
aattattcagcaactgcggatatggaatttgcatgtagggctgcatcggtaggattaagg
ttagcatcaagtttcgttttacataataacgatagttacgcgttagtaataggtgcagat
actgcacaatctaatccgggggatgttttagaactaagttcggcagcggctggtgttgct
tttgttgttggcaaaactgatgagaaacactcggctgccgtgatagaatattcttcatct
tatacctctgatactccagacttttggcgaagggatggaactccttatccagtccatggt
gagggttttactggagaaccagcttatttccatcatataatttccgctgttaacgatcta
ctacagaatagtggtttaaagatttctgatttcgactattttgtatttcaccagcccaat
ggtaagttcccgatccaagttgctaaaaagctgggtgtcccattagagaaagttaaacaa
gggttagtttctccatatattggtaatccctataatgcttctgccctattaggtttagct
aaagttttggacattgcgaaacctggtgaaaggatcttggttgctccatttggtagtggt
gctggtagtgacgcttttagtattttagtttctgaaggcatattggcgaagcaaaaattg
gctaaaaccgtagaatattatataaataataaaaaactcgtatcttatgctgaatatgct
aaatatactaataagataaaggtgtatgag
>SSO0536 Conserved hypothetical protein
atgtcagaacgggaggtattacaaaaaattaattcccccgaaggcaaagaagataggata
atagggaaacatgtgttcggcaacctatatgatatcgatgcagaaaggcttaacgataag
gagtttctagagaagttagtgctagaggctgtagatatagctcacatgaagctagtggaa
attaaagcttggtcttttgggggtaaaaaaggtggagtttcggttatagcactagttgag
gaaagccatatagcacttcacacgtggaatgagtacaattatgctactcttgacgtttat
acttgtggtgaagatagtgatccacaatctgcttttgcccatattgtaaatgccctcaat
cccaaacgttaccaaatgttttatgccgataggagctcacaa
>SSO0537 Hypothetical protein
atggcaaaaagtattgggattggaagcattttaataataataagtataattataattggc
tcagtcgcaacaatattttatcttgaaaacgttgatgttaatatttcagtaaaccccata
tattggagaatatattcaaacaattacgaggtaattgcgttcgcaataacagctacaaat
aacgcaccgttaacccaaacgctcaacattacattattatcacgctatctcgttccagga
tcaaatggagtattaaaaataatagcaaactcaactacaataaccttaaaatcacactct
tcctcaactgcaattgtctatttgaccttttcttcctccactttatttccagagatagag
gagttcaaagtattagtgcatggactttacggctattcaaaacagttcggcgatgtgaac
acgatttatactacggggttaacgagaaacatagcattattgatgggaattaaccaaaac
cagttacccacttttagcttagtaggaagcttcactccatctgccaatttcaactacagc
tatagtatagtatattaccaatacaattacacttcaaatacctcgttcctatttacaaaa
ttcacaatatcaccacttgccaatcaatatcttcagccaggaaaatacaacgtaacactt
agttacttagatcacgctaactcattcttaattaacattccaagaaataccccagtatat
ttctacttattcgtaccaatggcaaatttcaatatgacagtaattttacaaggtcaagga
gtaaagtatcaaggttatttcacagtaagtattatatca
>SSO0538 Hypothetical protein
atggaagaaaagagattatccttttttaaatggctcggtctagcattactatttatagtt
ttacctagtgcagtggctgtggttctatcgttttctgttccttactatatactacatgat
atgacactggccaatgctcttagtactattatttttatattaggatttggggtttcggct
atttactttaacaggtacttagaaagtcgtggtcttattaccccctttatgaagagggta
tccattaccatcttaccggatagcggacaacctattgacgagaaatatattaagagtttt
gaggctagacttaagtttgctaaaggtgaagagtatattaagctgttagccatgcttggc
atgatgtatttgcagaatgctgtagcttatgacaacaaggatttttatttgagggctaag
gagtacttgtcaagggctgaggaggctatgcaagaaaagagtgtgagctttgagactaaa
gcactcgttgataacttaaggagtaaaattgagacttacaagtaccgtttcggagaaaga
>SSO0539 Hypothetical protein
atgcctcagagtttaaagcctaagagtattaaattgttgcattatgaagagaagaaagat
gataagcgaatttttagacaaggagtgacattaatagagtatgaaggacaaccgtcaaag
ataattcaatggagtcagttaatagagggcgatcctttcggtgaccacgagataacctat
aggataaactacgggtctgaaagcgaacttagaagttttaaagtgaagtatttaggaagg
gaaggggataagcatagggttttgattaaggaaggagtgtctggttgtggaaccaagact
aagaggatagagaataaggaagtactaatatcagacaaactataccaaccttaccctttg
caacaaaaaaatgaagaagggagagatccaaatccgatagaa
>SSO0540 Hypothetical protein
atgtctcgcgagatagaagtaccttttgtcaaggttaatgatacgtatttacctttactt
aaagtggaaatggagtgtccaaaactaggtagtgagtatttagtttacgcccttccagat
actggaagcaggttttctatcattagaaatgatacgttcttaaagtgttttgatgaatcc
tcgttaaaaaatcgtttagtcgataaagttataatttctaatctgctcactacaaaagaa
aggtataacataaaatttcatttcgtggaacttaatgagacattacagatacccgtgaca
tctttagacttcgtaaacttaggtgagggtatatatcccagcctaattttaggtagggaa
gatttcttctcaagaataatgatatgcttcgaaagaaacgttagactaattattaaggct
aacgatctt
>SSO0541 Transposase ISC1173
atgaacctcgtggccctcgcacaacttatactattcgtcctaagaaatttaaaccttaag
ccccgaaagcacaagccagaggaaatcgcattagccattgcagcttacgtgatgggagta
cagatcacgaagctcaatataccgccctccacgttgtattactacaccaggaagctcggg
gtaaagaggaggaaggacgtgagaccgagatgtccttcctgcaactcggatcgcgtgatc
aagaacggttcgtccagagggaagagcaagtacaagtgcaaggtctgcgggaggaccttt
tacggaactgcgagtcacaggatgagcagggagcagagggagaggatcttgagggagtac
accaacaggatgagcttgaggggaatatccaaggttgagggaaggccattgaccacggtc
tacagctcggtgaagagggcagccttgaaggcttacgttgacttgtcgatcttgcaagcc
caattgaaggccttcaggtcgaagttcgcggtcctagacgagagctggacttacgtccgc
gtgagacgcggtcccagacgacagaacctctggatctggaacgctttgatcgacggagtc
cccttctttgtcaccggtgacagggactacaacaccttccgtcttctttggctgtcactc
cccaagtgcgaggtccactacaccgacgactacccaatctatcaagtcttgtatcaccac
gttgtgggcaagaagtacacccacaccgtggagagctacaactcattctgtaggtctcac
ttagctcggctagctagggacacgaaggccgtaaacaggagcagggcgatgattgactac
agcctggccttgttgaacgtcatgtacccgcaagttttcacagacgagaaaactcccttg
aacttagcctatttgagcggagtacagtatattagagatcatctaata
>SSO0543 Hypothetical protein
ttgaatgtaatgaagaaatatgttttaacatataggtcaattatctcatttttcgtaggt
ttcatgagttttgcgttcatagctttaatgaaaatatcgggcttaagtggctttcaaata
ggattaatattaagtaccatatcaatatctcagtttattgcatatattattttgatagcc
ttctcgataaggagaaatatcttggtctcggcagcattagaacttcttataccaataatt
ttaattatccaaagaagtgcttttactttcaccctctctgcgatttttatgggtattgtc
aactctataaattcttcagttataataattcagaaagaatttacgagaaaggattattca
ataatgatgaccttaacttacgcccttagcttagcaggattaggaatattttacttaagt
aaaataataggaataaataccacccttcttttattatttattcccttattgtctctaaac
ttaatattaacattaatgcttagatatgaagagaagaaagagagcttgtcggaactctac
tcttggttaaagaacgttggaaagtcagttttagtctttggcttctttgcgagtttaaga
agggttctaattacaagttatatacccttaattctccttacattattttatacatatact
ccgcaagaaataagtttatacctcatgataattcaagttcctctaattattttcttttat
ctaggccataaaataagtgtgagaattttcataacgttgtctatagtagaattaattctt
ttcttatcgctttctatattttatcgggaatcaatattactattcttatccttgatactt
ttagctaacatgtcttcatccttaagggctccagttgttgaagagacagtaaataaattg
ttaaatttcagtacaaaaatttcttcattttaccacttgatggatacgatcttctcggcg
ttagcgtcaatcttgcttgcatttatggtaaaattggatttgttttatggaatttttgta
atagcagggttatcttcactcttgccgtctttatttgtatacaaggttatgctacagcaa
aggaaa
>SSO0544 Conserved hypothetical protein
atggttgaggaagccattattcaacttactggaggaatagattccacagtattagcgtat
tatcttaaaaaagataaatatgtgttgcatggaactttcatacattacggctatcctccc
cagataaaagaattagagttagttaaagaattgtctaaaaagctcgatatccctctaaag
attattgatttttcctcttatattaagtctttcgatctccctccaatagattctatacaa
tacataattaagtaccagttcgtggtagaaatcctagcatctttttcagcttatccgaat
ctaaataccatgtttgtgggctggcttaaggatgagtggaataatagaataagtcttttg
aaggatattgaatctcttatgggttttaaggttatagcaccttttcacacaatggtaaaa
agtgaagttattaaattgggtaatgaattaggtgtagattttacaaaaactcatagttgc
attgtatctggaaaaatgcactgcggcatatgtatggcgtgtagatctagaagaagagct
tttgaagaggtaaaagttaaagatcctacaatctactactataatttgcctcccgctgag
gtagataaattatcaagggaactgagcctggaggaattcgtagagagatttttcaaacca
ttcttacaatataccggagaatatcctaaagaatttgtggataatttagcacatatttta
agaaaatataacggt
>SSO0545 Hypothetical protein
atgaaatattctacacagataaaggtggaaattagttctaaagttgaatacataacaggg
aaaaacttaatacccaaaataaagtccattttttctaatattgagataaaaattgaaaat
agtgagttagaagataaacagttcaaagattttctaaaatcgtattataacttttatgat
agttccaagatagataccatttttattattgaagttaatttaatcgatgaaacttataga
ggacttggcattggttcatacgatacaaagactaatatctcgtctctctattttgagtgg
gaatcaacaactaaatatgaagtgcaagctgctagtggtggctccataatttgctgggat
tactctacttattcaaaagcgtatcatggtgctgttaacataagttctgtcgcgggaaca
ttagaaggttttccattagaagcaaatgttacatatttaaccctaaacgacgagggtgag
atagtattccaaggatatcagaaaggtatagttaagactattaacgggatacgagttggt
aaagttaaattagttgggcttattgatgaaaaattccggttgaatacttcgccgggttat
gcagtatatctgacacagaaaaatgacaatataatgtatggagtttataatcagatacaa
gtagaccccatgggtagaatgtattacgaaaccgccattagagaatataaaatatatagt
ggcagaaaattaccatttgatgaggttatgatatttaaatacaaagatgctaatttcaat
cagataaagagtaataaaagaatagattcaatgtcacatatagcatattatatgccggca
aaagacccttacgggaaa
>SSO0546 (pqqE-1) Coenzyme PQQ synthesis protein E
ttgataaatcgtaaacctttttttattgaattagaattaacttataaatgtagtcagcaa
tgcatttattgtcataatccacctaaagatctaaaattttatatagctgataaagttcca
aaacctagatctgtaatagaaatgaatgagctaaacttaagtgagtggatatcagtaatt
aatcaaattaaaaggttagatgaaaaatacgagggaatcatggatgttgtgataactgga
ggagaaccgttgttaagaagcgatttagaggaaatcttgtcatatgttacaagacaaaaa
ctaaggcacatgttattaagtagcggagaacctatttccgatgatagaattacaaaattg
ctagaaagtggtctagaaaagattagaattaaccttacttcacataaatacgtctttaat
atacaatccccaataatgcatatcaagaacgaagtagctaagaagattaatatcgcaaag
aaatttaaagattttggagtaaaggaagttggaggcaatatagtcttgactagttattat
ttggacttcttagaagaaattgcggaacttgcatataaatcaaacttagattggattgaa
attcatagtgttataaaggtaggtcatggttatataaaccaaaagttcatagtaccagat
cctaacgatgaaagaacaattcaagaaaaattaaagagactcatagaaatttatggggag
aattttatacaaaattatgtggatactgacattttatattctaggataccaatccctaca
aattggggggaagtaggtttagttatagctccgaacggtgacatttatcctagttccgag
gcgacatctatcccattatcaaagctaggtaatataaaaaacgactcattagttgaaatt
tggtttaacaatctcttgcttaataaaataagaagtctatctttccttagagagccttgt
aagagttgtgaagttaagaagctttgtagaggtggttttaggtttaatgcatatataact
aagaatgacctatttgctccagacccttcatgtcaaatagttaaagattatattggaaaa
agt
>SSO0548 Multidrug resistance related protein
atgggtctgaagcaaacactaaaagagatctattacattgtagcagataagagactgctc
tatttttcattatctttggggatttctacctttgcttactcactgttgacatactatttt
cctataattatgactaacctcgacattactaccttcacaattggtataatttacagtata
atcagtttcctttacgtagtttttaatattccattaggtgctatagttgataaaataggt
agtaagaatgcagtcactctatcagcactaatggcagtacctttgttcctcttgatggga
acgcttaatcccttactttttataatttctcttgtaatttttgaatctgtgataagaata
gttaattccttaggagcgcatagatttatgctaaattatacgaatgcagggaaggccttt
ggggttttctccctcataaccagcatcttagcagctatagggattatgttagggggctac
ttgttacaacactcggtctctacgctacttttcacaataatagcggttcttttcggaatc
agcggtattataaggtttcttgaattaccgaaagacgagaacaaggttgaagtgaaaaga
tctctaagattaggctttaaataccttaaagaagacaagaaattgttactctatttgtta
gtttcaattctttcttccggtttaagcctagagacatattacgtaacaatctatttcgta
aaagacttactactacccttaacatttgtaggtgtgttatattcatcatacgcattaata
atggctttcttaccgttactgttctcggttattttaagtaaacgtagtaattttaagaac
ttatcaatcttaatcttctccaactccgtcatatttttcctagttccactctttactaat
gtttatattttattcttattattttacgcttggacggtaattgtagctatggaaagtata
gtggattataatgtcgcacagagcgttactaagcctgaaatccgggggactcaagttgca
ctaattagtacttttgtgagaatattttcagtattttataatgcaatcgtaggtttgctg
ttccaaataacgccgttatactcattttatttcaccggtttcctagggatattagcaata
tttactataaaatttgcagagtttatcggagttttaaaa
>SSO0549 Transposase ISC1439
atgcaaaccatgatattacccaaaacggagctgaagtccctcgctataactttagcaaca
aacaatattaacgttatctctcaagatctagacccggaaatagtgaaagcagcaccatcc
ttgctaaccggaaacagaggaaaatactacttgaaggtagtaagacgaggcgagaaagta
attagtaaaggtcagagaaccttcaagttctacccaatctacagagaagtaaagggagag
atcaacgtagtcgctgtagatgagaccggattaaccgtgggagaaaaggaacaagaaaaa
gcagagggctttctactctacaactggaagagaaaaggagtaaagatgagatccttggac
ctcgtatatcccttaaggttacccctcctagtggaggtagcagatttgagaagcgacagt
ccatcacagttcctactcaggagcgtgagggaagtaagccaatacatggaaatagattac
gttgtagctgacgccggattcttgaacctaggggtcatcaaggaaatgcccgtgaagacc
attgtgagaggaaagtcgaacttgaagggattcaaggaactatctaacgttccattagtt
gagaagagatacgaggttaaggacagggtttacgttgcgtatagggtcttgaaatttgaa
gggctttattattacgatgtggtttacgttaaggggaagccgaggcacttcatgttcgta
acgaacttcgagggagatccctatgaactggctgaactctataggttgaggtggcaagtt
gaggagggttttaaggttaggaaggcaaggataaggtatgttaggaagttgagtaataag
atcttcttgttcctctattacacggttctggattctgcgtggaatctagtgaatcatctt
ctctttaacttcaagtccacgtgtaagaaggttttgtccttcgattcattcgtcaagctt
ctc
>SSO0550 Conserved hypothetical protein
atgcggatgagtttacgtattgccatattattatttttattatttttagcatttagccta
ggctttgtaattcagtacttcttgcaagtttttgggataactaaccagtctactatcaac
tctgtgattttctatcttaggatagctctatacgtatttattggcttatggatagtatct
tcaatatcagaggccataagggtctattctcaaaggagacttggtataagggctaatgta
attgcaaatagcgtaaggtactttgggtatgtaattgtttttctattagtgctgttaccc
ttaggagttggctcttctacgcttattgcaggaagcacttttgcaggcttaattataggt
cttgctttacaaccggtcctaagtaacttctttgccggtctactgataatgctcactgga
tatatagtagttggggacaaaataagggttctttccacacaagtaccattcttccctgcg
caatttccagcatataaatatttttcaacggactttatagaacaaggatataaaggtaca
gtagtggaaatagatttgttttattctagagttcttctagagaatttaagggaattaaga
gtgccaaatattgtattgctgaactcagcagttttggactatacttcaaagtactctgag
gaacatgtgatcaatgtgagagtggagtttccattagcttttatagacatcaacaagtta
gaagatatagtcaaagaggaattaaaagactttaatgtagtagaaggaccttatataaat
gaacaaagcgataaagaccacgtaatagtattggctagattaaaagttggtgttagtgaa
gattggaggaaaataaagtctaatgcactaaaaaggttattaagactaagacaagagctt
atagataagaagagccaagattcgcaacaaacaaagatctca
>SSO0551 Conserved hypothetical protein
atgaagcccaaacccctaaaatgtataacgtctcaccattatataataaaattttatgat
aaaagcaacttacgaacctcgttatatttattaatattcaaggaacataaagattataga
gagcaaatgaaggtatatattatagactaccataaggatgatccaaagagatgtactggg
aagaagttagtcaaactaaaaattgcagaatttactagagtaggtaaaggtgtagttctt
gaccctttcgctcaaataactctgtcaaacaaggataaagatattgtgaggagaattggc
ataactatagttgatacttcatggaataatacgtcccaaagcgagtttaaaaatataaga
ggggaacatagaagaattccaatcttatttgccgggaacccaatacattacggtatagcc
tataaactgtcttctattgaggcgttaatagctacgttgtacattgttgatgaggtggaa
gaggctataaagctttccaacgtagttaagtggggacatacattcatagaactgaataag
gagcttctggaagcttataaaaacaaaaccgaggaagatataaagaaaatcgagcgagaa
attattgagaaaatacttgaaaaa
>SSO0552 (dpo1) DNA polymerase I (DNA polymerase B1) (EC: 2.7.7.7)
atgactaagcaacttaccttatttgatattccttcatctaaacccgctaagagtgaacaa
aatactcaacaatcgcaacagagtgctcccgttgaggaaaaaaaggtagttaggagggaa
tggcttgaagaggctcaggaaaataagatatacttcctattgcaagtagattatgatggt
aagaaaggtaaggctgtatgtaagctattcgataaagaaactcaaaagatctatgcccta
tatgataatactggacataagccctactttctagtagatcttgaacctgataaagtaggt
aaaatacctaagattgttagagatccatcttttgatcacatagagactgtgagtaagata
gacccgtatacttggaataaattcaaattaactaaaatcgttgttagagatcccctagca
gtgagaagattaaggaatgatgttccaaaagcgtatgaggctcacataaaatattttaac
aactacatgtatgacataggtctaatccccggtatgccttatgttgttaagaatgggaag
ttagaaagtgtctatttgtctttggacgagaaagatgttgaggagattaagaaagccttc
gctgattcagatgaaatgactagacaaatggcagtcgattggcttcccatatttgaaact
gaaatacctaaaataaaaagggttgcgatagatattgaggtatatacaccagttaagggt
agaatcccagactctcagaaggctgagtttccaattataagtatagcattagcggggagt
gatggattaaagaaggttcttgtattaaataggaatgatgtcaatgaagggagtgtaaaa
cttgatggaatatcggttgagagatttaatacagagtacgaactgttagggagatttttt
gatatactgttagaatatccgatagttcttacattcaatggagacgattttgatttacct
tacatttactttagggcgttaaagttaggttattttccagaggaaattcccatagatgta
gctggtaaggatgaagccaagtatctagctggtcttcatatagacttgtacaaattcttc
tttaataaggcagtgaggaattatgcatttgagggaaagtataatgaatacaatttagat
gcagttgcaaaggccttattagggacatcaaaagttaaggtagatacgctaatatctttc
ttagatgtagaaaaattaatagaatataactttagggatgccgaaatcacacttcagctt
actacatttaataacgacctaactatgaagttaattgtattgttttctagaatttctaga
ctaggaattgaggaattaactcggacagaaatatctacttgggtaaagaatttatattat
tgggaacatagaaaaagaaattggttaattcctcttaaggaagaaatcttagcgaaatcc
tctaatataagaacttctgctctaataaagggaaaaggatataaaggcgcagtagttata
gacccacctgctggaatattctttaacataactgttttagattttgcatcactatatcct
tcaataattagaacgtggaatcttagttacgagactgtagacattcaacaatgtaagaag
ccctatgaagtaaaggatgagacaggggaggtgctacatatagtttgcatggataggcca
ggtataacagcagtaataactgggttactaagagacttcagagtaaagatatacaaaaag
aaagcgaagaaccctaataatagtgaggaacaaaaactactctatgacgtagtacagaga
gcaatgaaagtattcataaatgctacttacggtgtatttggagctgaaacatttccgtta
tatgcgccagctgtagcggagagtgttactgcactggggagatacgttattaccagtacc
gtaaagaaagctagggaagaaggtttaactgtattatacggtgatactgattctttattc
ctccttaatcctcccaagaatagtttagaaaatattataaaatgggttaaaactactttc
aatttagatttggaagttgataaaacctacaagtttgtggctttttctggattgaagaag
aattactttggagtataccaagacgggaaggttgatataaaggggatgttagtgaagaag
agaaacacgccggaatttgtaaagaaggtatttaacgaggtaaaggagctaatgatctcc
ataaactcgccaaacgatgtgaaggagattaaaagaaaaattgtagacgtagttaaagga
tcatatgaaaaactaaaaaacaaaggatacaatctggacgaattagcgtttaaagtaatg
ctatcgaagcctttagatgcgtacaaaaagaacactccccaacacgtaaaggcagctcta
caacttagaccatttggagttaacgtattaccacgagatataatatactatgttaaggtt
agatctaaagatggagtgaaaccagtacaactagctaaagttactgaaatagacgcagag
aaatatttagaagcgttaagaagtacgtttgagcaaatcttaagggcattcggagtctct
tgggatgagatagcagccacaatgtcgatagattcgttcttttcatacccaagtaaagga
aatagt
>SSO0553 Conserved hypothetical protein
atgaaaattttgatagtaaaaagtgagaatggaaaggtgacatcggagaaggtagctgaa
ggcgaaattagcaaagtgctaagagatgttgcaaaagaagcgttagaggaatggaatgaa
ttagcttcagattttataattatgcgcgataaccaagaagtgagattgcctcttccgcta
aaaccagaggtttacgaagcaataaagacttttcttattggtaaggataagaaagaggct
atagctaaaatccctgtatatataataagctatgagaatgaatggaaagaaagtgacttt
caagataagaagatttatgttgtttcattttatatcaatgatgaaataaagaaagatgtg
ttaaatgacgcggctcaaatgactagcgaacagaaacaagaagaattaaaggaagaatta
gaggaagaggaggaagaa
>SSO0554 Ribosomal protein L11 methyltransferase, putative (EC: 2.1.1.-)
ttgagttacgtaccacatgttccttatgtaccaacaccagaaaaagttgtaagaagaatg
ttagaaatagctaaagcctctcaagatgatatagtgtatgacttaggatgtggagatgga
aggataataataactgcagtgaaggattttaacgtaaagaaggccataggtgtagagatc
aatgatgaaagaataagagaagcattagctaatatcgagaaaaatggggtaacgggaaga
gcttcaatagtaaaaggtaatttctttgaggttgatatttccgaggctactgtagttacg
atgttccttttaacaaatgttaatgagatgttaaaaccaaaacttgaaaaggaacttaaa
cctggaacgagagtggtttcccacgaatttgaaataaggggttggaatccaaaggaagta
gtaaaggttgaggacggaaatatgaatcatacagtatatctctacgtaattggtgaacat
aaa
>SSO0555 Conserved hypothetical protein
atgacagctaaaaaattgattctggtaacctcggagtcacatcccttacacaaagtattt
atggaaactttagaggagctttcaaaggaactaaatctagaaaaggaagtcaaaatagag
gattacgcatttctagctgactacggtgaaaaggatgagtttgatatgccatttcttcct
cagttattagcccaaacagatgatgggaaaataattcctgtattaactaagatgccattc
gacgctagcctaaagccagataagaaagctggaaaagaagaggctattaaaaaaattaaa
aacctagga
>SSO0556 (pgsA) CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, putataive
gtggtttccatgttaactagaataagaaggcaaatcaaaagagtaatagaaccactagca
aaaacattagcccagcttaaagtaagtgcaaattttattactatgctaggattaattttc
gcaatcgtatattactttgaaatcatgagatcaaataccactctaggaataatttttttg
gtattttcagcattaatggatgcaatagatggagaagtagcaagagtatcgaaaacagta
tctcccttaggaagtttcttagattccacattagacaggatagaagatattctctacatt
tcagccttcatattcttgggattctcctcgtatctcgtggcgatagccgtgggattatca
ctgacaatttcatatattagagccaaggctgaatccctcggactcaagatggaaggtagg
ggaataatagaaagaggagaaagaataatatttgtatttgtaattttattactttatata
atagttagcaaacaagtttccttgtatctattttacctatttatgttactcacagcgatc
acggtaatccagaggttttacgctgtctattcgttacttaggaag
>SSO0557 Conserved hypothetical protein
atggcattagacgttaaaaagtatccttttataaagagtcttgatgatgaactaaagaaa
tatggaggaggaattacattaacagatttactattaaatagcactaccctcattgatcaa
gctaaagataggatacaaaagactaaatctggtgacgaacttccacattacgtctcttat
aatgaacccgtactcgtgttttacactacgctactttctctagccatattaaatgatgtg
aagcttattagaagatacgcatatgcagaggctaaacaattcagatccctacttcacacc
gagaatgaggagaatttacttgaaatctctaagttattagatctgaagataaatagatgt
gatcctataaaattctatttagagaaaaagagaaggataatacaaaaagaattttgtgtt
cattttatcgattatctcaaatatacaaaagaccttaaggaagattggaaactaagtggg
cagatcttacataagggatacgtatatctggacaagaatcaactaattggcctaatagct
gaaagtattaagagtaagatagtcgaaatgataagaccactgaatcttaaagaaatacca
gaaaaattgaagagcttgatagaaaggagaggaataattcctccatgcatagaaaatatt
ttagctaaggaaaaattaaacgaagaagaaataaggactttaattacgttttacattgac
ataggtaagggactaagtggtatagtatctattatgaaaaaatataacgtttcaaacgtc
gaggacttatataggaaatataggggagataaggggacgaggtatatcgtttattcttgt
gctaagatgaagcaactaggtttatgtgtgagcagttgcaacgttaaaaatcccttacag
ctctacttcctaagtaacgaa
>SSO0558 (metS) Methionyl-tRNA synthetase (EC: 6.1.1.10)
atgaaagtgctagttacagccgcctggccatatgtaaattcggtaccacatttaggaaac
ttaataggttcaatattatcagcagatgtcttcgctagatatgcaaggctaagatatggt
aaagaaaacgtattatttgtaagtggaagtgacgagcacggaactccaatagagatagag
gctataaagagaaaggtgaatcccaaggagcttactgatcaagctcatgaatacgatagg
cacctcttcctcaatgtttggaaaataagttttgataactacactagaactgaaagtgag
atacataagaagttcgtaagagaatttttactgaaacttactaaatatattaaagtgtct
gaagacgagataccatattgtgagaatgataaactatatctaccagacaggtttgttaaa
gggacatgcccatattgtggctttgaagacgctagaggtgatcaatgtgacaattgtggg
aaattactaaccccaagtttacttgtaaatccgaaatgtagtatctgcggaaagacacct
gtatttaagaaaaccaaacactggttttttgatttatcagagtttaatgataagataaga
ggttggattagcagctctaatgaaatgccagataatgttaagtctgtcgcattgagctgg
gttggggaggggctgaaacctagaagtatcacaagggataataaatggggtatcccagca
ccatttgaaggagctcaagataaatcaatatatgtgtggtttgaggctcttttaggttat
atatcagctgtaattgaatattttgaaaggaaaggtgaccaagagaagtggaaagaatat
tggtttggtcctaacataaaaagctattatttcataggaaaagataacatcccatttcat
gcagtaattcttccagctatgctcatggcttcagaagaggaatatcacttgccagatgta
atagcggctacggaatatttactatatgaaggacaaaagttcagcaaaagtagaaagata
ggagtatggattgatgaagcaccagagctaatggatgtagaatactggagatttgtgcta
attagattaagaccagaagagaaagatactaactttacttggagggaaactgtcagaata
gtgaatactgaacttaatgacgatattggtaattatgtaaatagggtacttagtatggtg
aataggtactatagcgggattgtaccagagtttaagattgatattctcgatgataacgat
aggaaaattatcagtctaataaatgagacgccgaaagttgttggagatctattcgagaaa
ggtaaattaaaggccggaacggaggaaatgctgaaattcgttagggaatgtaacgcatat
ttaaatatgaaggctccttgggacctatacaagagtggaaaagagattgaattaaagaat
acactttacattggaaccaattcggtaaaaacgatagcgattttattatatccgctaatg
ccctcacatgctcagaaaatatatgaaatgttgaatatggggaatatagaaaatgagaaa
tgggatgttgcctcaacgctatcagttaaccctggtcataagatagggaaagttaatgta
cttttcaagaaacttgaaccagaatttgagtctaagataaaggataaactggaaaaaata
aggaaagatatagaaaaaataagacctaccttactcaag
>SSO0559 (atpI) ATP synthase subunit 1 (EC: 3.6.1.34)
gtgctattgccagagaatatggtcagattacagataatttctgataaatcagcgatagac
cctattataactaaactcctcaagctcggcatgtttcaaccagaagaccccctttaccca
ttaggcaatgaaagaatagaagatgctagaagacttatcacggcagtacaagatcacgta
agtaaattaaaaataatcatggaattaggaggattagtaatagaaccattggggagcatc
aaagtaagtagttggatcaaggctgcacaagatgtcagtgaagaggcgtcgaaattagaa
gaaaggtacaaggaactattagaggaaataggcagactgagatcagagaaagatctttat
cagcaacagttaaaagagctagaaccgattaagtcaataactgtagaattatccaaacta
tattctttggaactatttgacgtaatattagctcaagttgatgaggacaagttaaggctt
atcaaccaaattataggtgattccaacttcgtgtattatacgaggtttggagaggaaagg
tatattgttctaatcatcgccgagaagaatattaatgtagataagaaattgagagaagct
ggggttaggagatatgagctacaagaaggaaaatccccttttcagctctataacgaaatt
ttagaaagaataaatcaaataaacattattttagaaagaactagagaagaattagcaaag
aaagtgaagactgaggagaactatattaaaaatgtatacggtaaattactgactgttcgt
gatgcgctaaatatcatgaataaagctagagtctctgaatactatttgcaaatagaaggt
tattttcctgaaaaacatgttaaaaaagtacagaatgagattaataatttagcatttatg
gattatataaggcctaggagatatggtgaaaaagaggaaccaccgacattagttgaatta
ccaaagtccataaaggttttagaatccttagtcgaaatatatggctcaccatcctattgg
gaaatatcacctatagtcttccttgtttttactttcccaatactatttggtttaatgttc
cccgattttgggaacgccttagttttattgctattctcaatatggttttacagatatggg
aagaagagaggaagtgaaaatattcctaaattatccataattctaatatactcaagtata
gttgcaatcataacgggtttactagctagagatttctttggtccattaccagtaggtgga
ttaagggagatattaaataatgggaactatagcgcagggcctctttacaacttatggcca
atcccagcaagtgtatccgaggcaataaagtttctcttaccattcggagagtacagtact
agtgttagtatagaaaatactatgatattttcagtattactgggagccctagcgctattt
gtgagctccttattaggtgttatagatgcaattagaaagaaggatccagaattcttgttc
ttggagaaactcccactattcttactgtacgtagttccaatatttatcttcatgtatggt
ataaccgatccagccaatttctttaccgtagatcaacagatattaggccaaatacttaac
gccgttcttatgaaatcctttagtgaaaatattgtaggttacggaatagtttggtggact
tcgtttgcactattatataattgggctgctcacgcaattttagttaaaaggcatgataat
gctacgtggggttctgcgattgctatggggttcatagaaggtggatttgagggagcccta
ctattattgtctaatactatttcatttataagagtcttagtattcgctttatcacactat
tatatactatatgcattctcttatatggcctacttagttgcaccatccacaactactata
ggagtcctaataaaccccatagcaattatcatattgattatagggaacttgttagctata
ggcttagaagggttagtagtatttatacaagatttaaggcttcatttctacgagatgttc
agtaagttctatgaaggaagaggaagaaaattcgagccggttatggcttacgtctcactt
gag
>SSO0560 (atpF) ATP synthase subunit F (EC: 3.6.1.34)
atgggtaaagtgtttgtagttggagacaagtatacagtttccttgtttagaatggttgga
acggaaggggatttcatagatgatccttacaatctgcctgatattatttctaaattaaag
aaaagagaagatatagatttaatattaataacgaaagacatgtatgaacctataagggga
aaaattgatccacttattgcagatcaaagaaaacctttaataacaattattccttctcca
tttagtgaatccaagccattagacgtaagaaagatgataatgaaagcgttaggttttggg
>SSO0561 (atpE) ATP synthase subunit E (EC: 3.6.1.34)
atggatttcgaacagttgttggataaatccttaaacaaagttagggaagaaataaaaacg
gagttgagtaaaagcttagatgaggctataaagctactcaatgaaggtcataataagata
gtacaagaatattcacagaggataaatgaattaatagttaaaactaaggaagaaattgaa
ggagaaaaagctagactagaggtggaaaataagcgaacattattagttgagaaagagtac
tggataaataaagtttatgaaagagttttgggaaagattggagaagtagttaagaccaag
gagtacaaggacgcaatagagaacataataagtaaagaaattaaagagattagagaagag
aaagttaccatatattgttccccaaatgataaactaatgatagagaaaattgtaggcaat
aataaaaacgtaactgtaaagactgatgagaaaatgcttggtggaataaaaatatatttt
gaaaggagtggattaacaagagatttttcattaaagcttatcttagaccaagtttttgat
agtatgaggggaaagatttcagacatgttgtttggaggtaag
>SSO0563 (atpA) ATP synthase subunit A (EC: 3.6.1.34)
atggataatggaaggattgtcaggataaatggtccattagtcgtagcagataacatgaga
aatgcacagatgtatgaagtagtagaagttggagagcctagattaatcggagagattact
agaatagaaggagatagagcattcattcaagtttatgaagacactagtggaataaaacca
aatgagccagtgtacagaacgggtgctcctctgtcaatagagctgggtccaggcttaata
ggaaaaatatttgatggattacaaaggccactagactcaatcaaagagctcacaaaatct
ccttttatagcaagaggtataaaggttccatccatcgatagaaaaaccaaatggcacttt
gtgcctaaagttaagaaaggagataaggtcgaaggtggaagcatcataggaatagtaaac
gaaactccattagtagagcatagaattctagttcctccctatgttcacggcaccttaaag
gaagtcgttgcagagggagattatacagttgaagatccgatagcgattgttgatatgaat
ggcgatgaggtaccagtgaagttaatgcaaaagtggccagttagaattcctagaccgttt
aaagagaagctagagccaactgaaccattattaactggaaccagagtactggatacgata
ttcccaatagctaaaggaggaacagcagcaataccagggccctttggaagtggaaaaaca
gtcacattgcagagtttagctaagtggagtgccgcaaaaatagtaatttatgtgggatgt
ggtgagagaggaaacgagatgacagatgagttaagacaattcccaagtcttaaagatcct
tggactggtagacccttgttagaaaggacaatactagttgctaatacaagcaatatgcca
gtagcagctagggaagcaagtatatatgttggtataactatggcagagtatttcagagat
caaggatatgatacattactagttgcagattcaacttcgagatgggctgaagctctaaga
gatttaggaggaagaatggaggaaatgccagcggaagagggattcccaagctatttacca
tctagacttgcagaatattatgagagagctggaagagttaaaacaataggaaatccagaa
agatttggttcagttaccgttgcttctgcagtatctccacctggtggagatttcacagaa
ccagtaacaagccaaacgttaagattcgttaaagttttctggcctttagatgtatcatta
gcacaagccagacactatccagctattaattggcttcaaggattctcagcatatgtagac
ttggtagcaaattggtggaacacgaatgtagatccaaagtggagggaaatgagagatatg
atggtaaggacactgattagagaggacgagttaagacaaatagttagattagtaggacca
gaatctctagcagaaaaggataaattaatactcgaaacagcaaggttaattaaagaggca
ttcttaaagcaaaacgcctatgacgatatagatgccttctcttctccacagaagcaagct
agaataatgagattaatttacctatttaacacatatgcttctaaattagttgaaagggga
attcctacgaagaaaatagtagatagtatgggacagctcttaccagagattattagatcg
aaagccgcaatcaagaacgatgagttaaataggtatgatgagttagagagaaaattaatt
actgtctttgagaatttggaaaaggaggctggtact
>SSO0564 (atpB) ATP synthase subunit B (EC: 3.6.1.34)
atgttaagcgtaagggaattttcaaacatatctatgattaaaggcccactagtttatgtt
caaggagtaacggatgcatcatataacgagctagtagaaattgagatgccgaatggtgaa
agaagaagaggtctagttatagattctcaaatgggaatagcaattgtgcaagtttttgaa
ggaactactggcgtttcacctacagggactaagataagaatgttaggaagaggcttggag
gtaaagatctcagaggaaatgttagggcgtatatttaatccactaggtgattcattagac
aacggaccaccagtgattaaaggcgaaaaaagagatataaatggatccccattaaaccca
gctgcaagagagtatcctgaggagtttatacagaccgggatatctgcaatagatggatta
aacgcgttattgagaggacaaaagttgcctatatttagtggtagtggattgccagctaat
atgttggctgcacaaatagctaaacaagcaactgtaaggggagaggaaagtaacttcgca
gtagtctttgccgcgattggtgctagatacgatgatgctctatttttccgtaagttcttc
gaagagactggtgctattaatagggttgcaatgatagttagtttagcaaacgaaccaccg
gtgatgaagacattaacaccaaagactgcattaacgttagcggaatatttagcctttgaa
caagatatgcacgtactagcaatattaattgatatgaccaactattgtgaggctctaagg
gaaattagtgctgctagagaagaagtacctggcagaggtggatatcctggttatatgtac
actgatttagcaacgatttatgaaagagcaggaaaagttatagggaagaagggctcaatc
acgcagatgccaatattgacaatgccaaatgacgatataacccatccaattccagactta
acgggttatataactgaagggcaaatagtccttgatagggctttatataataagggtatt
tatccacctatcaacgttttgatgagtctatcgagattagcgaaagatggtattggagaa
ggaaaaactagggatgatcacaaggatgtctcaaatcagttatttgcctcatatgctagg
gcagtagacactagaggactagctgcaataataggcgaggattcattgtcagaagttgat
agaaagtatttactatttggtgagctttttgagaggaagtttgttagtcaaggatttaat
gaaaataggagtatagagaccacattggatattggctgggaaattttatcagtcttgcct
gaatcagagctaacgaacataaagacgcaatatatacagaaatatcatccgaattatagg
ggtaagaaa
>SSO0566 (atpD) ATP synthase subunit D (EC: 3.6.1.34)
atgagccaaaaagttttgccaacaaaaataaatttgatacagtttagaaggcaattgaga
ttaattacagttataaagagattattggaaaataagagggaggtcttgcttctctacttg
aggacttatgcttcacaatatgaaaaaatttacaatgaagtaaatgaagagatgaagaaa
gtttatgagagttatttacaagcagtagcatcagagggaatatctaatatagaggaaatg
gctctttcacaaaaacctagcctagaggttaatagcgcaataaaagtaatttttggagtt
aaggttcctacaataagattagacaaatctactattcccgcaaagcctttcagtgatgtt
gaaacatccccttacttgtcagaatcctatgaggagatgactgaagctttaaacaagatt
attgaattagttgagttagagtcaacgataagatcgttagtatcagagttaagaaaaact
cagaggcttatcaactcaatagacaattacatattaccattttataggggatctataaag
ttcattaagcagattttagaagataggcaaagggaggaattctcaagacttaaaattata
agaagaatattacagaggaggagggaaagtggatcaaga
>SSO0567 (atpK) ATP synthase subunit K (EC: 3.6.1.34)
atgaagagagctagtttgatcctagccttcctaataccagtattagtaagtagtgtaata
gcagcagcacaagcaccatcagatactgcacaaggttttgccggtattaacataggtgca
ggactagcagttggtttagctgcgataggagccggaatagcagttggtatggcagcagca
gctggagtgggtgtactaacggaaagaagagatatgttcggtacagttctaattttcgta
gctattggtgaaggaatagcagtatacggaatcttgttcgctgtactaatgttgttcggt
aagttc
>SSO0569 (proS) Prolyl -tRNA synthetase (EC: 6.1.1.15)
gtgcagataactagagagaagtggtcaaaaaactttagtgaatggtttgattgggtatta
agagaaggagaattttacgattatgggagatatccaataaaaggtatgggagtatggatg
ccatatggatttaagctaagacaaaatataataggaataattagaaattttctagactct
actggacatgaggaagtattgtttccacttctaatcccagaagatttgctaaggagagaa
agcacgcatattaaaggatttgaagaggaggtattctgggtaactaagggaggaagcacg
gacttagacgttaaacttgcgctaagaccaactagtgaagtcgcaataaccacaatggaa
aacttatggttgaaaagctacaagcaattacctaaaaagtactatcaaattgtaagcgtc
tttagatatgaaactaaggctactaggccaatgataagattaagagaaattacaactttt
aaagaagcccatacggttcatgaaacttacgatgatgcacagaaacaagtagaagaggca
atagaaatttataagaagatttttgacactctcacaatcccatacgtcctttctgaaaga
ccagagtgggatagatttgccggagctttgcacacttatgctttcgatactattatgccg
gatggtagagcaatgcaaataggtacagtgcatcacttaggtcaaaactttagtaaggca
ttagattttaagatacagaaaaaagatggtagtttagactatccacaccaaacaagttat
ggtatttcagacagagcagtagcttcagtaattgcaatacatggagatgatcacggaccg
gttttacctccttctgtagctcccattaaagtagtagtaatacccattcctgcaaaaaat
gaagaggaaactcaacaagtaatgaaatactcaattgagatctgtgagatgtttaacaag
aacaatataacttgtttgactgatcaagatactgagaaaacacctggggagaagttctat
atttgggaaattaagggagttccaattagactagaaatcggcccaagggagcttatttct
ggcacagtatttataaagagaagagacaattttaagtcttatactgtaaggaaagaagaa
gccatcaataagattaaagaacttctaaatgaaatccaggaagacttaagaagaaaggct
tgggaggatcttaaatctagaatagagtattcgaatgatattgaaaaagctaagaagata
ttagggaataactcaggtattgtagaagtcccttggtgtggaagtaacgagtgtggctta
aaaattgaggaacttaccaatgcgagagtactaggttatccaatagagaagagagaagtt
aatgataagtgcgtaatttgtaaaatgaacgcaaaaacagttctaaggattgcaaaaact
tat
>SSO0570 Ethylene-inducible protein
atgagactttatgaattatcttttgcacaaattgaagattttttctataaactagcagaa
gttaaagatattataaaagatcatggtctattagaatttctaccagaatttaaaaaattg
gattcaactgtccatacgggaactactagagtgaagcatgcatttccaatctttcaaaag
ggaggagtcgtcatggatattacaaacgttcagcaggctcaaatagcggaggaagctggg
gctgtagctgtaatggttctagacaagctaccttatgatgttagaaagtctggtggtgtg
gctagaatggcggatcctaagataattgaggaggtaatgagttcaataacaataccagta
atggcgaaagtgagaattggtcactattacgaggctaaactactagaagcattaggtgtt
gacatgatagatgaaagtgaagtcctaacaccagctgacgaggaacatcacataaacaag
tgggaatttagtgtaccgttcgtcaatggagctagaaatctgggagaagcactaagaaga
acatcagaaggagcatcaatgataagaactaaaggtgaagcaggaactggaaatgtaagt
gaggcagtaaagcacatgaagataataaatagtgagataagaagcttgataagtatgtcg
gaggaagatagggtcaaaaaagcaagagaatatcaagttccttaccagatagttgagctc
actgcgaaaatcaagagattaccaatagtcaacttcgctgctggaggtatagcgacaccg
gctgatgctgctcttatgatgtggttaggtgctgatgggttgtttgttggttctggtata
tttaagagccaagatccggacgaaagagctaaagcagtagtcctagcggcagcttgctgg
gaatacccagaaatcgtattggaagctcagaaaatgataagcgaacagaaaagtatgatg
ggaattgatataaaatctctaaaaccggaagaattactacaagtgagagggcta
>SSO0571 Glutamine amidotransferase, putative
atgaaaataggtataatagcttatcaagggagtttcgaagaacattttcttcagttaaag
agggcttttgataaactatcattaaatggcgagattatttcaataaagattcctaaagat
ctaaagggtgtggacggagtaataataccgggaggggaaagcactacaataggattagta
gctaaaaggctagggctattagatgaactgaaagagaaaattacatctggtttaccagtc
ttaggaacgtgtgctggtgctataatgttagcaaaggaagtaagtgatgccaaagtaggt
aaaacctcacaaccattaataggaacaatgaatattagtgtgattagaaattattatgga
agacaaaaggaaagttttgaagctatagttgatctatctaaaataggtaaggataaagct
catgtggtattcattagagctccagcaatagcgaaagtatggggaaaggctcaaagctta
gctgagttaaatggtgtaacagttttcgctgaagaaaataatatgcttgctactacattt
caccccgaattatctgatacaacttcgatacacgaatatttcctacatctagttaaaggg
>SSO0572 Conserved hypothetical protein
gtggggataaggattttgaatgatctgatgttagataaaagtgcgttattatttggggtc
tcgaaatatcttgagaagggaataattactggtaatatcctaattcataaatcactttta
gctgaactcgaaaaggaaagtaatgatggtttagttagcgctgaaatagctcttgatgaa
gtgaaaaagttaaaagatataacagaaagaattctagttaattttgaaatagtaggcgaa
aattcaaaaaaaggagaagctaatgaactttcgcgtgaatattgcttagagaaaggttgc
ataatggttaccgcagacgaaacgcagaaaaagatttgtgatgtgatggggatacagtat
agttttttacaaccgttagagcaaagtttatcatttgaaagtttctttgacgatgaaaca
atgagcttacacataaaagaggatactgtaccgagagcaaaaaaaggtaagcctgggaat
tggaaatttgtaaatctctcaaataagcctatgttgtcagttgatgtaaaaaggatagct
aatgagataattaatggtgttaggttcataaaaggttcttttatagaaatagagagaaaa
ggttctctcattatacagttaggcaattatagagtggtgataactagaccacctttaagc
gatggttgggagataactataactagaccagttgttaggaaaagattagaagattatggt
ttagatgaacgactaataaaaaggttagaagaaagagcagagggaataattatagcagga
gctcctggtatgggaaagacaacgttcgcacaagcactatcagaatactatatgaggtta
gggaagatagtgaaaaccatagaatccccgagagatatgcacttacctccagagataaca
caatattctaaaaactatgcagaaattggagagcttcatgatattttactattaagtagg
ccagactatacagtatatgacgagatgaggaatgacgaggattttaaactttatatcgat
cttcgccttgcaggcataggaatggtaggggtagttcatgctacctcaccgattgatgca
atacataggtttgtaaacagagtagatataggtacaataccaaatatcttggatactata
atattcataaattctggaaacgtaagtaaggtttacactttagaaatcacagtaaaagta
ccagcaggattgaaggaagctgaccttgcgagaccagttgtagaaataaaagatctagtc
actgggaatactgaatatgagatatatgtattcggtgaacagaccatgatagtaccagtg
aatagaggaatcaccttgaataatatggaatttaaaatatcgaaaattgttaataatata
ataccaaaagctacagtaaagtatgaggacggagaatacgttatagtaataccaaaagaa
gaaataggaaaatacaataggaaattggtacaacgattaaagagactcgagaagaagaac
aatataaagataaagattaaactgtcagat
>SSO0575 Holliday-junction resolvase
atgaacgctaaaaagaggaaaggttccgcagtagaacgaaatattgtgagcaggttaagg
gataagggttttgctgttgtgagagctccagcaagtggtagtaagaggaaagaccctata
ccggatattatcgctttaaagaatggcgttattattttaattgagatgaagagtagaaag
gatatagagggaaaaatttatgttagaagggaacaagcagaaggtattatagaatttgca
agaaagagtggcggttcgctatttttaggagtcaaaaagcccggtgttttgaagttcata
ccatttgagaagttaagaagaactgaaaccggaaattacgttgcagactctgaaattgaa
gggttagatttagaagatttggtaagattagtagaggcaaaaataagtagaacgctagat
aattttctc
>SSO0576 (ilvC-1) Ketol-acid reductoisomerase (EC: 1.1.1.86)
gtgaagtgtacgtcaaagatctacactgataacgatgctaatctagacttaattaaaggt
aagagaatagcagtcttaggctatggaagtcaagggagagcatgggctcagaatttgaga
gattcaggattaaatgttgtagtaggattggaaagggaaggaaaatcgtgggaattggct
aagagtgatggaattactccactccatactaaggatgcagttaaggacgcagatataata
atcttcctcgtgccggatatggttcagaggacactatggttagagagcgtgcaaccttat
atgaagaaaggtgcagatctagtatttgcacatgggtttaatattcactataagctaatc
gatccacctaaggattcagatgtatatatgatagctcctaaaggcccaggtcctactgtt
agggagtattataaagctggaggtggcgttccagctttagttgcagtacatcaagacgtg
agtggtacagctcttcataaggctctagctatagctaaaggtataggtgctactagagct
ggtgtaattccaactacctttaaggaagagacagagacggatttgtttggagagcaagtg
atactggttggaggtataatggaactcatgagagctgcgttcgaaaccttagtagaagaa
ggatatcagccagaagtagcgtactttgaaactataaatgagctaaagatgttagtggat
ttggtttatgaaaagggaataagcggtatgttaaaagcagtctcggatactgcgaagtat
ggtgggatgactgtaggaaagtttgtaatagatgaaagtgtaagaaaaaggatgaaagag
gccttacagagaataaagagcggtaaatttgcggaagaatgggtagaagaatatggtaga
ggcatgccgacagtagttaatggtctctcaaacgttcagaatagtttagaggagaagatt
ggtaatcaactgagagatctggttcaaaaaggaaagcctaaaagc
>SSO0577 Hypothetical protein
gtgacccaagaaagagtagttaggatattagcttattatagggacccgggattaatagag
aggatagcatcaaactttagaaaactatttatggatattgaatggatatacggttggaag
gtaaatgacgaaaacctctacgagttttatgttggagtaaaggatcacaataattttaac
actgcagtacttctgctaagtaagactgtggatgttagtaaggtagagattttagatgat
gctcaattaaaaagggtaataataagggatggaaaagtaattgagaatcaatcggaaggc
gtaaaagaaggggacataataatttatgtaccggttttcaataaagtaaaaggatatagt
tggggtgaagtgtacgtcaaagatctacac
>SSO0579 (ilvB-2) Acetolactate synthase large subunit homolog (EC: 4.1.3.18)
ttgccaacaggcgcacgcattttagttgattctctaaagagagaaggagttaaggtagta
ttcggaataccaggattatcgaatatgcagatatatgatgctttcgtagaagatttggca
aatggtgagcttagacatgttctaatgagacatgaacaagccgcagcgcatgctgcagat
ggatacgcaagagcttctggagtcccaggtgtatgcacagcaacatctggtccaggtacg
accaatttaactacggggcttattactgcatactgggatagttctcctgttattgcaata
actggtaacgtgcctagaagcgttatgggtaagatggcattccaagaagctgatgctatg
ggagtgttcgaaaatgtgaccaaatacgttattggtattaagaggatagatgagataccc
cagtggattaagaacgcattttatatagcaactactggaagacctgggccagttgtggtt
gacatccctagggatattttctatgaaaaaatggaagagataaaatggccagagaaacca
cttgttaagggttatagggatttcccaactagaatagatcgtttagcactgaaaaaggca
gctgagattctaatcaatgcagagagaccaataattttggtaggtactggagtagtatgg
gcgaacgcgactccagaagttttggagttagcagaactattgcatattccaatagtctca
acttttcctggaaaaactgcaataccgcatgatcatcccttatatttcggaccaatggga
tattatggaagagctgaggcatcaatggctgctctagaatctgatgcaatgctagtagta
ggtgcgagatttagcgataggacattcacatcatatgacgaaatggtagagaccagaaag
aaattcataatggttaatatagatccgacagatggagaaaaggccataaaagtggatgta
ggactctacggtaacgctaagataatattaagggagctaataaaggcaataataacactg
ggccaaaaaagagataaaagtgcatggataaaaagagttaaagagtacaaggaatattat
tcccaattttactacactgaggagaacggaaaattaaagccttggaagattatgaaaaca
attaggcaatcattaccaagagatgctatagtaactactggtgtaggtcaacatcaaatg
tgggcagaagtgttttgggaagtattggaacccagaacttttctaacatcatctggaatg
ggtacaatgggttttggtctccctgctgcaatgggagccaaattggctaggcctgataaa
atcgtagtggatctagatggtgacggttcgttcttaatgactggaacaaatttggccacg
gctgtagatgagcacattccagtaatatcggtgatatttgataatagaaccttagggtta
gtgaggcaagttcaagatttattcttcggaaggagaatagtaggtgtagattatggtcct
tcgccagacttcgttaaattggctgaagcattcggtgctttaggctttaatgcaacgact
tacgaggaaatagaaaagtcgattaaaagtgcaataaaggaagacatccctgcagtaatt
agagtaccagtagataaggaagagctggccttacctacgttaccaccgggtggaagatta
aaacaggtgatattacgtgacccaagaaagagtagt
>SSO0580 Conserved hypothetical protein
ttgcttattatactcttcctcctagtctatacagagatgataagagcaatagtatttgat
gctgataaaaccttatgggatcatcataatatatcggagtttgaagaacctttaagacta
attgactcaaacactttagaggattctaaaggtagggttctccatttatttccagacgtt
aaagagacccttaaggaattaaaaaatagaggttatatactaggtctagcaacgtggaat
tttgaggataaggcaattaaagtcttagctgcactagatttgcttcaatatttcgatata
attgtagcaaagccttatccctacaaatttttaatgttaagtcagataattgttgagatt
aatactaaagccaaccagaaaataaaaccaagcgaagtccttttcctagatgatagaaga
gggcatttcgggaatatctggttgtatctagggaatgtaaagtgtttagaaatgtggaaa
gatatcagcaagtatagtgaaatatttagcgtattaagtcacgttaataatgaa
>SSO0581 GTP binding protein, hypothetical
atgctgggaaaagtcattcagttgatcaagagatctgatcttgtagttgaggtactggat
gctagagaaccttctttaaccaggtcaaagaaaatagaggatattatagtaaaaaattat
aaaaatatattattagtattaaataaaggagatttagtacctttatgggttctcaaagct
tggaaggattactttaagactgaagagaatattgaaagcgtgtatgtatccgcaacttcc
catttaggtactaaaattttacgtgatacaatgaagtccttactaaaaggaaataaaggg
attgtagtgtttgtagggtatccgaaatccggaaagtcttcagtgattaatgctcttaag
ggtagacattcagctcaaacgtcagcccatccattggaatatggttataccaaatctatt
caactgtttaagattgacaacaaaatatatgcatgggatacgccaggtgtaataccccca
gatggtaatgagctagaaaaaacaataaggggatataacgcggatttattagaagatcct
gtaaaaccggctttgatgctgataaatagagttattgaattttcgaaagaaagtttgatt
agtgtttataaggtggattttaataatccttacgaactattagaaaggatagccataagg
agaggatggttctacaagagtactaaagagcccaatatcgatatggctgctagggcggta
ataagggactatcacgaaggtaaaattgcttattatactcttcctcctagtctatacaga
gatgataagagcaatagtatt
>SSO0582 Hypothetical protein
atgcctaaaggagagttagcgatatttgacgaaggagactttgaagggtcaatagactat
cagtcctttacgaaatcgattaagctaagtaacataaataaagaggctagtttctctata
gatatagcatcgaagcctactaagttttatcttataatccaagctaaacgagaaaaaaca
tatttgcctagatggaggctttggtttgataatttctctcttacaaaagaatttaaacca
aatctcgaaactgaaataaatgatgcccaagttatctcaactatagtctatgatataact
cctataatcaaagaagggaaacatcaaatagcagtataccatccatctattcaagtactt
gagttacttaacataagtctgatttcgttctatagaacagaaggttttagtactaaatat
cgactgagtgccggatcactaattttcaatagaaatgattcagtttcttttcacttaatg
aaaaagtcgtattttgtgataagaaatgagagtaaggaaggaatggtaaaaataagtgat
atagacgggaaaacaatatacacaatattacctagctctgatagtgatgagatagaaatt
gaaaacaatgatgcgataacgactacgcttcaatcaaataatgaaaaagactatggagtt
attttagcttcgtataacttacttgaaaaagctcctaaaataaattttagcgtagacagt
aaggtgagtgataacataatttacctatacttgaaaaatgagagcgagataagtttagat
aaactactaataaacgttatgataaatggtgttccggcccattttaaaacatttaccaat
atagatgtttcctcgactatagacctaaaattgcccatatccgtaccacaaagtaagaaa
gctccaataatcaacgtaagagtagttggggtaaagggaggatatagaaagataatagat
aaacagattagcctt
>SSO0583 (ubiA-2) 4-hydroxybenzoate octaprenyltransferase , putative
gtgagtttaaaatcctatatgcaacttgttagaatacataatgttataggggcagcgcta
ggggcaattatgggctttttggtttcgtcgcaatggtatctcgaactcaaaggaatttta
ctatccgcactggtagttggccttattgcagccggaggatacgttataaatgacgtatat
gatgtagaaatagataaaataaataaaccatacagacctatcccatcaggcaaaatatca
gtaaataaagcaaaagcactatcaatagctctatttataattggtatagcactttcgatt
ctattaaatatttacgctttagtaatagcgctagtaaccgcaattggcttgatatattac
gccaaagatctaaagaaaactggcttttacggtaatttattagtagcaacaaccactgct
ctttcgatattttacggtggcctagcttttttctccgataactggcttttaaggataata
attcccacactctatgcattctttctcaccttaataagagagatagtaaagggtattgaa
gactataatggggattcacttaataacgtgaaaacgttagccacaacccttgggataaat
aaatcttggagaatagcaaaaattctacttgtacttctattaataatatcacctttacca
ttctttataggttttaatttaatttaccttatacttctaatacttgtttttattcctttc
actattctttccataattcaaaaggagacaatagaaggagcctctaaagctagaacatat
ctaaaaatatcagcaatttcaggaataatcgcgtttttactagggagtcttccattcttt
aaaggc
>SSO0584 Conserved hypothetical protein
atggattttgatccaatagttttcgatagaagacgttttccgggtaagaagtgtactggt
ataataagtcgcagaacatttctaacgcttggtgtcagtagggaatttatagatagagaa
tttaaaactatagaaataagatatgatagaaaatatacaatttatataagtacagatgtt
atcagattgaatagggaaaagttagaaatatggcttgatagcgaagtgaagacaaagaga
ccgagagatgcgataattaacggtaatactgtgatatccggaaatgaaaaatatgaggga
atagtagtagattctagtggttggaaaggtaacgctaaatggattaaggcaattgagtat
ttaacggaaccggtgaacgaggaaaatattatagtttatatagattctaaaaacgttgga
gggtttagttggatagttccgctaccttatggtactttagttggcgcaatctcatataac
gacccaaaagtgttcttgcctaatataaataaaagagtctttgatactcatggaggagca
attccacgtgttttacctatatctagcataaaaacattgaagtttggtgattctaccggg
cttataaaaacatttactggtggaggtatgtttggcatcgcaagcttattatatccacta
gtgaatggaatacgtaatgggaaatttagtgaatattactctatgtataaaattttagct
aaagaggtgagaaaacaatactacataactagacttctggaatccacttggaggtttctc
ccaattttatttaagttatataacgataagacgctcaatatttctgaagaatttgacttg
cattcacttcttgtcagtagatttcctcac
>SSO0585 Conserved hypothetical protein
ttgatgatgggggtagagttagcttttcctaaagtagtaggaaagcaagtatatggaagc
ttatatgagtgtgatgaggacgttttaaaagatactaagaggttggagcaaataataaag
gaggctgcagatataggcaatatgaacattcttgatataaagtcatggaaaattggggag
ggagtaagcgtagtggcgattatattagaaagtcatataactatacatacatggccggag
tatagattcgcaacagtcgatgtatactcttgtggtccacatactagccccctaaatgca
tttaggtatatagttgaaaaattaggggctaagagatatactataaatgaggctgataga
tcatcagagttc
>SSO0586 Conserved hypothetical protein
atgatttgtgataattgtaagacgcgagaagcggtaattctacaaccacatactggaaga
aaattatgtaaagaatgttttatagaagacattagaaaaagggttgaaatggaggctaga
aagcaggagatagtaaattccaataaaatacttttagcggtctcaggcggaaaggatagc
ttagtattagctgataccttgtctcaatttatacatccatctagactaatagcattcaat
ataaatgagggtataaagggatacaatagaaatgaatacgtgaagaagctagaagagtat
ctgaaagatctagggattgaactaataaaaagtggatttaaagaggaagttggattttct
ttagatgagatgctagaagcttcgttaaagaaaaagcttaatgtatccgcttgtacattt
tgtggaggattcagaaggaagttaattaatgaagctggaattaaagtagccgcagattac
gtggcaactggacataatttagacgatgaggtacaaactatagttataaatttgataaga
ggtgacttgttaagactaataaggttcggggataagccattaatggtaagtagtaagttc
gtaatgagagttaaaccgttgagaaaaatctatgaatgggagacaacgatgtatgcacat
ctcaaaggcttcgagtttcaagaaaccgaatgcccatatatttctcaaaagccaactcta
agggctaaggtaagggacctattgtacaaactagaggagaagaaaccagggacattactt
agaatactagaacagtttgatgagatttcagagaaaatcaaaaaagagtatagactcact
aacgaattacctaattgtgtaatttgtggagagcccaccacaccagggagaatgatatgt
aagaattgtgaattactaattagatctgggttaatgcctcaagaatatcaaaaatactta
cctatatcg
>SSO0588 Conserved hypothetical protein
atgttcaccagaactggagacgatggaaataccaatgtaatatctaaaagagtaggaaaa
gattctccggtagtaaacttattgggagatatagatgagcttaactccttcatagggtta
gccttaacaaaaattgaatgggaagatatgcaaagcgatcttatgcgtgttcaaactgag
ttatttatattaggtgaggaaattattcaagataagggtagaataaatgaggaaactata
aagtggctagaaagtagaactgttgaatataggaaagaaagtggtcccgtaaagctattc
gtaataccaggtggttccgagcaagcttcgtatttacatgtagtaaggagtattgctaga
agggttgaaagaaatgcggtagcttactctaaggaattgaatttcaacaaatggataata
gtttatctgaacagattatcttctttattattctcaatggctatagtagcaaataagagg
aaaaacgtaaaggagagaatctacgatataggtaagtatttt
>SSO0589 (leuS-2) Leucyl-tRNA synthetase (EC: 6.1.1.4)
ttgaataacattgcctataagtggcagacgagatgggaggaagataaaatttacgagtct
aatccgaatcccagcaaacctaaatttttcactacagttgcatttccttatcctaatagc
ccttggcatatagggcatggaagaacatacgttactggagatattttagctagatataaa
cgaatgagagggtataacgtactattccccatggcatttcactacactggaacgcctata
atggcaatggctgacgcaattgcaaaaggtgataaagagctcatagagacctttaaggat
atttatgaaatatcaccggacgtaatccctagaatgtctgatccattattcatggcgaat
tattttaaagaggatataaaggcttcaatgagagagataggtttagggatagattggaga
agggaatttactacaattgatcctgaattttcatcatttgtaacatggcagtttcataaa
ttacagagcaagggatatatagtgaaagatactcaccctgtaggatggtgcccagttcat
catataccagttggtatgcacgatactaaaggagatgtagaaccagaaataggcgaattt
gtattaatatatttcaattcagaaaagggtatatttccagcagctacgctcaggccagag
acgatatttggtgctacagcattatggataaacccctctgagatgtatgtagttgctagt
atgttaggtaaaaagatgatattaagcgaaaaagccgctgctaaattgtcttttcaaata
gatgatatagaaatagaggagaagattaagggatctaaactagttgggcttaaggtagaa
aatccaataaccggaaagcatatagcagtattaggagcagacttcgttgatgttagttta
gggactggcgttgttatgagtgtaccagctcacgctccctttgactattattattctaag
aagacatttaagaataacaatattgagattataccagtaattacagtagaaggtttagga
aacgcactggctaaagacgttgtcgagaagaacaacccaaagagtgatgaggatttaaaa
aaattaacagaatacgtctacagaacagaatacaataagggtgtgttgaggagtgatctt
ggaaacttaattagggaagagtatagaaatgaattaaagagtttaggtggacttccagtt
cctaagggtagagaactaataactaacttcttaatttctaaaggcttgggtagaaaaata
tttgaagtgatgaataaaccggtctattgtaggtgtggcacagaaattgtagtcaagata
cttaaagaccaatggttcttggattattcaaataaagaatggaaagaactcgcgaggaaa
tctttatctaaaattaatgtaattccagaggaatccagaaaggattttgaattcactata
gaatggttggagaaaagagcttgtgctagaactagaggattaggtactccactaccttgg
gataaaaaatggataatagaaagcttaagtgattctacgatctatatggcgtattatact
atttctcacaaaattaaacaatataaactatcaccttccaaactaactcaagaattttgg
gattacgtaatgctgggcataggtaatttagaagagataagcgaaaaaactggtatcccc
tccaatatcataaaagaatttagagaagaattcctatattggtatcctttagatattaga
catagcggaaaggacttgattccaaatcatttgactttctttatctttaatcacgcagcg
atcttccaggagaacttatggccaaaagcaattgctgtaaatggtttagtcttatatgaa
ggaaagaagatgagcaagtcacttaggaacattataccgttaagaaaaggtctaaaaatg
tatggggttgacgtaatgcgaattgccgtttcgtctacagctgatatgggatcagatgtg
aacttctctgaatctttagtaaaaaccgtaggagaaaccttaagaaaaatgtatgaactt
ttcaagagcttagataattatactggagatatcttgggattcccagagaaatggttatta
tcaagaatatatgagatcacaagtagtacaaccagacatatggaagcgttagaactgagg
gatgcagtcaacgagttactatttgtattctcttcagatttggatgagtatttcggcatg
gtaagtgctgagggaagagaggcgaataataaagttttacgggaagttttaacaatatgg
cttaagcttattacaccatttgctccgcatttagctgaggaaatatggcacgaaatctta
aaacaaaaaacgtatatagtaaatgaaggttggccagaggttgaaggttcaaagatggac
gaactaacgctattggaacatgaatacatgaagagaattgttgaagatataaggtcaatc
ctaaacatttttaagggaacaccgaaactcattaaaatttacgctttgaacgattctaga
tatatggaattgcttagggatgctatagtagctaatggacaaatgaaaaagtttatggac
attcataaacctaagagtagagaagatgctagaattttacagaaaatctttaatgaatcc
ttagaaattgacgataagatgaagaaattagttacaaactataatattaatgaggtagat
gtactcaataaattatcaaaatatattaggagaaagttaaatgtagacattcttatagag
ccttatgatgaagaagtcaaaaagacatataataaagaagccatgcccttaagacctgct
ataataattgag
>SSO0591 Hypothetical protein
gtgaatttgttagattatctaatgtccttgagaaatagaaaaatacttttgcagtcgtat
catattaacgctaaaattgttttaatttataatattacacaaagattgtataaggaaaat
attagtgtatgtataattaattatgaaaaattcttaaaattatctataagagagatagac
cagcggtgtgtagaaggatcatacgtgatagtttttgaagctgaggaagcctctgatcta
ccaataagatacaatctagtaacaagttttgtaaaaataaataaggattttgacgatatt
ttaaggatagataagatttctacaaatttatataaggctcaaaataatgctggggatctg
tttatatttagtgtaattaatggaaaagttatcgataggaaactaagacctatacatgaa
gatattattaattttttaagagaatatggaggagaagttgagattagagatttagtaaat
ataatttcaaaaaaatatgagacaaatagagataatgttagagttgaactagcatttctt
aaagagttaggtataatagaagttaaagatcgaaaagttattcttactcaattatta
>SSO0592 (hisC) Histidinol-phosphate aminotransferase (EC: 2.6.1.9)
atgagattttcattaaagcttatttatttattttacgttgcttatctagggttttatatt
gcaccaaccaagttagttagaaataagataaaatcttggctattaaatgcaagcgaatat
gattttacagatataaaagaaggaataagattacatcttaatgaatccccatttgagcct
ccacaatttataatagatgcggttaagatgtatttaagtaagggaaacagatatcaacat
ccagatcttttagaaaaatatagggaattggctgctgaatattcgaaggtggaaccagaa
aacatttatccatctgtaggtgcggatgggtcaatcagagcaatattttataaccttgta
gagccgggtgatacaatactaacgaattacccgtcttatagtatgtattctgtttactct
tcagtaagaggaactaaggtaattaaagtaaatcttaaagaggataatgaatggtggaaa
gaaaacactgatgatttacttgctcaagcagaaaaagttgagttagtcataattgatgat
cctaataatcctacaggatcgccaatgctaaatgggaaaaaggaactaataggtcaatta
gcagaaaacacaaaagggtttgttgtaattgatgaggcatactacgaatttggaggatat
acagtttcaccttatatttacgactatcctaacgttttggtggttaggactctgagtaag
gcattttcattagcttcctatagattaggttatacgatagctaatgaggagatagtaaag
gctcttatgaaatcatcaacaccttttgatatacctttaccttcactcattgccggaatt
acagcattagaaaacccgtcatatataaaagatgtcgtaaacatagttaataggaatagg
gaaatattatatcaagggcttaagaatctaaatctgaaagtttacaagtcgataaccaat
ttccttttaataaaagataacagaaacttgcaggaaatgcttatgagacacgggattgca
ataagaaagttatatgacaacttttatagaataacaatagggactgaagatcagtgcaag
atggttatagataaacttggtgaggaacttgaaaatagcaattccaaa
>SSO0593 (hisG) ATP phosphoribosyl transferase (EC: 2.4.2.17)
ttggtgaggaacttgaaaatagcaattccaaataaaggaagactccagcaacctacgcta
caatttttacagtcagtaggcataaaaccgttggccagtgacgatagagcgttaatagta
ccgacaagttgggagggagtgcagctagtcatgatcagaaccgaggacatacctaatatt
gtggaaaccggtgctacagaattaggaattactggtcatgattatgttatagaaagtagt
gcagatgttgaagagctaatcaaactagactttggaagatcaaaaatagttctagcagta
cctcaaacttggagagaaaattctgtggacgaattgaaaggaaaggaatttagagtagct
actaaatactataacatcgcaaaggaatacgtaaggagaagagaactaaatgcaaaggta
gtaaaaataagcggagctgctgaggtaatgccatcactgggtgctgctgaggcaataatc
gacgtaatgagtactgggactacactaaaactacatgggttaaaagcaatagacgttata
atggactcctatgctgtagttataggaaatagaaactggataaaaaacgatgaggctgat
aggattaatttacttcttacaatgatgaaaggggcaatagcagctaagggtaagaaaatg
atattcatgaatgtacccgataataaactagatggagtaataaattcgctgcctgcaatg
ttagccccagcaataactagattaagcagatcagacatatgggaagtaattacggtagca
gaggaggatatactaccagaagttatagccaaagtgaaagctgctggagctagggatatc
gttgtaattgatatagagaaagtggtgaaa
>SSO0594 (hisA) Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC: 5.3.1.16)
ttgaatgaaataattccaagtattgatataagctttggaaaagcggtaaaacgaattaga
ggagttaggggaactggtctagttttaggtaatccaatagaactagcaaataaactctat
aatgaaggatactcaagaatacacgtagttgatttagatgctgcagaaggggttggtaac
aacgagatgtacatcaaagaaatatgtaaaataggatttgattggattcaagtaggcggg
ggtataagggacgttgaaaaagctaaaagattaatctcattagatgttaatgccctaatt
ttctccacaatagtatttactaatttcaatctattttacaatattgtaagagaaatcgga
aataatagagtaatagtatctatagattatgacgatacgaaaagagttctaataagcgga
tggaaagagagatcaatggaaataatagatggtattaagaaggtaaatgaacttgaatta
ttagggattatactaacctatgtcaccaatgaaggtaccgttaaaggaatcgattatagt
gtgaaagattatgcaaaactaatacgaggggtaaaagaatatgctggcggtgtttcaagt
gattcagatattacgtttttaaaaaacgttggatttgattacataatagttggaatggct
ttttacctaaataaaataagggggactaacgttgtc
>SSO0596 (hisB) Imidazoleglycerol-phosphate dehydratase (EC: 4.2.1.19)
ttgtctagaagcgcaaatataactagagaaacaaaggagactaaaatagaggtactctta
gacatagatagaaaaggcgaagttaaggtttccactccaattccattttttaaccacatg
cttataacattactaacctacatgaactctactgcaatagtgtctgctacagataaacta
ccctatgacgatcatcatattgtggaagatgtcgcaataacgcttggtttggcaataaag
accgcactaggcgataagagaggaataaaaagattctcccaccaaattataccaatggat
gatgctttggttttagtttcactagatatttcaaatagaggaatggccttcgttaatctt
aatttgaaaagaagtgaaattggtggattagctacggaaaatgttccacatttcttccaa
tcctttgcttacaatagtggaatcactttacatatttctcaattgagtggatataataca
caccatatcatagaggctagttttaaggccttaggattagcactatacgaagcaacgaga
atagtagacaatgaaataagaagcacgaaggggataata
>SSO0597 (hisF) Imidazoleglycerol-phosphate synthase, cyclase subunit (EC: 2.4.2.-)
atgacaacgaaaagaataatagcttgcctcgatgtaaaggacggtaacgtagttaaagga
gtaaatttccttaatctccaattgaaaggagatccggttagcctagccagtctatatgaa
gaagaaggcgctgatgagatagtcttcttagatataactgcaacgatagaagctagaaaa
gcattatataatgtcattaaggatactgcgagcgtattgtccattcccttaacagttggt
ggtggtattagaacacctgacgacgtgtcaatggcgttaagatctggagcagataaggtt
agtataaatactgctgcagttgaaagtagccaaatagtgaaaaaatctgcagaagagttt
ggatcacaagcagtagtagtagccatagatgttaagaaggtaagcggaaattggatagtc
ttcacaaaatccggaacttacaataccagacttgatgctataaagtgggctaaaaaggtg
gaagaacttggtgcaggtgaaatattgctaacgagtattgatagagatggtactagactt
ggttatgacttagaattaactaggaaaatagttgattctgtcaatatcccagtaatagct
agtgggggagctggaaaaatggaacatttttatgaggttttttccctcgcgaaggccgac
gcagcgttagctgctggcatattccatgatggaataattaaaataaaagacttgaagtcg
tatttaagccagaaaggcatcgaggtgagaatg
>SSO0599 (hisD) Histidinol dehydrogenase (HDH) (EC: 1.1.1.23)
gtgatttcctatagtctgccaaatgagagaccgaacgattttagcagagtaatcccagta
gtcaaggatattattgagtctgttaagaccaagggagataacgcgttatatgagctaact
gagaaattagataaagttaagatagataacatcaaggcaagggaagaggaactaaaaaca
caagcttctaagttggatcccaaagttaagcaagctatagatacagcctatgaacaatta
aaggcattccatgaaatgctagttccgcctaatatcggagggggctatcaaggtatatcc
tttggagtaatttggagaagtatagagaagatcggaatatatgtcccttccggtaaatat
tcctatccatcgaccttactaatggctggaataccagcaaaagtagctaaggtaaaggaa
atttacgtagcctctcctcctactcaagaaggaaccgtaaatccagctttagcttatgtt
gcaattaagctaggagtaaatgaggtttataagattggtggtgcacaagcaatagctgct
ttagcttttggtactgagagtgtaaagaaagtttacaagattgtaggaccaggaaatgtc
tatgttcaagccgctaagtacctagtgagtagcgttgttggaattgatggaattgaggga
ccaactgaattagttataatagcagatgagactgcaaaggccgagtatgtggctctagat
atgaaggcacaagctgaacatggtccagatacgtatatagtgctcttatctaatgatgat
gaactgattaggagagtcgaagagaaaataaagaatgataaaaaaatatattatataata
aaaactaaaaatttagatgaagctatagaaattgcaaacaaaattgccccagaacatcta
tctttatatgttaaagacgcatataccttaatggataaaatagtaaatgcaggcgcgata
agcctaggaaacacacctccagcaataatagattatgtagctggtcctaatcacatttta
cctactaatggttgggctaaaattaggggaggcattactgtttacgattttataaaacca
acaatgtacgctaatgtccgtgatataaataaacagctacttgaagcatctatttcctta
gcaaactatgagggattcataattcatggtaaaagtataggtgcacgatatgag
>SSO0600 (hisH) Amidotransferase hisH (EC: 2.4.2.-)
atgaaggcattagtaattaattatggtgtaggtaatttatatagtatctcatctgctcta
aaaagagtaggatttgaagtaacaatagataataaaccaaggaatgattacgatctaatt
gtatttcctggtgtcggagcattttcagctgtagccgaatttatcttacgatatagggaa
cttttcaatgatctaagaaggagtgggactaattttttaggagtttgtctaggcatgcag
ataatgtttgaaaagggaaccgagggaaaagagagtaatggcttaggatggtttaagggt
atagtggataagataaatgctaatgtgaaacttcctcacataggctgggatttagtattt
gaagtgaaagattcttgtgaattaacttacggattagacaagaaatatgtttactatgta
catagctatgtagcttatcctactagtggagattatgtttacatgaaaagtcagtatggg
atagaatatcctgcattggtatgtgataagaacgttgtaggaactcagtttcacccggag
aaaagttcaaatactggtaaaatatttctcgagaatcttaaggggtggattaaacgt
>SSO0601 Conserved hypothetical protein
atgagttcgcaacaacaaaaagtagacaaggaagaatggaagaaaaaaataatggaagcg
ttaaaagacgtttatgatccagaaattccagttgatatagtaaatttaggacttatttat
gatctgaaaataaatgatgatggtgatgtttaccttagattaggattaacagcaccagga
tgtccagttgttgatgatttgatatacactgtagagcaagtaataaaagaaagcgtacca
gctaagagtgtggaagttgacatagatttagatacacaatggacgccattaaaaatgaca
gctgagggtagagagaagtttaaacagttatatggttacgatatagttgagatgtgggta
cagacttatggactacctgctgatgaacagaagtca
>SSO0602 (serS) Seryl-tRNA synthetase (EC: 6.1.1.11)
atgtcgtggagtatcctagagcttttgcgaaaaaatccggaggatttgaaaaataatttg
aaaagacgggctatagatgtttctttagtagataaagcagtagaattggacaaaaaatgg
agacaagtattacaagaagttgaaaaattaaggcatcaacataatgttttaagttcacag
atttctaagctctctggagaagagagaaaaaagaaaattgaggaaagcaaaaacttattg
aaaatcctagaagaaaaagaaaaagaactagaagaaatagagaatgaaagagatagatta
ctatcatctctaccgaaccttgtagctgacgacgtcccaaacggtccggacgatagctat
aacgttcctattaagttttgggggaagtttaaagtatatgagggagacgttcaagaattt
ctaaagcagatcaaggatgctaaagtaaactatgaagtaattaaatggaaaccgaaaggg
catgcggaaatgctagaagatgtattacatttaggaaatacgctgaaagcagctgaaatt
gcgggttctagattttactatttatttaatgatatagtttggctagacttctctctacta
cttttcgcaatcgattacattactcagcaagggtatactttagttctccctccttatatg
ctaaggggagaggttatacaatcagtaatagacctagacacgtttaaggatgctatatat
aagatagaaaacgaggatttatatctgattgcaaccgcagaacaccctatagcagctatg
ttctttaaagaagaaattgagaaagataaattacccttaaaattcgccggaattagtcca
gcttttagaaaagaagcaagtgctgcaaataaggatttaaagggaattttcagagttcat
caatttcataaagttgaacagtttatattttcaactccagaagatagttggaaatatcat
agtgaattgataacgaatgctgaaagtatatttcagcaactcgaattgccatacagaatt
gtaaatatagcgtcaggtgatttaggtgcatgcgctgcaaagaaattcgatttagaggta
tggatgccagctcaggccaaatttagagaaatggtaagttgtagcaattgtacggattgg
caagctttcagaatgaagataagatatgtggatagaaaaaataatagaaggggctacgta
catacattaaatagtactgcaatagctagcacaagaactataacagctattctagaaaat
tatcagagagaagatggtgttgtcgaggtaccaaaagtactaagaaaatatcttgaggcg
tttccgaaggctcctaaagattatatatacccgctaaaaaataagataatt
>SSO0604 Conserved hypothetical protein
gtgagttttttggagcagacatttgatttcatattaactacagatagatgtctgatgacg
aatcatcatggaaaagaattccttggatttttaggtactggacctgctgtaggagttcca
gaagctgtctggaaatggttagcatgccctaaaatgaaagttgacgatttaggaagacca
gaacaagccccatatggaatgagaaaagtcgaagctaaattaatagatgaaggatttaag
gcagcaataatagatccagatcatttagatagacacttgaaatatgctaaggccctaatg
ttttcgcaccatgattacttcgcttttggtccaccatcatcaacttggtggggcataact
aaaaaggagccaataaactacaagagtttccaagctctgataagcaaaccggagattcaa
gaggctaaaaagagaggaatgaagatattagtaggtggtccttcgacatggcaatggtta
tggagagaagatatgatagaaaaagttggcgtagacacgttagtagatggtgaaggagag
aaggtagtagtcaaattagcacaaatgatactagataatgagccattgcctaagtacgtt
tacgttagcggagacgatgtgccagatatagacgatatttcagagattaaaggagcaagc
gtcaatggcatgatagaaataatgagaggatgtgcaagatcttgcagattctgttcagtt
actataagacctactaggtattatccattagaaaaaatcgaaaaggaattgcaaactaat
gttagagcaggggtaagacatggcgttgtacatagtgatgacgttctattttacggtgca
gtaggaatatatcctagacccgaaccattaataaaacttcatacgctagttaagaaatat
tataaaacaatagcgtggagtcatgcaagtttagcggcaataagatactctgaggagaaa
tatggtttaattagtaagctaggtgagataatatttgatgatgaacaaagatatctaggt
gttgaggtagggatagaaactggttctgtcaagttagctaaagagataatgccagctaaa
tctgcaccatataagccagaagaatatccagagatcgtagaagaagcgtttaagataatg
catgaaaacaagataattcctgcaggcacaatgatagtaggtttaccggaagagacagaa
gatgatgtgtacagaacaatagaattagtagataatttgagaccatatagaagtatatta
gttcctatgttctttgtacctatgggctttttcaaaaatagagattggttcactagagtt
aagttaagtgaggcccatatagagttatacagaaaagtattctggcacgacgtatattgg
gctgaggatattataaattccttctacatgaaaggaccagtgtatatgccagtaagattc
gcactgaagctattcttaagattcgcaaagaagaaaatgagagaagtagaaaaatggttg
gagaatcaattaaaagca
>SSO0605 Zn finger protein, hypothetical
atgcaaaagtttttatactattccctcactttatttacacttatgaagttttgtcctaag
tgcggaggattaatggttccatcaaagaaagacgggaaagaaatcttgaaatgtagtaaa
tgtggctatgagatgatgttaagtgaaaaagagaagaaagaatatagtgtaaaggagagc
aaggataagagtagtaaagtgttaacaacatcaatagttagtgacaaagagggaagaaat
ttaagcgaggagctagagcatgaaagggaagagtattataaggaaatagggttggagtta
ctaagagaggaattcgagggaaatgaagaggaagaaagtagagaagat
>SSO0606 Transcriptional regulator, putative
atgtcagatagtaaaaaacgtacggtagatttggacgcaatagatagaagattattaata
gaactcactagagatgcgagaacaagtctaagaagacttgcagaagagatgaacgtatct
ccagctacgcttcataacagaatgactagaatggtacaagaaggaatgataaaaagcttc
gtagctttgctagattactctaaattgggtttcgctctaactggcataattatggcgaaa
gtggatggaaaacatcttgttgaattcgaaaaagagatagcaaacgctgataacgttaca
gctgtttatgatgtggtaggggaatatgatgttgtaataatcgctaagtttagaagtgta
gaagaactggatagcttcttaaaacagttgcttaaaaatcctaagattgaaagaacatat
acaagtatagttttaaatgttgtcaaagaagatccaagaatacgaatattt
>SSO0607 Conserved hypothetical protein
atgagtgagttagtttcaatcccagaaatagcctttaagctatatgcaattatggatcca
ctatcgatccttccttatcttattgcattgtacgaggaattcaatcgcaattctcaaaat
aaaataagctggagatttttggtaaacaaattgtctatagcagttactgtcttactttta
tttttctcaatactaggcggaccccttttagctttcttaggaataagtgtttcagcactt
gagataggtggaggtataatattagtttacctaggcgtagacacacttggaggattccaa
cagttaaagtttttatcaagcaggatagaggaggccataattacacctattgctaccccc
cttatcgtaggtccaggtacaatgactggattaattacattgtcagttagtaataattta
ataattttaattcttggtagtttactagctgcactactagtttatctatctttactatta
ggtcccatcataattagaatattaggtaatacaggcacagtagcagtaggtagatttatg
gcaattataatagcagcatttggtgttcagcttataatagatggtatatcacaaataaag
ttgata
>SSO0608 Conserved hypothetical protein
atgagtaaatttagaattgataaaatacctaagaatgaacaagatatagaggaaatacaa
agagaaatagaagaatcccatccccatgagcatgaacatgaacacagcgttgaagaatta
ataggtgaaatatatttaaatgttcagagcctccagagtaaggtagaggaattaaataag
tcaaacaataactgtaaaaaagaaatttctaaaatttattttattctcggcaagttacta
atagcattaaccacaaacgataatgatgagaagattaaaaatcttaaagaagttcttagt
ctgctagaa
>SSO0609 Hypothetical protein
atggttaggccagtaatgaaaggaagagatttagaaacattagtattcctagggcgatta
aaggaggtaaaagtagagtattgtgacgaagaaaagaagatggctaaagtaatagggatc
actgataccaaagaggaagtagagacggagtgtataccattgagagctgcaggtaagatc
tctacagtgcttaagcattatattaggttaggtgtaggaaattatatcataacccaaact
gatatgagaaatgtagctaatgtagatacacaggcggaagaggaggaaaaggaagaa
>SSO0610 (pyrD) Dihydroorotate dehydrogenase (dihydroorotate oxidase) (DHOdehase) (EC: 1.3.3.1)
atgattacgataaaaaatatcacactaaacgaccctttaataatagcctctggaatcata
ccagatgttccaaattatgtggagacaatttgcgaaaaatataaaccctctgcaattacc
acgaagacagtaacacttaaccccttagaacctcataagcctcctacagtcatcaaactt
cacgatggtatctatatgaacgctataggtttaggaaatcccggtgctaaggcaataaat
gaaattggcgttttatgtccccttatagtaagcgttggtggttcctccataaacgagata
aaagaagtggttgaagttgttcagagtaaggcgaagataatagaaataaacgtgagtagt
cctaacagaaagggttacggggaatcattatctaagttaattggggatataattgaaagt
gtcaaaagtgtgactaaattaccagtatttgttaaattaggtccttgggataacgttatt
gagcttgcagggaaagctttagagaaaggtgctgatggacttacccttataaatactata
aagggactaattattgatgtagagactttcaagccaattctctattatggtacaggaggc
gtttctggcagatgcctttatcctattgctcttaggataattaaagatgtttacgaagag
tatggagttgacattataggagttgggggtgtgtatgattggactgatgtaattggtatg
ttggcagctggtgctaaattggtaggcctgggtactgtattaatcgagaaaggatttagt
gtaattgaggaaattcggaagggtttgcagtcctatttacttgaaaagggtttaaaattt
gaagatattataggtatttcagtgagaaaa
>SSO0611 (pyrC) Dihydroorotase (carbamoylaspartic dehydrase) (DHOase) (EC: 3.5.2.3)
ttgatgatcttgtggattatgggaaaggcgtacttaagtaaggagattagggatgtttgt
ataaatttcgataggagaataaaggaaattaaatcaatttgtaaaccagatattgcatta
ccaaaaggtacattaatattgcctggggcaatagatcttcacactcacataagaggattg
aaattggcttataaggaagatgtagtatcaggtaccagtgaagcctcttacggtgggatt
acattaataggagatatgccaaatagtgtgcctttcgtaaacacgatggagacaataact
gccaagttaagagagtttgaatattactctagggttgactatttcgtgtactctggtgtt
actaaggatttaaagaaagttgataaattccctatagctggttataagatattcccagaa
gatttagagaaagaagagacgttagaggttttaaaatctatgaaactgaaaatccttcac
cctgaagttccgttagcattaaggggtaatagaaagttaagattgaatatatggtatgag
ataggagcattatattatgtaaaagggtatcaaaatgttcacataacgcatgcaactaat
atacgtactgtaagattagctaaggagctgggttttactgtagatataacgccacatcac
ttgttagtagatagagaaaaggaatgtctaaccaaagtgaatccaccaataagagataca
aatgaaaggctttggctattgcaagctataaatgaagtagatacagttgtaagcgatcat
gctcctcatgcgagttttgaaaaacagcaaccttacgagatatgtccacctggcatagct
gctctttcatttacagttccttttatattaacgttagttagcaaaggtataattagtatt
gatagagcagtagaactcatttctacaaatccagctaggatattaaatatcccctacggc
gagattaaggagaataactatgctaattttactattattcaatttaaagattggagatat
tcgactaaatattctaaggttattgaaactcctctagatggatttccgctaagagcttcg
atttacatgactatcattcaaggtaaggtaggtagtttggagggagaggtatttccagtg
aagggaataaatccgtttggtgagaataaa
>SSO0612 Hypothetical protein
atgatatattatgaagttatcgagaaaaggaaaaacgtagataatgtgtatgaaataaaa
atagctaactttagcgttaaaccaaaagcaggacaatacgtgagcttaatactgcctagc
aaggctgaaatacccttaggtgtcggagactatgatgaagataataatgaacttagactt
tatgttgagtcagaaaaattagctaacgagataggtaaaagagtaatattaaagggtcct
ttaggtaaacccctagactttactaacgtaaggattattgttggtatagcttatggcaaa
ctttaccatgacttattatatcctttaaaggtcgcttataggagtaagatagaaactttt
gcaaagtgtatagattgcaaattaaattatgaagagcctaaaaatattgaagatgctgat
ctaattttagtttcggcaccgttacaactcctatatgaattaaagatccccggagagaaa
accttagtctataatagatgggttaaaatgaattgtaatctaggagtgtgtgggttatgt
gaagttaaaggtaaattaacttgtatagatggtcctttcatgaggtttgatgatcttgtg
gattatgggaaaggcgtacttaag
>SSO0613 (pyrI) Aspartate carbamoyltransferase regulatory chain (EC: 2.1.3.2)
gtgatagggaagatgattagctcttcaaaaagggatgaattaattgtaagtaaaataagg
aatggtacagtaattgatcacattccagctggtagagcattggcagtattgagaattcta
gggataagaggaagtgagggctatagagtagctctagttatgaatgtggaaagtaaaaaa
ataggaaggaaagatatagtgaaaattgaggacagagtgattgatgagaaagaagctagt
ctaataacactaatagcgccgtctgctaccataaacattataagagattacgtggtgaca
gagaaaagacatttagaagttccaaaacagattagaggattaataaaatgtcctaatccc
caatgtataacaaataatgatgttgaagcggaaagtagatttataacgatttcaattaaa
cctcttaagctaaagtgtaagtattgtgagatgtatattactgaagatgatgtcataagg
cagatacta
>SSO0614 (pyrB) Aspartate carbamoyltransferase catalytic chain (ATCase) (EC: 2.1.3.2)
gtgagattaagacacgtagtttcgtcgcttgacttgaccagagatgactactttagaata
ttcgaacttgcagacaagttctatgatgtaaaaaaactaaattatctatcagggaaagta
gtttcattagcattctttgagccaagtactagaactgctcaaagctttcatactgcagca
ataaaattaggtgctgatgtgataggatttgcatccgaggagtctacttcgatagcaaaa
ggtgaaaatttggctgataccattaggatgctaaacaactattcaaactgtattgtaatg
agacataagtttgatggggcagcattattcgcaagtgagataagcgatatacctataatt
aatgctggagatggaaagcatgagcatcctacacaagcagttatagatttatatactgta
tataaggcgtttggtgaaatagatgggaggacttttgcattattaggagatctgaaatac
gcaagaactgtgaatagtttgctaagagcgttaactagattcaaaccaaagaaggtattt
ctaatttctccttctcaattaaaggttagaagagaaatattagatgaattaaattatcca
gttatagaaactgaaaatccctatgatgtgatccaagagattgacgtattatatgtgact
agaattcaaaaagaaagatttgttgatgaagtagaatacgagaaagttaaggagagttat
gtggtcgatctcaagttagttaatatgatgaagaaagatggaatcatattgcatccatta
cctagggttaccgaaatagacaggagagttgataaaactgtaaacgctaaatacttctat
caagcgtcattagctgtaccagttagaatggctctattttacgaagttttgggtgatagg
gaagatgat
>SSO0615 (pyrE) Orotate phosphoribosyltransferase (OPRT) (EC: 2.4.2.10)
atgaatttcgcagaagtcttactcgaaaggaaattattattaataggaagtttcgtttta
acatcaggtaaggttagtccatattacttagacttaagacctttaccaaattatccagaa
ttttacgatatagttaatcaagctataaagaaagcaaaagatataccccatgatataata
gtaggaatagccactggaggagttcccttatcggcattcatagcttgtaaccttaaagag
cctatgggatatattagaatagaaaagaaaggtcatggaactaatcgtacattagaactc
gatgtaaaaggaaaaagagtattgttagtagatgacgttgcaactacaggagtatccata
gagaaagcaacattggagattcttaacggtggaggtaaagtttcagacgcactagtaatc
atagatagacaagaaggggcttcacaaagattggaaaaactaggagtcaaattacactct
ctatttaaaatttcagaaattctagatgaattgttgaagagtgataaacttaaggataat
gaaaagaagtcaattctagattatttggtgaagaatgttgaaaag
>SSO0616 (pyrF) Orotidine 5'-phosphate decarboxylase (OMP decarboxylase) (OMPdcase) (EC: 4.1.1.23)
atgttgaaaagtagagtaatattagcaatggataaacctctctcatatcaagttcttaaa
gagatggaaaatgagttatatgggataaaagttggtttacctttagttttagatctagga
gtggataaaactagagagctcttaattggtttagacgtggaggaaattattgttgatttt
aagcttgcagatatcggatacataatgaaaagcatagttgaaagattatctttcgccaac
tcgttcatagcacattcctttataggcgttaagggatctctagatgaattaaaaagatat
cttgatgcaaactctaaaaatttatacttagttgccgtaatgtcacatgaaggatggagt
acgttattcgcagactatattaaaaacgttataagagagataagcccaaaaggaatagta
gttggagggactaaattagatcatataacgcagtataggagagacttcgaaaaaatgacc
atagtctctccgggtatgggtagtcaaggtggaagttatggcgatgcagtatgtgctgga
gcggattatgaaatcattggaagaagtatttataatgcagggaatccattaacagcatta
agaactataaataagattatcgaggataaggtgatgaaatgtaaaggagcaatttttagg
aaaaaa
>SSO0617 Hypothetical protein
gtgtatgagtattttgtaatttatgatgagatattgaggatttatatgaatttcttacaa
aaccttatgttaaactacgccagtaggactatcaattcagatgtggagtttatgaacata
gtacttagcgatggatcatacataatacttgagggagatgagaaaagagtttctatacca
tttccaaagggtatagccactacacatacgcacccgggaatttgtttgttttctcacaaa
gatttggaaacagctgatcacttatttagtattggttatgcagtagtttcagtaatgaat
accaaatgcatttcctctttatatagacgtggtgtatatacattagatgataaactagct
ttaaaaaatttggtaggcaagattaaaaaggccaaaaatttggaggaagtgattaatata
tacagaaatctagcttttcctaattatctaaaatttatcacttattcgatt
>SSO0618 Conserved hypothetical protein
ttgagcaaatcaataacaaggaaaatacagttaactggaggatctacctatatagtctct
ttaccaaaggaatggataaaagcattatcattatctgccggcgatgaagttgagatctat
caagatactgatatgaagctacttatagttcccaaatctgcgaatacaacagatcagaaa
gaaatcaagaagattatacattgcgataacgtgacgtcagaagccatcatcagggaattt
atagcatattacatagctggattctcttctgtatcaataacatgtcctaggatgtctagc
tctacaagggcttatattaaggatgtagtaaggagaagattgctgggggctgaggtaata
gaagaggatgttagtacaatttctatccaatttcttgttgacgaaaaagagttatcaatc
aaaaaggcgatatcaagagcatttacaatatcatataacatgcttagagattccttggag
gctataagtaaggctgatatcgagctggctaaagaaatatcgggaagagacgatgaggtg
gataggtttttcttctatattgctaggcaattaactatttcagtaaaagctataaacgta
ctggattctgaggggtataatctcacacaaatggtcgatatatattcagtagccaaaaca
attgaaagagtaggtgatcacgcaaacagaatagccagtctagtagaggatgtaagtaag
tttagtaataaagaagatctagtgaatttaggtcttacgattttggaaagttataagtcg
gccatgaatgcgtttttaaacgaaaagaaggacattgcacatagtctaatttcaaatatt
gaaatatttgaaaaattacgagaattacaagaaatagcaattaaaagtaatgacaatcca
aagattataacttcaacttcgatgacagttgaatctttaaggagggttgcaagatattcc
gctgatatagctgaagctacaatagatatactggctaaatcgaataag
>SSO0619 Hypothetical protein
gtgaagaagaaaggaaagagcttagcggagctactaatagacgtaaggattgcaagaaat
aaggtgcaaaacataattaatagaatgcagaataagataggtacttataatcatatcttt
atgagaaatgtagcttcattccctcatttatcaaaaatggtcgctagagaatctgagctt
ctcgagaatgtgatggaccatttgttgacactagaggtaattttagagatacttgagata
aaaattgagactattatctatataggcaatatagttactagcgctgcatcagtagttgaa
gctataaagctgcttaaagaaagtttcaatttaacgccagatatctcactattgcttgac
gatatatatagtaatttctacgttaatgtcgatctacccaaagagataaagattaatgta
aaagaagaagcgagaagcgtattgttggatgcggagaaaatcgccgagaagagaaaaagt
gaaacttattatcaagttaataca
>SSO0620 Conserved hypothetical protein
atgaacgaaaaggaacgaaagcaagttaaaaaatttttcaggtttctttttttcacttca
aggggaggaataactaggctaaaaatagtaagagtactagaggagaaacccttgaatccc
aaccaaatagcttcaacgttaaaacttgattataaaactgtaatgcatcacttagaagtt
ctaatggagaataatatagtatatagggaggccgatggatacggtttgccttataagctt
acaactttttataagacttataaggacgttctagatgaattagaaagagaaattaggcaa
aaagctaataaaagc
>SSO0621 Hypothetical protein
atgacacttagtgatgtgatattaagatatctgttaagtgaagaacctattatagaaata
aatgagaatgacataagtgcggaagaattcagcagtattgatgagataagtataggacta
agaataataattatcggtaaaaatagaaggaggagattagtggatttgggattattacaa
attatcgctaaatgtggacacttggattttattagggattatctaaacatgaaatttacg
ttaagagacatatataccaaatataacgtctatacagaattagaatatcttgctattcaa
gaagactgtgctgggttggttaatgatttggatttgaaatgtgttttattaaaggttaaa
tctacaacagagaaaagaggcactaccaga
>SSO0622 Conserved hypothetical protein
atgttggtgtgggaggaactaagagagaaagcgcttaataaaatataccatgataaagaa
ataggttacttagatccagatattcttggcttcttactagcattctatagaaacagaaac
gatgtttatacccaaagtagttgtagtgggagaataactattgttgatgcggaaatgcct
tgggataggaaaaactcaactatcatattcaaaaatcatttgagaattacggaacaggat
ctagaggacgttttaagcaaaaatcaagttaggcgactatggttaatagtacaaggaccc
attatacatatttatgctaaaaacattgaaactggctgggatatcttgaaaatcgctaga
gaagctggttttaaacatagtgggattttagctacaaaccaaaagggagtcttagttgaa
ttaagaacgggaataagaatggttcatctcttaagggagtcaaacacagagagagttgac
aaggataaaataaaaacattagtaaatgtatgtaatgaagtgttagcaagaggaaaacaa
aagatgaatctattaaaagacctattatcatctagctccaataattctatggagctgggg
aagaactctaaattgaagacccctatc
>SSO0624 Conserved hypothetical protein
gtggtacaaatgaagtatcgcgtgattgaaatctttacctctatccaaggtgaaggggag
gttatcgggatcccttcaaatttcattagacttgctacgtgcaacttaagatgtgtatgg
tgtgatacgaaatattcgtgggaaattggcactgagatgagtatagatgagattattgca
aaacttgataagaaaattaaaactaccacgataactgggggcgaacctttactccaaaac
atattaccacttgctaaggaacttaagagtatagggcataagattgtggttgagacaaac
ggtacaataaagccttcagaggaattaaggaaaatcattgatatcttttcggtttctcct
aagcttagtaattctgggcataagctaaaatacgacttcgcagatgattgggctacatat
tataagtttgttatagtctatccaaataaggatatagatgaggttgtaaaattcgtcgag
tctcagagtattaatccacgcaaagttatcctacaaccagatggaaatagaagcgattat
ataaatgcaataaatgaaatagtgcaaattgtgttagataggggtcttcaatttagagtt
cttccccagctccatagaattattggagctaga
>SSO0625 GTP-binding protein
atgttaaatccatttgagaagttacagatcccgccaaaagccaatcaaactattgatacc
atgctaaaaaggctgccaaagataggtggtactacagttagggatagagagataagaaga
ttaaaggaatattatgagagaattaagaaatactacgactttgtggaacaattccctaaa
attgacgaactacatcctttttatttagaggcaactagaattatgactgatattaataaa
ctgaggatatgtttatcagttaccaagaaaaccagcgtaatatctatgaagatattgaaa
aaatacatcaaccagataaggaaaagtccggaaaatgaatctaatcgaataatgcgtcaa
gcgtttggaagagtaagttccgtattaagaaaatccagtgaatgtatagatagagtaata
gacgtagcgaaagaattaaagaaaatccaaggtatagatccaacattgccgactatcgta
gtagctggccctccaaacgtaggcaaatccactttagtttcgaaaatctctacagctaaa
ccagaaattgccagttatccctttactacaaaagaagttcatgtaggtcatgtaatttta
gacgactttcgtattcaggttattgatacgccaggcattttggataggccagaagctgag
agaaatagaatagagagaaaggctactaacgcgataagaaacttaaatggcataatcgta
ttcatgtttgattcctcgatttcctcagttctatctgtagaaggtcaaatagaattattt
agggaggtgaaattattaaaaaagattgtcatacctgtaattaataagattgatgagaaa
tatgaagaatattataaaaagattgtagattttcttttaagtgaaggaaacgaatggcac
gaaataagcgctgaaaagggaatcggtatagataagttaaaagaggaactttttaacttg
gtaaaaagtagtggtacaaatgaagtatcgcgtgat
>SSO0626 (purC) Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthetase) (EC: 6.3.2.6)
atggaagttaacaagatttctgagggaaagaccaagatagtttatgattttgataaagat
cacgtattactcgagtttaaggatgacataaccgcgggtgatggtcaaaaaagagatata
ttggagggtaagggcgttttaaacgctcaaacatcagcattcttcttcagattactagaa
agaaatggtatagaaacacactacgtagggatgaaggatgaaagaacgatgatagtaaag
aaattaaagatgataccagtagaagttgtattaagaaacattgctacaggtagtatagtt
aagcgattaccaattaaagaaggtgaagtctttgaatcgccaatagtggaatttttctta
aaggatgacttacgtcatgatcccctacttaactattaccatatggaacatcttaaatta
atgaataggaaagaggctcagcatatagaagatataatgatgaaggtgaacgatgtacta
ttcaattttattaaaagcaaaggatttatattatatgactttaaactagaatttggccgt
ttgggcgataaactagtaattggagatgaaatatcgttagatagtatgagaattagagat
ggtaattccagaatttatgataaggatttatataggaagggttacgatttaaaaacagta
aaatcctcgtatgaggaatttctaaaaagaattacctca
>SSO0627 (metS-like) Methionyl-tRNA synthetase N-term homolog (EC: 6.1.1.10)
ttggtctttccctcagaaatcttgttaacttccattacgacaattttacataaccgatat
aaaaagttagcttcaaataagtataaacttttacttcattatgtaaatcaaaatccttat
aattcttcaccaatgcttaacatcatgagtaatcaaattacaatagacgattttgcaaaa
ttagaccttaaggttggaattgtgagacaagctgaaaggattgaaggaacaagattacta
aaactattgattgacttgggttcagaacaaaggcaaataattgcgggtttaggagaatat
tataccccagaggagttattgaacaagaggataatagttatagccaatttaaagcctaga
gtgataagaggttttgagagccaaggtatgttattggccgctggatgtaaagaggatgaa
gcgaaaggaataaaacccagaatactaactgtagacggagaagttcctccaggaactaag
atatgt
>SSO0628 (purQ) Phosphoribosylformylglycinamidine synthase I (FGAM synthase I) (EC: 6.3.5.3)
atgattgcaataattaagttcccagggactacttgcgaaactgatgtctataaggcatta
atagaggctggagttcccacagtgatagtaaagtacaaggacttcgatccagatagatat
aatggagtaattttaccagggggatttagctttggagactatctaagggctggaagtatc
gcagctagtacggaaactatgaaaaaagtcaagcaaatggcagaggatggaaaaatagta
attggaatatgtaatggtttccagatccttgtggaaagcgggcttttaaaaggagcattg
cttcctaatttaaaattaagatttatctcgaagtgggtttaccttaaggtaattagggct
gacacaattctaaccaaaggattagataagaaaataataagaatgcccatagcacatgcg
gaaggtcgatattatgtggatgatatagattatgcaaagacacatatggttctccaatac
tgtgatgagaatggaaatattagtgaagatgtcaatccaaatggatcattacttaatata
gcctcaatagctaacgaggaagggaatgtaataggaatgatgccacatccagaaagggct
tcctttaaactgacttcaattgacggaactgttgacgggttaattcttttgaggaggtta
ggagaatgggca
>SSO0629 (purL) Phosphoribosylformylglycinamidine synthase II (FGAM synthase II) (EC: 6.3.5.3)
atgggcataaatcttctccctatagagatggacgagattcgaaaaagactaggtagagaa
cctaatgagaccgaatggagagttattgatgcagtatggtcagagcattgctcttataaa
tcatctaaaatcttcttaaagagcttttccatagatagtcctaatgttataatgggcata
aaagactggcaagatgctggagcggtagatataggagatggatgggcagtagtaataaag
gttgaaagccataaccatccttctgccattgatccattcaatggtgctgcaactggtgta
ggaggaataataagggacattattagcaagggggcaaagccaattgcacttatggacatg
ataagggttggaaatctgaaaataaagaaaaacgtatggttgcttaagaacataattgca
gggattgcggcttatggcaatagtattggagtcccggtagttggtggagaattatcattc
gatgatacatataatgataatccgctagtagatgtagcagcgatcggaatagttagaaaa
gacaagataaaaccaagtattgtagataaagcgggacttaaattagtgttagctggacta
accggagttgatggtttaggcggagcttcatttgcgtctagaaagttaagtggtgaagac
gaaattggagcagtacagatagctgatccttttgctgggaaaattatattggatgtaacc
ttagaaatcgctgataaagtagaggctattaaagacttaggtggtggagggctagcagtt
gctgtaactgagataacaaacggacttggtgctacagtagatatagagaaaattccatta
cgtgtaaaaaatatgaatccgtcagatgtaatcatatctgaaacacaagagagaatgtta
tatgcagtggaggagaaaaacgttaaggaagtttgcgaagcttttgaagaatacgaatac
ccttgcagtgtaataggtgagataactaatgaaccagtaattaagtttagatatattggt
aaagatctcgtctccctacccacaaacgtattattaaacccgccgaggtttttatggcca
ataaaaaacactaagaaaaatgttgaagagaaaattgttgatttaccgttagaaagtgca
atttatactgtattaacacatccagatttagtaagtaaaggatgggcctattcacagttt
gattatgaagtaaatacctcaacagtagttaaacccggtgatgctgatagtgcagtagtc
tcgcttcctaatggtaagttattggcgataaaagcggatgcaaatcctgacatgtgcgct
gaggatggatatgagtgcggaaaaggaatagtagcagaggcctataggaatttagctaca
gtaggggctagaggaatggtagcagttgatcatttacagtttggggatccaaagaaggca
gaagtttactatactttcgtagaagcaataagaggtataggagaggctactagattcttt
aacatacctattgttggtgggaaagtttcattttataatgaaaataatcaaggaagacca
ataaagccaacacctttaatagttatggcagggttagttcaagataaattacttaaaaat
agagtggaagacaacttatacgttgtatcagtagggtatacgcgaaaagaattaggggga
tcattattatcaaagatatttaagatacctagtcaagctcctaaagtaagattacaagag
gatctgttatcttctgaggtagtaattgattctataaatgaggggaaaattacatttgcg
aaagatgtaagtagaggtggcctagcggcatctctttttagcatactagttcatggatat
ggagtagaaatcagtactaagagtattttaagcgatactgacaatgttatagagaatcta
ttctctgaaagtagtggacgtttcatagtcttaactaatgaaccagaatggatagttgaa
aagagtaagagtaaaggtattgtagcatctataataggaagggtcaataaaaaaactaat
attttaactattgataatatagattataatcttaaaaatatagttgataattactttaat
tttctagaagaggtaatgggtaatgga
>SSO0632 (purF-1) Amidophosphoribosyltransferase (glutamine phosphoribosylpyrophosphate amidotransferase) (ATase) (GPAT) (EC: 2.4.2.14)
atggatagcatacgtgataaatgtggagtctttgctgtatctagccctaaagaagtaaat
attcaactggtagtagagggaattagactacttcagcataggggtcaagaatctgcagga
atcgcatatgctgagaatggggaaatattgacgattaagggatctggacttgtagacgaa
gtatttaaggaaaatcttaataaatttataaaaaatggaataggtcatgtaagatattca
acaagtggaaaaagctcaattgaagaagcacagcctttaggcgactcaaaaatagtcgtg
gcgttcaatgggacaataagcaactattaccagtttggatcatttagggtagatactgaa
tttatatataagttctttaagcaaaaattggcctttcgctctatccctgatactgtaaag
gaatttatgaaagttgtcgatggtggatactctgtagctattcttttgaatgatgaagag
attgtagtatttagagatcctaaaggatttcatccagttgtattaggatttttagaagga
tcattaatagtttcctcggaggattccgttattagacaactaggtgggagcgttttgaaa
catattctaccaagcgaaatgataattatgaaaaatggcaaaatattatatgacaaagta
atctatgaggagaaaaattacgctacttgttccttcgaatatatatactttgcaagacca
gattccaatatagatgggcattcagtttacttagctaggataaggttaggtgaattatta
gcagaaaaacacccagctaacggagatattgtagttccagtgccggactcatcaaggcca
atagcgctgggcttttctagaaaaagtcacatacctttagaggaacctctagttagaaca
atttcctctgtaaggtccttcataatgccaactcaagataagagaaatgaggtattagaa
gagaaatttggagtggttgcagatgcagtaagggggaaaagaatagttttaatagacgac
tcaatagttaggggaaatactatgaagagaataataactatgttacgtaaagccggcgcc
aaagaaattcatgtacgtataggatcacctatgataaaatacccttgttatatgggaata
gactttcctaaaagagaagagttgattgcgcataataaatctgaaaaagaaataggaaat
gagctgaacgctgattctattgaatttctaagtgtcgaagagatgttacaaggaataggt
agaagagacttatgcaatgcatgcttttctgggatttatcctctcaaatttaactataat
tctacagagttagaaagaatatttgggaag
>SSO0633 (purF-2) Amidophosphoribosyltransferase (glutamine phosphoribosylpyrophosphate amidotransferase) (ATase) (GPAT) (EC: 2.4.2.14)
gtgatattaatggctggaatactaggtatattagcgttcgatgatgtatggaatgtatct
agatttttatattatggtctaataggcttgcaacatagaggatattctaaaagtggaata
gcaatattgaacaagcagaggaatatatttactaaactagagaacgtagcgcctgaggat
ttagaaattaaagacttgaatggatgggctggaataggttatgctggaatcagaaatagt
tatcccataacaatagataatggtgctatagtcgttgatgggatgatagatgataacaat
gttcttaaccatgtcataagagagccagaaaatgcaatagatgatattaaaaagccgatc
tcgttcatagccattagtaaagacggccagttaatagcctatagagacgaactaggactt
aagccgttaagcataggtggatttggattcgatttagcagttatttcctccgaaccaacg
tcaatgtttgtaataggggctgagttcaaaagggaaattaatccgggagagttagtgatc
gttgacaaatatcatattgaatccaaacaggtgagaatacctagaaaatcgtattgtact
atagagtacgtataccaagctagaatagacagtatgatcaacgaaagagaaatctatgac
ctaagagtgaaaataggggaagaattagccttagaatatccaataaatgctgattcagta
ataggagttccagaaaccgcattacctttcgcaataggctattccaagaaattaaatata
ccattagacttaggctttacgaggacagggagcccaataaggacaatgttatcttctgat
gctttcctaaaaatagttggggtccaacttaagctaaacccaataaaaagtgcagtaaaa
ggaaagagaataattctaatagatgattctatggtcaccggaactacccttaaaaacact
atatttaacttgagaaaattgggcgcaaaggaaatccacgtgctgataggaagccctaaa
ttagtctcacaatgtccgtacggagttgaagtccccgacgaaaaagaattgatctcagct
aatcttaacgacgaaactatagcgagggttttaggtgcagactctatacactggttaagc
atagaaggattgttcaaagccattgggcatagggatctctgcttaggatgtatgactaaa
aaatatccatgg
>SSO0635 (purD) Phosphoribosylamine--glycine ligase (GAR synthetase) (GARS) (EC: 6.3.4.13)
atggtgagaaaaatgaaagtattactcgttggagatggagctagagaaaacgttctagcc
tattcgttggcaagatcatctaaaggttacaagatttacgcactatcgtcatatataaat
cccgggattaattcaatagtgaaaaccactggtgcagagtattttataggtaacgtaaac
tccccagaagttattaaggaggtaattaagaaagtaaacccagatttaggcgtaattgga
ccagaagatcccttattcaacggaattgcggacatttttagaaaagagggaatatcggta
ttcggggctagcaaaaagtgtgcaaggatagaggagtctaaggcatgggcaagagagtta
atgtggaaacattctattccaggaagattaagatataaggtattttacacaatagaagat
actgcaaagttcatattagaatatggcggatcagtcgcaataaaacctgctgggcaagct
ggaggaaaaggggttaaggtaatagctgatctagaggcttatttaacccatgataagaga
gaggcactgacaaaaagcgtgaatgaaatagggagtctatacaataaggaaggtgagccg
agaattataatagaggagaaagttgatggaccagaatacacacttcatgttttaagtgat
gggaaaacaactatctccttacctttggctcaagattataagaacgcgtatcaagacgga
ataggtccagagactggaggaatgggatcaatttctggacctaacgaattgcttccattt
atcagcaatgaagagtatcaaacaacttatgatatagttaaaaggactatggatgcgata
tacaaggagactggagagagatacgtaggagttattgcaggacaaatgatgttaactgaa
ctttggggacctacagtaattgagtattattcaagatttggtgatccagaagcttccgcc
ataattccaagattagaatctgattttggagagacaattgagctcacagctactggacat
ttgaataaagctagtataaaaataaacgagaaaccttctatagtcagagctgttgctaca
ttaggataccctatctcaaaacaaatggcatctgggcataagattgtagtagatttagaa
aagatgaaagagcgcggatgcgtggtattttttggatctgtagcattagagggaatgcaa
cttataactaaaggctctagagctttagaaatagttgcaataggagatttcgaagaagct
gctgagaacttagacagatgtatgcaatatattagcagtgatactaaattgatatatagg
actgatattgggaggacagttaaatctcaaattgaaaaggctgaaatcataagatattct
tataaaaatagagaaaaaagagggattcttggagtttctgcagattggtctcctaatggt
gggttatgg
>SSO0636 (purM) Phosphoribosylformylglycinamidine cyclo-ligase (AIR synthetase) (AIRS) (EC: 6.3.3.1)
atggtgagtgaggagtataaaaaagcaggagttgatttagaaaaattacgtaattatcat
aatatgatttctcaaataatctcatctacttataaaaatactattataggagcgggacat
tattctggagtaataaaaataggtagtcttaacatagcgatgcatactgatggcgtagga
acaaagacttttctagcattgcaaactagaataataaagcccgtaggaatagactgcgtt
gccatgaatgttaatgatctgatatgtgttggagcaaaaccagttgccttagtggattat
attgcgttagaaaggccgatggataatgtggtaaatgagatcattgatggtattgttcag
ggtgctaaagaggctgatgttgaggttattggtggagagactgctattatgcctgatgtg
attagaggatttgatctttcttgtactgcaataggggttgtagataaactgaaaacgggc
gctgaaataaggccaggagattatgtattgggactagaaagcagtggtatacatgctaac
ggttattccctagttagaaaattaatagaagaaggtaagctttcgctagatgaatataaa
aatgaattgttaaaaccaactaaaatttatgtcaaaccaattttggaagttatgaatatg
ataaagggagcggctcacgtaactggaggtgcatttagtaagcttaaaagacttactagt
tataagattgtcttaaatatgccagatccaccacagatttttaagactatcgaaaaagca
ggggtcgctcacgaggagatgtataaagttttcaatatgggtataggaattgtcttattt
gtttcagaagaacttatgaaggaagtaaaaacaaaactagaaggatatggaactgtatat
gaacttggcagagtatataatggaaatggaatcactataaagacttataagaacgaaatt
ctcagatta
>SSO0637 Hypothetical protein
atgaaacaaactgatataaagtctttagtaaattatgtagctttaaagatactaggtgga
agcgactatctaatagaagcattagaagagtacttagtgaaaggagaaggacctgctaca
gtagcctataaatataatatttcaaaacatcaactccgtggctatgcccagaggattatc
gaaaaaagcggaagtgaaggaaaggctaagaaactcgtaccaatacttaaagctatctca
gagggaatcacaccaatagtcaaaaaggaaaatgacggatcatatgagtgttcactgtgt
aatattatcatagctaaagaagatagtgaagagcatattagaaagtaccacaaagagatt
ctcaatgaaaatataaatattatgatgcaaagactagagaaaataaagaaggatctgcaa
caaaataaagccgtaatatttacttctgcaagt
>SSO0638 (argG) Argininosuccinate synthetase (EC: 6.3.4.5)
atgatatcaattgtttttaagcttcttctttaccctttttgtgaaatgaaaatagtcctt
gcatactctggtggacttgatactacagtatcgattagatggctaaaggaaacctttaag
gctgagattataacagttactgtagatgttggtcaaaaggacgattttaagaaaatagaa
gaaagagcgtatatagccggcgcctcaaagcattatacaatagacgctgttaggcaattt
gccaacaattacatagcatatgcgataaaattaaatggattatatgaaggagtctatccg
ttgtcaacggcattggcaagaccattaatagcagaaaaagtagttgaagttgcaaaaaag
gaaggagctgaagccgtagctcacggttctacatctaagggaaatgatcaagtgagattt
gaccttgcagttaaggcattataccctgacgttaagataatagcaccagctagaatatgg
aatatgactagagaagacgaaataaaatacgctaaagagaaaggaatacctatcaaggtt
gaaagtgacaaatacagcatagatgagaatctttggggaagaagtatagaaggagacata
atctctgatccttctcttgaagtcccagaagatgcctttgaatggactaaacagatctac
aataaaaaggaaatagtctctatagaatttagtaatggagttcctacagctgtgaacgga
gaaaaaatggaattaaataagttagtagattttctaaatttaaaattcggaagccatgga
tttggaagggtagaacatatagaaaatagagttgttggatttaagtctagagaggtatat
gaagtaccagctgctctaggtctaatttacgctcatattgacttagaaaaaactatctat
actccaatggaattaagattcaaaagacacatagatcagttatggtctgatctagtatat
caaggattatggtttgagccactaagagagacattacataaagttgctgatgaaatgaat
aaatggattagcggagaagcgaaggttgaagttagtaatggttcgttcagaatagtaggt
agagaatcagaatattctccatattctgaaaaaattgctagttataacaaaggatggtat
ccaagcgacgaaatggctaggggatttatagagatttggggaatgcactcactaatagcg
agaagagtaaggggactt
>SSO0639 (argH) Argininosuccinate lyase (EC: 4.3.2.1)
ttggggaatgcactcactaatagcgagaagagtaaggggactttgatgttatatagaaaa
tggggatctgaaaaagacgaagtagttaactatacctcatccgtggatagcgatagagag
attattgaagaagtgaaattaactatgaaggcacacgtaattagtctttatttgactgga
taccttgggaaggaaaccgctagaaagatccttgttgcattaaacgagtttaaagaaatt
ggccaaggatatgaggatattcatgaagcattagaggatttcttaataaagaaagtaggg
gaggatgccggatggatagggttaggtaggagtagaaatgatcacgttgccacagcttta
agactgagattaagaaataagctaatagaacttttaactgacattaatagcttgagaaaa
atactattggataaagcaaaagagcatataacaacaatatttccctcatatacacattta
caattagcacaacccacaacatttgcccactacctaacttacattgaagaggagttagct
tcgaggtgggaaataatattttccacgttaaaacaagttaataaatcgccattaggctct
ggagcaatagtagggacaaacgttaagattgatagagaaaaagaagccgaactattagga
tttgacagtataatatacaatacattatcagctacttcatcgagagcggatattctcagc
acgatctcggaattaactgtattaatggtagtactaagcagaatagctgaggatttaatt
ttcttttcgtcaaataaattaattaaattaccagactctcatgttagcactagcagtttg
atgccccaaaagagaaatccagttacaatggagatactacgagcaaaggcagcggagtct
ataggtatgctaactagtttgctttccatttacaaaggtttacctactggatacaatctt
gatttacaagagatgaataaatattattggcttgtaataaactatactaaatcttcaata
ggagttttaagctcactctttagtcaaatacaagtaaataaaataaacattgatgaatct
agtttggccactgatgacgctgaattactttccataagtaagaaagtaccttatagatcg
acctactttgagatagctaaaaaagttagggaaggttcttataagtcaactttaaaaata
gaggattctattaatatgaaggcagtaatcgggtctcctaattttgatttaatggctaat
ttgataaaaattagagaaactaaattgaaagaagatgaaaaggaaatcgaggagtataag
ttaaaaataatctccaaattaggagaattacaagtgatcgaaaatgaaattggagaa
>SSO0640 (carA) Carbamoyl-phosphate synthase, small subunit (EC: 6.3.5.5)
atgaaattggagaataagaagggttatttatatctagaggacggaacgtttattgaagga
tatagttttggagctaaaggaatcaaggtaggagaggtagtgtttacaacttctatgaat
ggatacgtggagagtttaacagatccttcatataagggtcaaatactaattattacgcat
ccattagttggaaattatggtgtacccgaaaagaagtatgaacaaggtattctaaccaac
ttcgagtcagaaagaatacaagttgaaggcttaatagtagctgagcatacatatcctagt
aaatggaactcagcgctgacattagatgagtggctgaaatcagagaacgtaccaggagtt
tttgatgtcgatacgagaatgattgtaaaaaagattagaacctatggcacgatgatggga
attatagcttctgaattagaaatagacgatcctagaaaatatttagaaaaaaagtacgat
gaaatagatttcacacaatttacatcacccaagtcaccaatctttcatccaaatactgga
gatatgatcgtagtagtggattgtggaataaaacatggaattttgtacggactttataag
agaggattctcaattgttagagtcccttgcagttttagtgctagtaagataattgagtat
aatcctaagggaattgtatttagtaatggtccaggtaatcccaatttgctagaaaatcaa
atcaagacgttctctgaattagtggagtataagattccaatcttaggtatttgcttaggg
catcaaatagcaactctagcactgggaggtaaaattaagaaaatgaaattcggacatagg
gcaataaacaaaccagtaattgaaagcaattcaaataaatgctatatatccactcataat
catggatatggtataatatctaaaaacgatatcccgcctaatactaaaatttggttctat
aatccagacgattatacaatagaaggcttaatccatgaaaaattaccaattatcactaca
caatttcatcctgaagctagaccaggtccttgggatacaacttgggtatttgataaattt
agaactatggtgactggaaaa
>SSO0641 (carB) Carbamoyl-phosphate synthase large subunit (EC: 6.3.5.5)
atgagagaaactccaaaaaaggttctggttattggatctggacctataaaaatagctgaa
gctgcagagtttgattacagtggaagtcaagcgttaaaggcattaaaagaggaaggaata
gagacagtattagtaaattctaacgtggcaacagtacagactagcaagaaatttgctgat
aaattatacatgttaccagtagtctggtgggctgtagagaaggttatagagaaggagaga
ccagatggtataatgatagggtttggaggacaaactgcgttgaatgttggagtagacttg
cataaaaagggagtattacagaaatataatgtcaaagtattaggaacgcaaattgatgga
atagagaaagcactgagcagagaaaagtttagagaaacaatgatagagaacaatttacca
gtacccccaagtttatctgcaaggagtgaagaagaggcgataaagaacgcaaaaatcgtg
ggatatccagtaatggtgagagtaagctttaatctaggcggaagaggctctatggtagcg
tggactgaagaagacttgaagaaaaatattaggagagcgttatcccaaagttacatagga
gaagttctgcttgagaaatatctttaccattggatagaattagaatatgaggtaatgaga
gacaaaaagggcaattctgctgtaatagcatgtattgaaaatctagatccgatgggagtc
cacactggagagtcaacagtagttgctccttgccagactttagataatcttgaatatcaa
aatatgagaacctatacaatagaagttgcaagatcaattaatctaatcggggagtgcaat
gtacaatttgcgcttaaccctagaggctacgaatattacattatagaaactaacccgaga
atgtctagatcaagtgctttagctagtaaggctactggttatccactagcatatgtttct
gctaaactagcactaggatacgaactccatgaagttataaataaagtctctggaaggact
tgtgcatgttttgaaccaagtttagactatatagtaactaaaatcccaagatgggatcta
agcaagtttgagaacgtcgatcaatcgttagcaactgagatgatgagcgtgggagaggtc
atgagtataggaagatcgtttgaggagagtttgcagaaagctataaggatgctagatatt
ggtgaacctggggtcgtaggtggaaaggtatatgagtccaatatgagtaaagaagaagcg
ctaaagtacctcaaagaaagaagaccatactggttcttatacgcagctaaagccttcaaa
gagggagcaacaattaatgaagtatatgaggttactggaattaacgagttctttttaaat
aaaatcaaaggattagtagatttctacgaaactctcagaaaattgaaagagatcgataag
gaaacattaaaactcgctaagaaattgggatttagcgatgagcagatatctaaagcgcta
aataagtctactgaatacgtgagaaaaattagatacgaaaccaacacaataccagtggta
aagcttatagacacgttagctggcgaatggcctgcagttactaattacatgtatttaaca
tataatggtacggaagatgatatagaattctcacaggggaacaaattactaataattggt
gcaggaggttttagaataggagtttcagttgagtttgattggagtgttgtatctctaatg
gaagcaggatcaaagtactttgatgaagtagcagtacttaattataatccggaaactgtc
tcaactgattgggatattgcgaggaagctttattttgacgaaattagcgtggaaagagta
ttggatttaattaagaaggagaagtttagatatgttgccacgttttcaggtggacaaata
ggcaattcaatagctaaagagttggaggaaaatggagtaaggttattaggaacatcgggt
agcagtgtagatatcgcagaaaatagggaaaagttctcaaaactattagataagttaggt
atttcgcagccggattggatatctgcaacttcattaggcgaaattaagaagtttgccaat
gaagtaggatttccagttcttgtaagacctagttatgttctaagtggatcgtcaatgaaa
atagcttattcagaagaggagctttatgaatatgtaagaagagctactgagatttctcct
aaatatccagtagtgatttcaaagtacatcgagaacgctatagaagctgagattgatgga
gtttcagatggaaataaggtattaggaataacattagagcatatagaagaggctggagtc
catagcggagatgcaaccatgtcaattccctttagaaaattgtctgaaaataatgtgaat
agaatgagagaaaatgtgttaaatatagctagagaactgaatattaaagggccattcaac
gtacaatttgtggtaaaagaaaatactccatatataatcgaattaaatcttagagcaagt
agatcaatgccatttagtagcaaagcaaagggtataaatctaataaatgagtcaatgaaa
gcgatatttgatggtctagatttctccgaggattattatgaaccaccatccaagtactgg
gcggtgaagagtgctcaattctcttggtctcaattaagaggagcttacccattcttggga
ccagaaatgaaaagtactggagaggctgcatcatttggagtgacattttatgacgcatta
ctaaagagttggctttcgtctatgcctaataggataccaaataaaaatggaatagcgtta
gtttatgggaataaaaatttggattacttaaaggatactgcagataatttaactaggttt
ggactaacggtctatagtatatctgagcttccattacaagatatagaaacaatagacaaa
atgaaggcagaggagctggtaagagccaagaaggtagagataatagtaacggatggttat
ctaaagaaatttgattataacattagaagaacagctgttgattataatattccgataatt
cttaacggtagattaggttatgaggtgagtaaggctttcctaaattatgactcacttact
ttttttgaaatatctgagtatggaggaggaata
>SSO0645 (rimK-2) Ribosomal protein S6 modification protein
ttgaagatagccttagtagtagatataattagacaagaggagaagttaataataaaggca
ttaaatgaaagacaaatagactatgacgtaattaacgtaggccaagaacctatcccattc
aataaagcactaagcaagtacgatgttggtataatcagaccagtaagtatgtatagggct
ctttactcatctgcgatactagaggccgccggtgtacatacgataaattcaacagacgct
attggcacttgcggagataagatacttacatattctaaactatttaaacatggaattcca
ataccggactcaataatagcagcatctccagatgcagctatgaaagcatatgagcaaatg
ggattcccactgatagataaaccgcctatcggaagttggggaaggatggtatctttgata
agagatgtatatgagggaaagacaattatagagcatagagaaatgcttaataattcagcg
ctaaaagtacatattattcaagaatatatcaaatacaaagaaagagatataagatgtata
gtaataggtgatgagctattgggatgctatgcaagaaatattccacctaatgagtggaga
gcaaatgtagcattgggaggaaatcctacacctattcagttagatgataacataagagaa
ttagctgtaaagtctgtaaagttagtaaaaggcgaattcgtatctatagacatattagag
cacaaatcaaaaggatatgttataaatgagctaaatgatgttccagaatttaaaggattt
atgctagctactggtatcaatgttgccgaaaagctagtagatcacatcgttaagacctac
cgagct
>SSO0646 Conserved hypothetical protein
atgcttgttgagaaaattaaaggttatcttaattcaattagtggtgtacttcaagaaaga
tttgagaatagagaaagagtattgatgctagctagagaattaataagatattgcggggag
acaatttcattatctcacaagggtaaaaaagaagaggcattaaaaaagtatcagattgca
atttctaaagtatctgaaattcaaaagattatagatagtttcccagaacttttatatggc
gatgtaggaactgcgtatcaagaactagctgaggcttctatagtgatttcattgtacttt
gatgttgagttaaagctctctaaggaactcggtattccagacatatactatataagtgga
atagcagacgcgataggtgagatgagaagaagagtattggagttacttaagaaaaataaa
atagatgaagccgaaaatacatataatataatggaagagttatatgaacttctatggagt
ttcgagtaccctaaatccttggtccctggactaagacaaaagattgataccataagaaga
ctattagaggagactaatcacgatatttttctggctaagctcggtaggtct
>SSO0647 (hdb-1) 3-hydroxyacyl-CoA dehydrogenase (EC: 1.1.1.157)
atgtttatacatatgaaatcaattaataaggtagccgtaataggagccggggtaataggc
gtagggtggaccactcttttactagcgaaaggttataaagtaaatttgtatacggaaaag
aaagaaaccttagaaaaagctttagcaaaagtatcagcttatttagttaatctgaaaaat
cttggaatgataaatgaagaaccagaatcctacataacaaatctaactggaatcacgaaa
attgatgacgcaatccataatgtggattttgtaatagaagctataattgaggattatact
gctaagaagaatttattcaaactacttgatactcaattgcctcaagacataataattgcg
agtagcacttctggtttattaatgactgaaatccaaaaagctatgataagacatccagaa
agaggagtaattgctcatccgtggaatcccccacatctattgcctttagttgaaatagta
ccgggcgagaaaacgtcaaaggagacagtagatttgactagagaatttatggaaaagtta
gatagggtagtagtgctactgaggaaggaagtccccgggtttataggaaatagattggcc
ttcgctttatttagagaagcggtgaatttagttgatgaaggagtagccacagttgaagat
atagataaagtaatgacagctgccataggtctaagatgggcatttatggggccattctta
acttatcatttaggtggaggtgaaggaggaatcgaatacttctttagtaaaggattcgga
tatggtgcaaatgaatggatgcacactttggcaaagtgggacaaattcccatatactgcg
gtcaaaaaggtattggagcaaatgaaagaatacgaatttataaaaggaaagagctttcaa
gatctatctagatggagagacgagaagctagtaacaatttataaggcagtatataaggaa
aaatgtaattca
>SSO0648 Hypothetical protein
atggaagttttaaaaagagttgacaaacaagatgtattaaaaggagaagtagaagaatta
gtgaaacaaattgaacaagatgatctaaaagtagtaacttttatggagtacactaatccc
cctgagaaggttaaaccaaaattaataaaatttgagaaagtgttgcctctattagagaga
attgcagagtctgggaagatacagaatggtgtagcgaaaataatgttcttctccccttca
acttgcagaaataggggactaacgcctacgatgatggcagggttccagttaattaaacct
ggaattgcgactaaaccccattctcataatatggcgtcaatatatcttgtttttaggggt
cgaggatactcggttatcggaaaggagaagatagagtggaaggcaggtgatgttttcgta
gtgcccgcaaatgaaattcattaccatgtaaatactggagacgatgattgtattctattt
gatgtaacggattctggtttacttgagagtttaggaatcttagaatttagagag
>SSO0649 Conserved hypothetical protein
gtggcaaataagttatatgaagcgttaaaatacgtggtaaaatatgaattaaaatcttcg
attagacgctatatagtgttaggtgcattcgatggtattttattgaccttatcgattttg
ttggcaggcgtgatctcacatattggcctaaccagtatttccttatcgatatatagtggg
ataatagctactgcaatttcatccacatggaatgcgctagtagtagagctgggggagaaa
aaaactgaattagagaaaatagaaaagcaagttctaaagagtctaaaaggtactatatat
gactatagtgcaaggatagctgcagccttagctgctattgcccatggcatttctccattc
ttaggcttgctagtactttacgcatatgaatattctcatagtactatgctatccttaggt
gtagggatatcaagtttagcagttttagggttgctttatggtgagggaattaaagctaag
attagcacaatggttcagctaatagtagcgggaattattactgctttaattacactgcta
gttataaaa
>SSO0650 Hypothetical protein
gtgcttttgatgaatagacagattctcttagcgttagcactactagtaatagtagtaatg
gccataggagtttacgagggaaataaatatagaacagaaattagtacagtagcgttaggt
agtcagcagacagatggaatgtatatgttgaaggttaacgtgataatgaattatggacca
tttggtggaaagtctcctctatccaatgcggtgatttgggtctataaatataatggaact
acatattcattctatacttataatttcactaactcacaagggatagcatcttttaattta
ccagcaggacagtataagatcttggtaacacagttacgtttaacctatatagttaactta
aatcaaaacgaagaagttataattaactatgcctatttaaacagtgga
>SSO0651 Conserved hypothetical protein
ttgatgagcataaaaatagatgttgtaagaatagatataccagaaggaactaatgtaatt
atagggcagtctcattttattaagacagttgaagacttgtatgagaccttatcgtcaagt
agcccgaatctaaagttcggcatagcattcaacgaagctagcagtaaaagacttataagg
tatgatggaaacgatcaagagctgattaagcttgcaattgagaacgcaaagaaaataggc
gcaggccacgtttttgtgatctacctaaagaacggttatccaattaatgtcttgaataga
ataaaaaacgtagaggaagttgttagaatattcgtagctacagctaacccattacaagtt
atagtagctgaaacagatcaaggaagaggtgtaattggtgtagtagatgggtacgcccca
ttaggtgttgagtccgaggctgatatacaagagaggaaggagttcttgaggaagatcgga
tataagaga
>SSO0652 Hypothetical protein
atgttgggtagggttttattattctataagaagggaatatttaacgatgatctaaagaaa
tttctaaggagtaaaaacatcaatgtaatagacgttaggatagggaaatatgttgaagta
gatataatggacgatcctagaaaggttatatccttaattggcgaaccattatttatggtt
accgagatcagtggtacatttaaaccgttattttatgaaatgagattttgggaatgtcat
gagattatagaggaaaaatggagagaggtaaaaaataaggacgacaaaaaatttttgcaa
gcaataattttgctctgtgcctctttaattaagtatctaaaaggggaaattgaggtttct
gatatgttgatggaaaaagccttatctcttatatccgatcttcctcaagaactccttcct
ctcttgtatatcagcctcggactcaacacc
>SSO0653 Conserved hypothetical protein
atgactaaagaagcagtactgtataaaaaagaggatggtagaattcgttgtttggcttgt
gctagaaaatgtctaataggagagggacaagtagggttttgtggtgtgagatcagttaga
aatggaaaactataccttgatgtttatgggaaaatagcagctgctcatatagaccctatt
gagaagaaacctctagtacactttaacccaggttcaaaggttttctcattttcaacatat
ggatgtaattggatgtgtatgtattgtcaaaattatgatataagccaaaggcgtaaagct
gagggagtagaactatcaccagaagagattgttgaactggcaatggggtacgatgtggat
ggaatgacatatacttataatgaaccggcaatattctctgaatttgcacatgacgttggt
attgtagcaaaaaggtatggcctatttaatactatggtatcaaatgggtattggacgcca
aatctcgtggactatgtaaaggactttctggatgctgttacaatagactttaagggaaat
ggggaacagaagtttttaagaagatatactggcgctacatctgcggagcccattatcgag
actgcgagtgagttatcgaaaaaagggattcatgtggaaattacagacttaataataccg
caaataggcgatgatctacaagcagcaaaacaacttttaactaaactgtacgatcaacta
ggcgcagatataccgattcatttcttaagatttcaccctgattataaattaaattatata
ccgtggactccagttgagacactggagaggcattataaattagcaaaggaactaggtttc
aaatttgtttatgtaggaaatgtccctggacatccttatgagaatacatattgcccaaac
tgcggtaatttagtaataagaagatatagcttcgatattttggaatggcacctcactgag
gatatgaggtgtaagttctgtggatataagttacctataagaggaaagttatctagacac
gcattcaaggaaagattcgagccagtatttatt
>SSO0654 (paaF-2) Enoyl CoA hydratase (EC: 4.2.1.17)
atggagacaatagttacaaaagaagaacccccaatagaatggatagtattaaatagacca
gacaaattaaattcaattaactcgattatgataagggaaattggagatattttaaggcaa
attgtagacaatgataaaattaaggttgttatatttacgggttctggaaaggccttttca
gctggagctgatatttctcagtttaaagatttagacccagttaaagcttgggaatttgct
ataaagggaagagaactaatggattatattgaaaggtatcctaagcctaccatagccatg
ataaatggatatgcgctaggtggaggtttagagctagcattgagttgtgaccttagaatt
gcttcccaaattgcagaactaggattaccagaaattaatttgggaatttatcccggattc
ggcggtactcagagattggttaggctaattggaaaagggagagcgatggaaattatcatg
ttaggtgatataataaaagccgattatgcggagagaataggccttgtaaatagagttgta
gaaccttcatctcttgaaaaagaggtaagggaattggctttgaaacttgccgaaaagcca
caaatagctataagattaataaagactgtagtaaattatggtaacgacgctccaatactg
agtggtttaacgttagaaagtttaggatggggtatcgcatttgcaacggaggaagagaag
aaaagagttaatgagttcctttcaaggaggtctaaa
>SSO0655 Hypothetical protein
gtgactaggagagatataataatatcaataatatcagcactgccaccgataataggaact
actattacatcgtttattatgagtagaagatatggagatctaaaagaagtaattaagtat
gtaataataggcttaccagttaccttagctattacctattacttgattctaaacatattt
ccaaaatacgtagattacttaatagcaattcccgcgcttttaccattaccaatctcattt
ctcttaactagaaataacatttcaatcaactatagtgaagactatattgagataaagttt
aaaataccaattaatatgacctcccatgatccacatgaattgtttaattatgtatttaat
aaggcattaggtaaaattagaaacccttattaccattataaattgtctgcagctgcaaac
tgctctggactaaaggtatcttatcaaaatgaggataagttagtaataagaagaaaatgc
ggagatatagatattagaattataatctcctctaagaaaatagctgatatggtaatagat
atctcatat
>SSO0656 Cytochrome C oxidase folding protein
ttgatgagcttacagcagaaaataaaggcttatttaaaattaggtaaacttggtgtggta
agtcttcttgatttggcagcaattgctggggcttttctggcgtacaaacacggcatttca
cttttaccaatcattcctatgcttattggaggtacattagcgtcaatgggtgcaatgata
attaatagtggaatagaaataaatagagacaaagtaatgtctagaacatcaaatagacct
acagtagttggctatgtcagtaggaaagaagttatagtagtgggctcacttctagcagtt
ttaggtacagcattaggttttatagataacgctttaactgctttctttatagcactaggg
gtaataatatatgtattcgtatatacgatcctattgaaacctaggacatggctaaacata
gtaataggtggatttgctggtagtgctgcagcttgggctggttatacgtctttaactaat
tctttaactttagaagcatttcttttaggttttctaatatttatgtggactccaggccat
ttctggtcgttggcactaaaatatagagaggattacattaacgctcattatccaatgtta
cctgctgtggtcggtataactacttctgcaagggcaatagcaacttctaatgccttaatg
attcctattgtacttttgatgggatactacattagccttatagcgcttatagtgttttct
gttttaagtgcattattattgtttctttcttataggttaatacttaatccaaccaaggaa
gaagcaatgaaatccttcatattttcaaatatttacctaatgttaatacttttaagtata
ataataattaaattaata
>SSO0657 (thrA/hom) Homoserine dehydrogenase (EC: 1.1.1.3)
atgaagttacttttaattggatatggtaatgttggaaaggcatttagaaggctattacat
gaaaagaaagataactatccaatattgcaaggtgttgagattgcaggaataataactagg
caaggactaatggtcggagataaggagaatttttctccagataagcaattgactgtctta
gaggcgattgattatataaaccctgatgtaatagtcgatatgtcagtacctaattataaa
gacggtgagccatctgttagtgcttatataaaggcattatcaagaaaaattcacgtaata
acagtcaataaagcaccgctagccctaaagtttagagagatatttgaagttgctgagaaa
actggtgccaaaattggatttcaaggaactgtaatgagtggtactccttctattaatctt
tttaggattcaaccagtggctgaagtctctaggattaggggaattcttaatggtactaca
aattacattttaaccagaatttatgaaggattaagttttaatgaagctttgaaagaggca
aaagagaaaggctatgcagaggaagacccaactttagatcttaatggattcgatgcagca
gcaaaactgacaattttatccaactttattatgaacagaagtctaaaattaggtgatttc
aaattcaagggaataactgagattactaatgaggagattagaagggctaaaagcgaaggt
aagaaaataaaactaatagcctatgcagataactatgtagttcaagtttctcctcaaatt
atagggcctcaagatcccttatactatatagatggagttgaaaatgcactagaaattcaa
aatgaaatacagaggattatcattagaggtccaggtgcaggtccgataaatgctgcatac
ggtgccctttcagatttagtgttattattggaaggatgttta
>SSO0658 Conserved hypothetical protein
atgaaaagacttagtatttctgaggatgttagaaggctaggggtttttgtagcaatgact
gaagtgagtaatgtagacgctaaaagacctctagatacgttggatgatataattagaaat
cttgaagaaaagtatgcttctcaagatgtagagtccttaagaaatgacccagtagttagg
gcttatagggacttctattggaggatagggatagatccaactaaaactaggcctagtggt
gaggctcttagaaggagattagctagagggaataaacttcctagaattaatatagttgtt
gacataggaaacatagtgagtgccgaaactttagttcccataggtttatatgatagggat
aagatcgtaggtgatttgcatttggtcatgtctaagggtaatgaagagtttttagggtta
ggtaaaaaaaaggaaaaactagacaagggaataccaatactagttgatgatgaaggtaag
gttcttcacatatatcctcatagagattcagtcttgactagtataaccttaaacgttaaa
aacgttgttataattggagctggagtccctaatattgatgaaaatctggtcaagtatgca
gtagatcgtgtagcagatttattagaaaaagtgtgtaatggaaagagagaatataatact
atggtgattaga
>SSO0659 Conserved hypothetical protein
atgagcgctgaaaagataagtatatctttgccaaaagaactttatagggaactagaggat
ttcattatacgaaaaggtatacccgatagatccaagatctttcagatagctttgaggaat
tatctagatgagaatagggacggcaatgagatcatctatggtattataaatctggtatat
gatcatgaggaagcatctgaagcgttaactgaaattcagcatgaatataacgatagtata
atttctacattgcacttacacgttagtgaaaagatatgtatagaggccatagctgtaaag
ggagagaaaaggaagcttgttgagttaaacaataaattaggccaaattaggggaatcctt
aaagccaggctattaatatcttttccttatgaaaagact
>SSO0660 (tldD) Zn-dependent protease, tldD protein homolog, putative
atgtttaaatacattaaaaaagctgaagagctaggagccagttttgccgatattagatac
gaaagagtaatagcaaatgaagtaaccattacagaggatagaaaatacgtaagtcacgga
gtagatgaaggttattcgattagagtaatttataatagaaattggggatttaaagcaact
gataagattactgaaaacgagatagaggataccataaatcacatatatggtgacgaaaga
gttaacatcgtatatttgccttcaaaacatgatactataaaaattggtaaggatattaac
aaaaatgaagaggaaaaaatcaacgatttgcacaaagtcgcgagccaagttaataccctt
catcctagtataaaatcatattccataaaatattatgatgaaatttttcataaggaatat
tatagttcagaggatagagaaataatagctgatgggagctcctctagtttatctatttta
gttgttgcaagggaaggagatgtaactgttgaggtgtcagagatattaagcactcaaatg
ggttatatatttgacgtttttgatataaatcaagtattagctaatcttcagaagagaatc
ataaatcaattaaagggaagtacacctaaagctggtgagtatccagtaattttagctcca
gaggtagtagggatttttacacatgaggctatagggcatttgagtgaggctgatgtaaca
ttaaacggatcgctatataaattaaggaacaagagaataggagatgagttcttaaacatc
tctgaccttcccgctatggatcatcctcagtctagtctcgtatattatgacgatgaagga
gttgagggaagagaggtaaaaattatcgagaatggtattctaaaagagtttatgactgat
agatactattcagcatatctggggcaacctcctactggaaacgctagggcacaaagctat
agaaacttctcattaatcagaatgagaaacacttacatgaagcctggggacgctagttta
aatgaattatttgaaggaataaaggaaggatattatttggtttcacctataggtggtgaa
acgagtagtaatggtacgtttcagtttgcaattcaagaaggttatagagtagaaaacagc
gagataaaagaaccattaagaaatattgggatttctggcaatacaataagtactctaaac
gcgattgagatgatttctaaggattttggaatgtcttcaggcttttgtgaaaagaatggg
caaacagttcaagttagtaatggaggtccacatattaaagtgaaaaagcttaaggtggga
ggctatgta
>SSO0661 (tldE) Zn-dependent protease, tldE protein homolog, putative
atgtatgaaagactaatctcaagagctaaagctatggggatctcgttagaaattttttct
gttaaaatgagagaatatactatagctaaagataagttctacgttccaattattgtggaa
gagacaggctatgggataaggctaattgatgagaaatataggatcggttatatatacact
aaaaaacttaacgataacgtgttagaagaagccttaaaaatagccaaattgggagaatcg
gataaggctaatatattgccatcgaaacaaccagtaaaaagaattaatgagaatcaaata
aatgaggatgtagtacaagatacaattaaagatctaatagaattagaggaaaaggtaaat
cttacttcggcttcagcatctgcaataaactatgaggtttctatattcaatactgaagga
gttgaggtgagtgaaaaacgaggagtactttcagtacaagcttcagctaatgatggcaat
aattccccagaaatttatgaatatctaataaaaagagattcaaagatatcgcttgaaaaa
ttaaaagcgtcaataattgagaaggtaaaaataatgaagaaaaaagagagaatagatccc
aaaggatatgatgtaacttttacacaaaaggcattagactcgttattttcatcattattc
ccatcgctgttttctgctagaaacttctataaggaaactagtccatttaagttaggagaa
ctagtaaatgagaatctagaaataattgatgatcctttgaaccaatcattaccttttagt
agatcttttgacgatgagggaaatccatcaagagtgagtaaagttatagaaagtggttta
gtgaagagaccattaactaacacttactgggctacaagaatgtctgtcgaaaataccagt
tcagcatcgagaaatctagattgggtagttccttcatatttcataccgcctcatgtagat
ttttcaaacataatttttgactataaaaacactgaatctaatattgaggaaaatagcgta
attgtggatcagctagaagggatagatactgcagatttaagttcaggtaacttcagcctt
gtagcaaatgtaagttggctaaatagaaaagatgagaaaataggactagaagaactgcta
attactggaaatcttaagcagttgctcaaaaatattgtgagtacttccaaaaatattgag
aactatggaaaagtagtcagtggaaaattaaaggtaagaggtctttcattattaatg
>SSO0662 (bioR) Biotin--(acetyl-CoA carboxylase) synthetase (EC: 6.3.4.15)
atgtgtggaagtatgttggtaataagactcaataaggttacatctacacaagatttcgca
gaagcaattagcaatatgttgtttgaagattttctggtaatcgcagaggagcaaactaaa
gctaggggaagattagggagaagttggtattctcccaaaggtggactttggtttacttat
gtaaaaaagaactttaaaacagaagagattcagttatctagcctaaaagttgccgttgca
gttctagatgttttaagaaagtttgtagatgcaaagataagatggcctaatgatatagtg
gttaatgataagaaaattgcagggattttgattgaagctaagacttatgaagaggacatt
aagttagcggatctctttataggtgctggtatagatattctcatcaaagaattccctagt
gatctaaacgctacatcattatatttagagataggtaaggaagtagaactcaatatagat
gaggtgataggcaaaatagaggagcacttaaagttagataatagaaaaattattgacata
gtgaatcagtatctctcaataaaggatagagaagtaacgctaaaaggagaaaattgggaa
aagagatgtaaggcactattcgtagattatatgggaaggctagtgacagaatgtggaata
tatgaggttgaagagatttatagggttgaagtttcacat
>SSO0664 SUA5 related conserved hypothetical protein
atgactgaagtacttaaggtcgatccattatatccagaattagataagataaaaaaggct
gctaatgtaataaaagccggcggtactgtagtctttcctacagaaactgtttatggatta
ggcgcaaacgctctagatccagaagcggtgaaaaagatattcatcgctaaaaatagacca
atggacaatcctcttatagttcatatatcaaatatagatcagctttatgaagtagctaaa
gatatacccaaaaaaataatcaatttagtgaatatagtgtggcccggaccattaacattt
gtcttaaagaaaacagagaaagttcctaaagagaccaccggagggctagaaactgtagca
gtaagaatgccagctcatccagttgcattggctttaataaatgaaagtggcgttccaata
gcagcgccaagtgcgaatttggcaacaaaacctagccctactagggtagaacatgtaatt
gatgacatatatggaaaagtagatgtaatattggattctggagaaacgttttttggcgtc
gaatcaacagttataaacgttacagttgaccctccagtacttttaaggcctggtccattt
agtgtggaagaattagaaaggttatttggaaaggtcgttgttccagaacaagctaaaggt
acagcggagtttgacgttgcattagcacctggcatgaaatataagcattatgctcctaca
aaaaggttgctagtagttgaaaacagaagtgtactacgtggcgtcatcaacgaattgcaa
aagagaagttgtaggatagcgcttttgtgcgcgagtgaagtttgtaagcaatttcgagga
gaaaaaattgaaataatagagctcggaagtgaaaataacctctatgagatatctagaaac
ttatttgatagctttaggaagttagataaatctaatgtagatattggagttattcatagt
attagtgagaaaggaataggattggcaataatgaataggacaagaaaggcatccggtttc
tcttcaatttataatatagaagatgtgtggaagtatgttggtaataagactcaa
>SSO0665 (NuoB) NADH dehydrogenase subunit B
atgacagaacagactattttaatgggtaatttaaatgaagtagctaaaaaggcggctcaa
tggctaattaataggaaacccatcaaatcgataattgattggggaatttcattttcttta
tggccacctcactttactacatcttgttgtggtacggaatttggagctttcgcagctgca
agatttgatgcagagagatatgggatgttgccattctcctctgctagacaatcaaatata
cttatactggaaggtacgctaagtagaaaaatgggtagagcagcgagaattgtttatgac
cagatgccagaaccaaaatacgttatcgcccttggagcgtgtatactcgaaggaggaatc
ttttggaattcttataataccgtgcttccctcagatattggaataccagttgatttatac
gttccgggatgcccaataaggccagaggctgtagctagagcagtattaatgttacagaag
aagataagaactcaaggagcccttaagaca
>SSO0666 Glycerate kinase, putative
atggatattgttgataagatattagagtatacagatccctataaggctttacaagagaaa
gttagggtatataataatattcttctatttaacaacgaaaagattccatttaaaaaacct
atactaatttcaatagggaaagcctctctacctatggcgagattcttcagagagaggatg
gagctaaaggctaaattaatagtgacaccaaagggtactaacggaaaagaaaatgatgtt
atagaagctggccaccctttgccagacgagaacagcataaaggctgggaaaaggatgata
gagttactagctaatgaagactacgatttagtaatatttgcaatttctgggggtgcatct
gcactagttgagtattctgaaatacccttagatgagttaaaaataattaacaaggtgctc
gtaacctctggattggggattaataaaataaatatagtaaggaaacatctatctaaggta
aaaggtggtaaaatacttgaatatgtaaaagataaaatccctatagtatcatttattgtt
agtgatgtcccaggtaatgacattagtagtattgggagtggtcttactagtattgataat
tctagtaatgatgatgcgttagaaattttaaaagctatagggttggagaaatactctaag
tatttaacagagactcctaagagtttctctagaatcgtaaaaaattacataattttagat
aacatggaggtgcttaggaagcttgcgaatactctggtgaactctttcattcttacttct
gaaatcagaggagaggcgagagatgttggagctattatcgcctcgatttataattcatca
gagagctacaatataccttttaggagaccttactatttattggttggtggagagcctgaa
gttacaattcaaggaaaggcagggaaaggtggaaggaatggagaggtatgtttatctttc
cttaaatatgctaaaaaaagaaatagatttgaacttttaggtttcgctactgatgggatc
gacggtaactcagaatatgctggttgtaaggtcagttctgacatggaaataagagaggat
gagataaataatgcattggagactcataatagctatggattgctagaaagccataaagct
gttataaaaacaggatatactcacactaatgtaaataacatttatgtcttaagggctcct
>SSO0668 Conserved hypothetical protein
ttggatgaattgatgaaaaaaatcttaattcatatttacaaatacggtcctgataatcct
tggtacatggcgaggagacttttaggagaaagcggatggatagcaaaatacgatatggct
caaatagaagaagcttgtaaaaaactagaagaactgggatatttgattagatttaaaggt
tcactaaaaaaatctgtaacgtcatctataaagccgtggttaaaagttaaagctagagaa
ctagatcataagcccaacggaatttattatgacctaagtaaagagggaagaaaagtagca
tccttattatataaggaatatagaaaagagaatgga
>SSO0669 Iron-dependent repressor
atggttgaactttcggaacctttagaaaattacttaaaagagatgtatgagatagaggaa
attaagggtagtgctaaagtgtcagaattaatttctatttttaacatttcaccaggaaca
ataagtaaagcgttaaacaaattggaaaaattaggattggtagagagaactaatgataga
aaaataaagttaactgaagagggaaagagaattgcggaaagactaattaagtctcataga
cttagtgaacgtttattaacggacatagttggggttgactggataagagctcacgagtta
gcacacaggctagaacacatttggccagatgatatattggagagaatagatagattactt
ggttatcccacaacttgtcctcatggacatccaataggaaataggataaaagtgagtgga
aagaaactatctgaaataaatattgctggtaagtataaggttgtaatgatagtaagagag
gaagaatggattttgagagaggctacacggctaggattaaaacccggggtagtacttgaa
gttatagaaaataatggcactgatataaaaattaagataggggaggaaatagaggaagtt
agcaaagtaattggcgaccaggtgctagtaattgga
>SSO0670 Hypothetical protein
gtgtacaaggtcatttttagaattaaaggaggatatggaacatcatttagagaattaaga
caagctggcttcactccaatttattttagaagagataaaggtgaggaatactatgtaact
atatttacgggtaaagatttgagtgaggtaaaggaggcaattctagacttatcttactat
ttgtctaaatgggggaaatatggtgatcataacttcgcaacaatatatgaagtaaagaat
caaaatttaggcaaggtagccggaggtgcactaggtgcacttgcaggatattatcttggc
ggattggctggactagtcataggtgcacttgggggaatatttttaggtgagttagtagat
attgaaatgggagaaaaattagttggtgttttgggatggcccatgtcaataagcaga
>SSO0671 Hypothetical protein
atggcccatgtcaataagcagataagaaagaggcttgtaagcatatcactagggatatta
ttattaacgacttcgatatttttactcataaagactggaataaatagcgaacaattacag
tcagcattattttttggaataagtcccattctattctatatgttgggaatcatattcgga
ctagaaaggatagtatttggggtaaccgggagtgaaaaattatttagattattagcaggt
gatggtgagctctattataccgctctcctaggagtatttttcatattcataatttccgga
gtactaattctagcatacacaccattaatagctggaattattgaaaaagtattagagctc
atcaatggattaagtttctttgctctttcggcgacattgtttatgagatct
>SSO0673 Hypothetical protein
gtgatattctcttgccctattgatagaagtgatgtaaatgagaagttagagtgtgaaaaa
ggtcacaaatttggtataattggaggccaaatttatgatttcctattgaaagacgtcgag
gtcgataaattattatcaagagtaattcctatttacgaaagtatatgggctccgttagga
ttgctgatcacttctggtaaaacttatacatcctttctcagagaaattggtgagtttata
gatggcgatttaataatcgatgtaggaactggtacaggtaagatttttgattttctgaat
tgtaagacttgtattggtattgatgtatctttacggtttttaatgtatatgaaaagaaag
aggactagggtgatagcagtaagggctgatgctaataatctacctctcaagtctggaatc
gccgacggaatttcttctacactagttttacatatgttatctaatccatcttttgctata
agagaaatgtctagagtacttaaatctaatggtaaatgtagtatcgcagttttagccaac
gtaaattcgataataggtaaaacactgtcaagatggtggaaagttaatttaaggcactat
gattactatattaatttacttcaagagaattcattaaaagtagttgaaaggaaggaatta
ggaccttgggaggtaataaattgtattaagatctca
>SSO0674 Conserved hypothetical protein
atgtcagttcagattaatggagctgaaattatatcgttggatcctaatgcgtatgtaacg
gacgctttattcttcatgaggagaaataacgtgagaagattagtagtaagtaattccagc
aatataataggagtttttacaatagagaacgctattaggcaaattttggaaaatagatta
gaagtaaggctaaacgagttaaagttaagaaggccagtatatgtcgaggacaactacatt
aaaagtatagtaggaacgatgattggtgagagctcagactttgtactatatagaggaaaa
tatattataactgaaaaggatgttgtaagatcttttaactggagttcggtaaagggaagt
gtagaaggtatcagtaaagatgcgattgtagtacagccctttacgaagatctcaacttgt
attgaaactatgcttaaaaacaatatcagacacttaccaattgttaatgggattgcatta
ggcatagttagtgcaagagatatagcttattcttatgactcagtaactggaaatacaata
gttgaaaaaattatgaatgtaaatttagttactgcagacgataatagtgagttaagttat
gcgataaatttaatgatagggaggaatgttggtagtctaatagttaaaactagagttaag
aacaaagttaaaattcttactaacagagatttaataaagttgatttttagttatatattg
>SSO0675 (mobB) Molybdopterin-guanine dinucleotide biosynthesis protein B
atggcatgcatatttcatattataggtaaaaaagatacgggaaagacaagtgttattgag
agcgtattaagagagattaagaaggacaacttaaaggttgcagtggttaagcattctcat
cacaagttggacttagcaggaaaggatacttatagatatagaaactctggatctgatcta
attctatttcaagagggcgaagaagagtcagttctgtttatgccttctgtatcctccctt
accttaattacacttctcccagtagatgttatccttgtagagggtttttcgaatgtggat
ataggtaagaaatacattatcaataacgtaaatgaagttgaagccataagtaaacaagtt
ataaacgatataaaaaaagagtgtcaaaagacgaatagagccttaatattggataatgtg
aaagtagaggtaacatcagataacgctttattactaaccctttataatttgatgaaagta
ttaggagttaaaaatgtcagttcagat
>SSO0676 (moeA-1) Molybdopterin biosynthesis protein
gtggcactaattccagttgaagaggctagaaaaataataagcaatactaattttgaggta
aagagaagagaaaagtacgttgaaatctttcaagcactaggtaaaatagcagtagaagat
atacttgcagtaaaaagtatgcccgaaagatcattatcagcaatggatggatatgcaatc
aaatatgatgactatctaaaatatggaaagttaagagtcgtaggaaaactatatccaagc
acgtcaaatattccagaattaaaagaaggagaaacctattacgtaaccaccggttcacct
ttaccactatatgctgatagtgtagtaccagttgaaaattctagacttgagggagagtat
gttatatttaaaggagaggtaaaaaagggtaagaacataagggaagagggagaagacatt
aacataggacagataataatacaaaaaggtactgaaataactccctattatttaggaatt
ctaatacaacaaaaaatctttcatgttaaggtttcagatttaaagtttacagtttttgct
aatggagacgaaataactagctttgaaaatccacagaaaaataagattatagattccatc
tcaccgatactgatcaaaattctcgagaaattcggtagtgtgaaatatatgggagttgcg
aaggacgatttaaatgatgtaacggaaaaaattgaaaaatcattagaaatttcggatgta
ataatatctgtaggaggatcatcggttggcgaaaaagattacgtaaaaaaggccgtaaat
aaactgggagaggtgctattcgatggcgtatccgtaaatacaattaagagaggtagtgtg
ggcagaattcaaggaaaaccaatattgatattaccaggacaagtagtatctgctataact
gcgtttcatgaatttggtctttcagtattgtctaatatattaggtactaatctaaagaag
tttataaaaagtactcttgtagaggacatctatgttaatcactctatggattcagtatac
ctatttaatgttaaggggaactcagcatttccgcttagatggggcgtaggtttgtacagc
gaattagctaaagctaatggatttgcaattctcaagagaggtttaacttataagaaaggg
gaagaagttgagttacaacaactcata
>SSO0677 (mobA) Molybdopterin-guanine dinucleotide biosynthesis protein A
ttgagttacaacaactcatatgatgttataatactagctgggggactatcgaaaagattt
ggagctgataaatgttgcttcgaggtaaattcaaagacaatgttggataggttactagag
caatttgacaatcccattgtggtatcaagatcgcctaggagaataaaaaagggaatttta
gttatagagaagggtgaatatgaaggaccagttaaaggtgttagagaaggattaaaatat
gtaaggagagatagagtttttatcactggatgcgactttccgttcctcattaaaaattta
gtagattatgtatgtagcaaaccatatgacatcgtaattccatttgatcatagaccacag
ccactgttagcttgttattccacagaactgcttaataaaaacattgataaaattaatgga
cttgtagagctgattgaactctctagctcagtatattttatcggtactgaagaactatta
aagatagatccttttctttatagtttgattaatatcaatagtataatagatctaatttat
cgtccaattagaataaaaacgaaatcaaattttattcttaga
>SSO0678 Conserved hypothetical protein
atgaaaatttgtgtgttatactccggagggaaggatagtacttacgcgttgcattgggca
gttttcaaaggatttgaggttgtctgcctaataacgctaataccgaaaagagaagattct
tggatgttccaatatcctaacgtgatttatactaaatatcaggctgaagccatggatttt
aagttaattaccttcgggacttcaggagagaaagataaggaactagaagatctcaaaaag
gcgttattacaagctaaaaatgaaggtgctgatggaatagttagcggagcgttactttcc
gattatcaaagattaaacataagcataatagccgaagaattaggactaaagacatatact
ccgctttggagaaaaagccaagaagaatatatgcgatggttagtaaaagaaggatttaag
ttcataataacatcagcctccgcctatggttttccattcgatctagtaggtaaggaaatc
actacagaggatgtggagaaaattattgagagagcaagaagatatgggttcaatcctgca
tttgagggtggagaagctgaaacttttgtaacttacgctccacttttcaaaacacaatta
agggtaaatggtaaattaaaaagaataagtgagtacgaatgcagatacgaaataacggat
atacat
>SSO0679 (trzA) N-ethylammeline chlorohydrolase, putative
atgcagatacgaaataacggatatacattaaaaaattgcagatttattgtaaactatgat
aaaatattggaaaacgtgaacatagtaatacaaaatggatatataaaaaatgtaggaagg
gaagttgagggagatgaggtagattgctcagaatacattgcaataccagggctagttaac
gcacatacacatactccaatgataatattgcgtggatattatgacgatgccgaattaaca
gaatggctaaaaaagatatgggaatttgaaaaagttttcaagctaaatgagatgaacata
gcctcagagttggctataatggaaatgttatcaaaaggtacaacagctttcatagacatg
tactttaatcctgaaggagtaaaagaaattgcagaaaagtatggaataagggcctatgct
ggttatacgtttctaaacagtttattcgagcctcatgagatagataagaaacaaagacag
cttaaaacaagtgaactgtttaaaccaattgtgaacgtacatagcatttattcaacatct
atagaaacattaaaattggctaaacaaattgcagaggaaacagacacatggattcacatc
catgtatctgagaccagaagcgagatttatgagataaagaaaaaatatggcaagttccca
gtagagttattgaatgagctaggaatcgtaaaaaatgctcagttagtccatttaggatgg
atagctaattgggaattacgatatgtgaaccaagcaactcattgtcctacatcgaatatg
aaacttgctaccgcaggtttctttccatttaaagaattgatggaaaatggagtaaacata
accataggtacagatggagcagcgagtaataactcgttagatatgtttagagagatgaaa
aatgcagtattgctccaaagacattcgtattgggatgttggagtaaaggcatttcatgca
tttagggcagcaacagaaaatggatacaaacttattaatttaaaaggaggaagaatagaa
gaaggttacattgctgatatagtattattaaagaaggacaaattatatccgctaaggaag
gataggattctatcaaacattgtttattataccgtaggtgaatatgtaggtaaggttata
gtaaatggaagaatagtttacgacgaaaaagtagaaagggaatttgataagagaagaaga
gaattacttaagcttttggatgagattatatcc
>SSO0680 Conserved hypothetical protein
atggttgagattataataccagtgggtcctaatgataagcttgaatgggttaaaagaagt
gtaaattccgcattattacaatcagttgataaagtgataatttatgataatagtgagaga
gcagatatctacaacttttttcaagaattgaaagataaattagtttatattaaggataag
agaatgacaaaggttaacatggctagattacgtaataagatgctttcgttagccagtgat
aaatatgtgatcatgctagatagtgatgttgttatacctaagaattattctaataatatt
ataaataaactggaaagaggagttgcatatacttggattcattatgcttattcagaagag
gaaattgaaaaaccattatctatatccgaaaataatcctaatctaggatgcgcagggctt
aatctagaggtaattaagaggattggttactttgatgaacgatatgaaagagatgaggat
gtttggctttacgctaaattaaaaaaaactggatataaagtagaacccgccgagggcaga
tgtttgcatcttaataaggttcacgcaaggcttaatttatcttcttcagtcgctgaagct
agaagaaatctttggaggagtaaatacgacattatgcttatgttcgacggtcttacagat
tttacctttttgacgggctattcatattatggtagttactatatattagcaattttatca
gttattttccatcccttaactttcctctatctaccactcataggttatggtgtctattat
tataaaggtccaaagaaatatttattgaatttaatacccggtctatctttggctatttca
ttcccatacggtctaggatataatctcatccaaaagcttaag
>SSO0681 Conserved hypothetical protein
atgaagaaaataaaggttgcagtaatagcccatggcttagggatgagtatgggctatagt
ggtgagggaaatatatataaaactttttttgaaatgctagaggaaagaaaaatagattat
actgcaataagctttgcaaagccttacaatacatcaataccctcagtgtatacgttaccc
ttccatttgccaaagctggataagtatcaaagattattaacctattatacagcaaaaaaa
gtaaaaccggatttgtaccttaacgcatccggagttccaataccactatccaaaatagct
ccacatatagtttatgcgggagcgccttcaatagctaacctacctagcaagtatactaga
tccctattttggaaactttatttattaccgtttcgtcttgtcatcaataaaataaaggaa
gaggggaagagggcaaagataatagcaaactctcgttattctgcaaaggcgatagctgaa
gtttacgaaataagtgaacctaaagtaatatacccaccagtggatgtaggatattttcag
agagcatataatgaggaaaaaagggaaaatttcttcgtcacaataggaagaatagaaagg
gggaaaatgcttgaaaactcaatcctcctatcagctaagagtggagttaagggggtaatc
attggttcattaaatgaaaaagactatctgaaaaagctaattaaccttaagagagaactt
aatgctgatatagagattataactaatttaccaagggaagagctacttaaagtactctct
aaggctaaagtgtatttccacgcaacgataggagagcattttggggtaccagttgtagaa
gcaatggcaagtggagttatcccaatagtacctaaagagagtggagcttacgaagtagtt
ccggaattctcgtattctgacatagaagaggccgtaactctattaaagagcttattagag
aaggaaaacgtggagttaagaagggaattaaaagatagggctctaaatttcagtaaggaa
aactttaagcgtaaaatatttaatgaaatttcttctataattttc
>SSO0683 Conserved hypothetical protein
atggttgactattatccttctggttgtggtgtttttgggatcttaaggaaaagagatgcc
cctaaagttaaaggcgatttagttgtaagagcaatagatagagttagatataggggtagt
gataagggtgcaggatttgctgtatttaatttagaaaaaagaaactattatgttattaaa
gcattttataatggaaacccaagtgaactaaaggaggtatttagtaagtatggtatagaa
gttaagaatgttgagttagtaagtaagtattcgaatttgtgtgattgtaatctaattgct
ttaggcgatataaatgaagttaggaaggctataaggaatataaatgagattatgtggaat
ggtaaagagaggaaaggcagagtatatagcgttggtagttctcttcatgtttataagggt
gttggatatcctagagatgtagctgaacaatatcgtgttgaggaaatcgagggtgattta
tggttagcacatactagacagcccacgaattctcctggttattatccattttggtctcat
cctttttcctcatttaatattgctatagtacataatggtgatgttagctcatttggcgca
aacgttgaatatctaaactcaagggggttaaatagttttgtaggaactgacagtgaagta
ttggctttcttatttgaggaactcatcgcagaaggcttaactgttgaagaagcggtaaag
attctaattaatccatctagaagattcgatggcttacctaaagacgttgattatctatat
agaaacgctagacttgatggtccatttactgcagttattggttatgattctggtgatgat
ttatatttgatagctattgctgatagatctaaatttaggccggccatagttggtgaggat
gattcgtattattatatagcaagtgaggagaatgagattagggaagtaagccctaaggcc
aaagtttggacgctcaaacccggttcttattttatagcgtcttacaaaaagggagtcata
tcgtacggtaggagcaatgaagagttaaagacattttctcctcccccaataatggttcca
gaaaagtatgatattaatgcctataatatagggtataaggagttaaattatgagatcctt
aagttagctgaaaaaggaaagagggaaataacagttgccaatgttttaggtcatagatat
attgggataaatctacctgctagaggtataaataatttgaggattaacctttatggtgtg
atcggaaacgctatggcaaacttaaatgagggtaatgagttttatgtttatggaaatgtc
gctgatgattgttgcgataccatgcatggagggaaggtagtaatttacggcgatgcaaga
gatgttttagctcagacttttcagaacggtaagattttcgttaagggtaatgccgggaat
agagtcggtattcagatgagagaatataaggataaaagaccatatctcataataggcggt
attgtcgatgattatctaggagaatatatggctggaggttcaataatagtgtttggtaag
ggatacaatggagaaccagtaggaaattttgtaggaacgggaatggtagggggtaggata
tacataagaggtaaagtttccccatcaaagttaggattacaaccacctaagtatgaggtg
atgagactaataaaagcgctattcttagaaggtttaatttctagtgaagaatatgattca
ttaaagaatgaagagtatatagggattgttaataagttaaaaggagaagccaaggaatac
gcgaagaaattgtttgaggagaaaattggagttccgatgtacgaatatagagaattgact
gaggaggagtttaaggagttgtccccagtagttaatgagtattctaaggacatgatggac
cactcttatgaagaacttttaaaggaaaagtttactgttgtaactgctagaaaatta
>SSO0684 (gltB) Glutamate synthase (NADPH) subunit alpha (EC: 1.4.1.13)
atgataatagaatataataaattgggaaccatactttacagtagaatttctcataaacag
ttatataatatatttcattacagttatcatgaggttagattgctcgtatacaacaaatat
ctaccaataccaaaacaatttaatgacgaattttggactgtggaaaaggtagaacacatc
agatatctctctttaacaggaaagccttataaaatatttaatgaggacatgaactcttta
agagtattagacaaggttagatttaagctcgataaagcaacttcaatatctttgacccct
aaggcaaatctagagctagaattttctggaatttacatgaagtctccattatatctaggt
gatatgtcttatggagcgttgagtggtaatccaaatatagcaattgccactgcggctgat
ttgactgaaactctagctggtaccggagaaggtggtctgcacccagaagttgctaaacat
aagaggatttttgtacagtgggcctcagctagattcggcgttgatattagagttttaact
gctggtatgggggttgtaataaaaattgggcaaggagctaagcctggaattggcggtcat
ttaccaggcaataaagttactgagccaatatctttaactagaaggatcccaatcggtata
gatgccatatctccagcacctcaccatgacatttattccattgaggatcttgggcaaaga
atagaggcattaaaagaagccactggaaggcctgttttcgttaaagtggcagcaactaac
tacattccttatatagtgtctggtattgccagaatgggggctgatggtgttataatagat
ggacatggagcagggacgggtgctacacctgttgttataagggataacgttggcatacca
atagagctagctatagcctcagctgacaagattttaaggagagaaggccttagggataag
tttactatcatagctgctggtagggtttcgtcagctacggatgctgccaaactatttgct
ttaggtgctgatatagtaagtgttggtactggagccttaattgccatgggctgtgtcatg
gtacataagtgtcatgtaggctcatgtcctacaggtttgactgcaaagattgatggaact
agagtagttgatacagagtttggagttaagatgttagttaattttattaatgggttttct
cttgaattagccaatattttagacaatttagggttaaataatattagagagcttaggggt
agaagagatctcctttacgggcatggtttgagtaaagatactttagaaactctaggaatt
gacggtacagaggatgaagcgaatcctaaattgggtgaattgtggaataggagaattatt
gcttatatgcacgaattgatgaataagggaaatccagtaataactagcatgggaagtact
gcaccaccagatgtggagaaaccagctagaataattgattggctcagatctgatggagct
caagttactaggccttcaatagatccttatagggaagacgtagatacttccttttatctt
aaaggtggagagatatacttatcccttccaataatttttgacatcactgaagctccttta
gagtataaggaagcgttcagttggagtgccctagcgttgtcttcagcagttttcgattac
gaaactattgacaagtacgcagaagttttcataagtagtgatggaagaggtatcgctagg
tggagtaggaacgagatttatgaaaactcgtatctcttgatacccgcggatgagaacgta
atagatgaagttattggaatgggtgttcaagggttcataattgatgaggacagcggaaat
agtgatctagaattggttgttagtgctttagataccaaattaaaggaagtgggtgttaga
aatcattatgatattttagctaaatcaagcagactaagacattctgcagacgctttcaaa
ttgattctattaggtgcggattctgtcataatgccttactttattttagaaaaagccata
ggtgagggaaataagggtaatttgaaagaaaaagccttcagtctcataactggaatgaag
aaggaaatagcattgcttgctggtgcagctggagtttatagtgtccaatccaccttgact
ggtaatagggagttattacgttctatcaatttgaatcattctataaggaaagcacttaga
ataaaaccagcggggtcttta
>SSO0686 Conserved hypothetical protein
gtgaattcattagatattttatggctagcatataaggggttagtatctaggaaagcgata
gcgattttagctataatatcagtgatgataggagtagctagtgtgactgtactagttgct
tttacacaaggtgtaagtcaatcagtcttatcagttgtggagtcgttgggacctagtaca
attttagttttacctaggggtggcgctagcttaactcaagctaccgtagcaactatagcg
agtttgccggggattaaggcagtttatccagtagttagcggtttcggggaaatgaatgtt
gaggggcaaccaataggggttagtatcattggaatagataacttgtcagcacttcttggc
caagtgttactggaaagcgggtcagtttatcctccagttacttctccagaaactgtaatt
ggatcagaagtagcgaatccagctccagggattttcttctcaccaggggatataattact
gttcaagtttcaaggggtaatagtgtagcattagaagttgtaggggtactatctccatct
ggtgctaatcctctatctaattctgaaacgtctatatttttacccttgaacgaggcaatg
gcaattctaaacagaacttcgtatagcgaattgataataaatgctcaatcagttaatgat
gttaataacgtggtaaaccttattgaagaaatatatggtaatcagttaagtgttatctcg
gttcaacagttaatcaatacagtatctactataacatctggatttagttttctattaata
tcagttgcatcaatatctcttttcgtaggtgctgtaggaataatggcaataatgttaagt
agagtttatcagaggataagagaaataggtataatgaaaacagtaggtctgacaactaga
gatattctattagtttttttagcagaatctggaataatagggctaatagggggcatagtt
ggtatattggtaggtttagtgggtacgtcatttattgatcttttatcagcaataacatca
cagtctgcatctggtacctcaacaactgttagctcaagtggatttagaggaggtggtggt
tttggcagatttggaacagccgcatcttcatcggccttcacatttaaaccagttatttca
atagaagccattttaatagcattagtagtagcagttgctgtaagtttaatagctggtatt
tacccagcttggaaagctgcgagacttacggcaatcgatgcgattagaagagat
>SSO0687 Hypothetical protein
atgagtaaaatattctccattattactatatcactatttttagtgtcgttgttatttatt
ccattaacatcctctgccacacaatcgtctttttcagcatcttcacaatggctttcttct
acaccttatgtaactccgggggaaagattagtacagttacaagtaaatttagtatatcac
ggaaatgggaatataacaaatgtggaaatttctccaatagaaagtggtccttttatagtt
tatccgtctacacaaacatacattcttccctcaatgtttcccaatcaacaatattcactt
gtattcattggaaatattacacctaatatacctttaggtgtatataatttctatctgcaa
gcaacatatctagaaaacggagcagagcaatcgcagataattacagtgcaaattcctatt
cttggatatgtacaactttctgcaatagctcaaactagcggtacagtatttccaggtgaa
cagtacgttccaataaatttagtaatatacaacactggaactgttactgccaataacgta
gccttgttcttaaactcaacatatccattacaattcataactaaagagataaatatacca
attattagcgctggttcctcacttaatgttcaagcaatagcaaatatttataataatgcg
acaattggtacatataaaataccacttacagccttcgtatatggcacatatcattcgctt
aatgtgacaattacaattaacagtaatcagactgttggagggaagctaataactccttac
gttatcttacctgctggttcatatcaattaggagttccaataactcttcagttaatttat
accggtcccatttcagtaagtagctattcaattcaacttattttaccaaatggctttact
aatataactggtggaaattctgtttacatcaatgggggaccactgcaaccttatgaggag
ttcacggtatcttttactattaatattcgtaatgtatctttaggtgcatatacaattcct
ttaaagataatttggagcactatagaaggtaacggcgtagttgtaaatacattacagtat
atgtcatttactatgttccttatgggtcaaccgaatatagaagtttaccctgaaacctct
ttattatatccaggagaagttaacaatattactctagttatattaaatctaggatctgga
agtatatacaatctatccctttccgtttcctctcaacaagtatccatccttaataacttg
cctaaaattcaatcactatctccaactcaatcggttaaaatacctttagaagtttatgtt
ccatctacttatcaaggagctcctgtacagttcactatttcaatatcgtatttaaattca
gtttatcaacagtcgcagtatcaacaacagataggcctttacgtttctcctctaatttca
ccaaatacccctattatcgcctctttaaacccagggataatttcaccaaattcgtttaca
actacgtatcttgtattgacaaactcgttaaatactaccctttacaatctatcaattacc
ctttcgtcaccagtttacgttaatgctacagcgtttaatttaccgtctctcaaacctact
tctaaatacgaattacctataactgtttacgcacaaggctctgggagttattctatctca
atatcgattgtttattaccaaggtaatatagaaagacaagagcaaattacagttccagtt
tacgttatacagatcaattcaccaactataccaattttaattcaattcaattcttctaca
ttactaactggtcaagtagaggatgcaacgatcataatacaaaacacagtaaatcaacca
ttgtataacgttaccatatcattagcctctcaaggaacactttatattaatacaacgaca
ataactctaccctcgcttcaacctttgcaaagattagatattcccgtcaaagtatatact
cagagcgctggaataattagtataagcgctagtatatcgtattatcaggctggacaatta
aagcaagctcaagaagttattaatagtctagctgcaggttcagttaacattataataact
ggtgtttcctcagttcctacggttgcagtaagaggtggcatagtttcagttacagcgacc
atctataattttggtactggtcctgctaacggtctcacagttacggtatttccacctaga
ggcgttgtggtaataggtcaaaacacttattatgtaggtaatttaggttcggatacctca
tcaacatttacctttgcatttagaatacttaactccactaagccaggttcttatgttatt
cctatagagtatacttatactaatgacattggacaagttatacactcaaattcaagtatc
acactacaagtctcaaatagttcttctagtttcttcatctcgttctcaagaagtagtaat
aattctcacatatctctaattgacatattaggtataataattgtaataatcgtagttgta
gtcttagtgatagtattattaagaaaaagaagg
>SSO0688 ABC transporter, ATP binding protein.
ttgccaaaagattttttagagggagccaatagagtcgattatatgaccgatatcttaatc
gatgctatggatttaaagaaagtatacaaaactaaaaatattgaatacgttgcattaaga
ggagtaactttgaaagtaaataaaggagaattcttggttattgctggtccttctggatct
ggcaaaaccacacttttagatttgctaggccttttagattcacctagtgctggtaaaata
ataatagatggaatagatgttacgaattttgatgaagatgagagagcaatttttagaaga
agatatataggttttgtatttcagtcatataatttaattacgtatctgacagttcttgag
aacgtggaattagctttagcagctatagggatccccgtatggaaaaggagggagaaagca
gaagagattctgtccatgatacccggtatgttagaacttaagaataaaaagcctaatgaa
ttatccggaggtcaacaacagagagttgcaatagctagagccttagccaatgatcccaag
atattgcttgcagacgaaccgactgcaaatctagattcgaaaacaggtgaggcaatagtg
gagttaatgaagaagttgaatgaagaaaaaaaggtaactattataatggctactcacgac
ccagatatgatgagatatgcggataggatcgtatatattagagatggattagttgaaaaa
gaggtgatacagaatgag
>SSO0689 Conserved hypothetical protein
gtgacggaaatgaagattttaatagttaccctaacttacattgaaaaatcaataatagat
gaaattgttaataatctttcaagctatggattagaagttgatatattgttagatagtagg
aaatatcttcctatttctgcctttaattgggaaagattgcaatacgacgctgaaaaagta
ttgagcttccttaagtcaatacacgactttaactatgactcaataatattcttagcagat
tccgacggctatattgatggttataattttgtatttggattaactatagataattttgcc
attatttttctgcatagattacgagaagagttttataacagaaaaccagatttagatttg
tttatgaaaagagtagttaaggaagtaactcacgaagtaggtcatacattagggctaagt
cattgtaatacaaccggttgtgttatgaatttcagcaattcagttgaggatgtagataaa
aaacaagctaagttttgtaaaaattgcgcacataaaatagaaaaattatctaaatatcta
caacaaaag
>SSO0690 Conserved hypothetical protein
atgaggcagtttgaattctttgaacatacagcagatgtcggtattaaatcgtatggtaga
tccttggaagaggcattctcaaatgctgcgttaggagtttttgaagtaattactgatacc
tcgaaagtaagacctgtagaatatcgtgaaatttatttaaatggatatgatttggaaaat
ttgttatataaatggatagaggaacttctatattattatgattctgaattaatgatcttc
agtaaattcgatcttatgatagatcaagattctataactttagaaggaaaagcatgggga
gaaagatttaacgataaaatacatgagagaagaaccgtagtaaaagcaatgacttatcat
cagttatcaatagaaaaaacagaaagcggttatgttattacttttgttgtagatatt
>SSO0691 Hypothetical protein
ttggattgcattaggaacaacagtgttctcattaataacttatctagcttcacaagtggg
atcatgagcagtggatattctccattctatatattatacatagcgatgaatatagcgaca
ttaacatatgcggttggtacgttattttacggcttgccaattcctatttatggcttaaaa
aaatggggaccaagaatgatgagtgatgcaatatatgccgctgtatgggtaaacatttat
ggtattataatttttgcgataggccaaattcaaagcttacttggagtagattggagtagt
ttcttttcgtcaattttacaattacaagctaatatgtttagcgcgcttattcaagttaag
agtttatattatattattacgactgagaagatatcaatggctcttgcccttcttgcagat
ccagtacttcagttttcctcatttattactgatataatttttttattacaattttttata
gatctaggagaatttatacaacaatcgtacatgatacttatagcaattggtattctttta
ctatcacttccttttagaatgggaaagggagtaggagggactttaatatcgtctgcaatt
atattttatatcggtttgccatatttaccaattttcatgcaagaaatgtcctctattacg
ctttctcaaataggatctcaattatctacgattaccgatgtaaacacgttggttgagact
atagctggtgtagttccagaactagtaattgtatttataataatacccatgctttattta
agtattttagctggcatatcactagggttaggcaatgcaatcggaggctcaagtggtcga
gttccatttccattagacttgttt
>SSO0692 (cmK) Cytidylate kinase (EC: 2.7.4.14)
atgataattataataagcggtcctccaggtagtggtaagacctcagttgcaataaagctc
gcaaacgaactatcatataaatttatatcagccggaaaaattttcagagatatcgctcaa
agcatgggattagatatcataaatttgaatagggttgcagaatccaattttgatattgat
aagatggttgataaaaagattcacgaatatgtattaagggagagaaaccttatcgtagag
tcacatattgcaggctggatatttagagaatatactgatgttgcaatatatttgtgggca
ccacttaaaatcagggcaaatagaatagctattagggataaaatatcatatgtcgaagca
gtctcgcaaattattagaagagaatacatgcattataaaaggtttaacaaattctatggt
atcgatattaatgatttatcggtattcgatttagttataaatacctcaaatatagacatt
aataatatagtgaaattaattctggactatctatcatcagtttcacataactctcagcca
ttaaaagaaaaaaatatcaacgataag
>SSO0693 Hypothetical protein
atggagttaaatacaatatacatttttttgatttcgcttttctcgaattttgttgtttat
ttgatctacaagtattatttttatgggaaaataatcaataagataagcctcgtcgaaaag
tacgaagagaggttaaagaatatagcctcgtcgaaaagaagagaaaaggcttacaagaaa
atttctaaagagctagaatcctatatctcttctgttagatattatatgtttttgcgttca
atgatattagtgggcgtttatatagttgatcttgtaattatattgaattacttaaatact
aatatatatctgccattctatataccttatcttacagcgaagagtagtagtaatatgtat
ttaatgctcaacgggtctctctttgagtttatagcatcttatatcttatttacccctcta
tctttaagatcaaatttaaaaacaaga
>SSO0694 (adkA) Adenylate kinase (EC: 2.7.4.3)
atgaaaataggtatagtaactggtatacccggtgtaggcaagacaactgtcctttctttt
gcagataaaattctaactgaaaagggtatatcacacaagattgtaaattatggggattat
atgctaaatactgctctaaaagaaggctatgtgaagagcagagatgaaataaggaaattg
caaatagagaagcaacgagaattgcaagctttagcggctagacgaatagttgaagatcta
tctttattaggcgatgaaggaatagggttaatagatacgcatgccgtaattagaacacca
gcaggctatttacctggtcttccaagacatgtaatagaagtcctttcccccaaggtaatc
tttcttctagaagcagatcccaaaatcattttagagagacaaaagagggatagtagtaga
gctaggactgattatagtgatacagctgttattaacgaggttattcaatttgctaggtat
tcagctatggcgtcagctgtactagttggggcatcggtcaaggtagtagtaaatcaagag
ggagacccttcaatagctgcaagtgaaataataaattccttaatg
>SSO0695 (secY) Preprotein translocase secY subunit
atgtcattcatcgattcactcgctactcttggacaatacttaccagcagttactaaaccc
aaagagaaaccttcacttggtcaaaagttagtttggtctttagtagcagtaataatttat
ctgataatggcttcaacaccactatatgggataacatcagcttcttttttcaaaaacctt
attttagagcagattattttcgcttctactacagggaccttagcacaattaggaataggt
cctataataactgcaggtttgattatgcaaatactagccggatctaagttaataagtatt
gatctaaatgatcctgacgatagggttaaatttacagaagcgcaaaagggtttggcattt
atctttattctagtggaatcagctttatttggttacgtattagctagaacttcaacaacc
ataaatgcgtcaatattattcattgcagggatagtgatagctcagcttattgtagccaca
tatttgatcttactgttagatgagctgatacagaagggttggggtttaggatcgggagtt
agtctgtttatattagctggagttatgaaaattatgttttgggacatgtttggaattgct
agtgttagttcccagaatttaccgataggattctttcctgcattatttaccgctttagca
tctcatagtgacgttcttaatttaatagttaatacttcaactaaaaatctctttcagcca
gatttagttggtttagtaactactatagcactgataattataacaatttatctaactaca
atgactatagagattccagtaacttcccagaagttaagaggaataaggaggacaattccg
ttaaacttcttatatgttagtagtataccagtaatatttgttgcagtactaggttctgat
atccagttattcgcttcattagcttcttatgtctcaccctcagcttcaaatatattaaat
accgttagtggagtcttctttttccctcctccaaattcagcaataccccatagtatatat
gctgtagttttagatccgttaggcgcgcttgaatatgctgtagttttcatagttcttagt
atcttgtttggcatattatgggtagatgtagctggtttagatcctgctactcaagctcaa
cagctagttgaagctggtattgaaattcctggagtcagaaacaatccaaagattatagag
ggaatattagctaggtacatctatccgctggcattcttcagttccataattgtaggtctg
attgcagtatttgctacgctcctaggtgcatatggtaccggcatagggatattattggca
gtaacaatagcaatacaatactatagcttattagcttacgaaagatctttagaaatgtac
ccattattaaagaggttaataggtgaa
>SSO0696 (rpl15AB) LSU ribosomal protein L15AB
atggtagtaagaagagagaaaaagagtagaaaaatgagaggatcacgaacaatgggatgg
ggtattagagggcagcatagagatagaggttcacaaggtggtaggcaaattggtatgcac
aaggagaaatggtcatggttagttaaatatggcaaaggatggtatggtaagcacggattc
agaaatccaactacaaagttaacaagcgctatttcattgaggaaattaaatgagttatta
gaaagtggttatataaaaattaaggaaatggatggaaaaaagatagtagacttaaacgag
ttagggtataataaattacttggtggaggtagtataagtattcccgttactataaaagta
ggtaaggctactaataaggcaatacagaaagtgaaggagatgggaggagaagtaatatta
agcccaactgag
>SSO0697 (rpl30AB) LSU ribosomal protein L30AB
gtggtggagttattaggcataattaggattagaggttgggcgaaggccccttggtatatt
aatgaaacattaaatatgttgagattaaggtataatttcaataccatggtatatccaaaa
acgtctcaaatacttggtatgctgaataaagtttctccatatattacatggggtgagata
gatccagatactttaaagctactaattataaatagacttgaaacggtaaaaggggataag
gtttcggatagttatgtgaaagaagtgttgaagatagaaaatattgatgcaatggtaaaa
caattgtatgagggtaaaatttacttacataaacttgatgaatatttcaagttgcctatt
cgcttgcatccacctagaggagggtttaaggggagtgttaaaaggccctataaaaataaa
ggtgagtttggatataggggagataagataaacgaattaatgaggaggatggtg
>SSO0698 (rps5AB) SSU ribosomal protein S5AB
gtggttaaaatggcagaggaagtaccaagtttaaatatagaagaatggaaaccacgaacc
tctataggtagtctagtaaaggaaggaaaaatatcatctataaaggaactatttgatagg
aatcttcctattactgaaccagaaattgtagacgtgctactacctaaactaaaatatgaa
gttgtagatattaaagtagttcagaagcaaactgatgcaggagaaatatctagatataaa
gttctagttataatgggcaacatggatggatatgtcagtataggaactggaaaagctaaa
cagttaagggttgcaattcagaaggcaattagggatgctaagatgaatataataccagta
agaagagggtgtggtagctggcagtgtacatgtggtgagccacatagtttgccatttaag
gtagttggtaaggcgggcagtgtagaagttgacttattgcctgcacctaaaggtactgga
ttagtggttggaagcgtactaaagaccttgttaacttatgctggtataaaggatgcttgg
tctaccacaaagggtgagactagaactacagagaattttgttagagctggatacagtgca
ctttataatacatataaatttgttactttacaggattgggttaggaagagg
>SSO0699 (rpl18AB) LSU ribosomal protein L18AB
gtgaataaattggccaatggtcctaattataaggtaaaacccagaagaagaagagaagga
aaaactaactactataaaagatatgtctatgttataagtaaacaaacaaggtttattgta
agaataacaaacaaatacgttatagtccagattgcaaaaatcgatcctaaaggcgatatt
atgattgctagtgctcattcagctgaacttgctaaaaagttcggatggaagggtgatgaa
aataacactccagctgcatacctgaccggatatttagcaggcttaagagctataaagaga
ggtgtaactgagtgcgtggcggatattgggcttcatgtaccatctaagggtaacagggtg
ttttatgtgataaaaggtgcaattgatgctggattgaaaattccgataggcgacataagt
atagaaaatgatagaataaagggagagcatatagcaaagtatgctgagaagttaaaatct
gagaattcggacttatatagtaaattgttttcaaggtatttacaaaggggactaaacccc
gagaacttgccttctcattttgaggaaatattaaataagattaaatcttctggtggt
>SSO0700 (rpl19E) LSU ribosomal protein L19E
atgactaacttgaaagcgcaaaaaagattagcagcatcgattgcaggggtaggtataaac
agaattaaggtcgttgaggattacattgaggatgttcaaagctcattaaccagagatgaa
attagaaatttaataaaagatggtaagattatagtcctaaaaaaggttggaataagcggt
ggtagattaaaggaaaggcgaaagaagaggagccttaagagcgaaggaaagaagtcaggg
agcagaaaaggcaagaagggagcaagggctaatagtaaacaaatgtgggttaaaagggta
agaaaaataagagcttatctaaagtggttgagagatcataaggttattgatagacatact
tacagggaattatacttaaaaacgaaaggcggcaactataagggagtttctgatgtcaga
aatgtcctaatacaaatggggaaaattaaaggg
>SSO0701 (rpl32E) LSU ribosomal protein L32E
atgaccgaaggaagaattcagtcgtataggaaaaagatttatgtaataaggcagaagctt
aaggcaaagaagcctaagttcttgcggtatgattctgataagttctacagattaggaaga
caagaaaaatggagaagaccatatggaagagataataagactagattgaaagttagggga
ttcccagcaatagtgagtgtaggttatagattacctaaaaaggttaggggattccaccca
agtggattaaggcaagttatagttcataatgttaatgaactagttaaggttcagaaccaa
aaggacaacgttattgtaactatatcttcttcagttggttttaaaaagaggcttgaaatt
ctaaataaagctagggaattgggtctgaaagtaagtaatgagggtgtagttaca
>SSO0702 (rpl6AB) LSU ribosomal protein L6AB
atgcagatagtaattttgagggaagaaatcgaaatcccgaaaaatgttgttgttgatcta
aaggggtcaataattaagataaagggacctaaaggtgaagtagttaaagatttcagcttt
gcaaagggtatacaaattagtttagatgggaataaaatagtgctagagactacttttgct
aatagacgaaaaaaggctgtcttctatagtatagttagtcacattaaaaatatgataact
ggcgtaacaaagggttatagatattaccttaaaattatatatacgcactttccaacatct
gtaaaggtagtagggaatgaagttcaaataactaatctaataggtgagaagaatactaga
agggcacaaatattggaaggcgtcaaggttaccgtgaagggtgaagatatagttgtggag
ggtccgaatttagaggctgttgctcagactgcagctaatatcgagtcggcttcaaagata
tctggttttgatagacgtatcttctcggatggaattttcatctataaaaaagaggtgatt
gaa
>SSO0703 (rps8AB) SSU ribosomal protein S8AB
atggtattcgtgaatccgttggcaaatgcattaacgtccatatataataatgagatgaga
aggaataaacaagctattataatgccagcatctaaattagtaataaatgttttaagagtt
atgcagaaggaaggttatgtaggagaatttgaatatattgatgatggaagatggggaaag
ataacagtacagttgttaggaagagttaataagtgcggtccaataactccacgatatcct
cttagttatagacagatgattgcgttgccagattacgttagacgttatctaccatcgaaa
gagataggcataattattgtttcgacatctaaaggtgtaatgtcccataaagaagctgca
agattgcgaataggtggggtagcactaggatacgtgtat
>SSO0704 (rpl5AB) LSU ribosomal protein L5AB
ttgattaaaatggcagagtctactttacctcttagccagaatccaatgaggaaggttaaa
ttaagcaaggttactgttaacataggactaggtgagtctggagataggttgcaaaaagct
tatcaacttttacaagagctaacgggagccaaaccagtatatactatttccaagaagact
ataagggagtttggaattagaaaaggtcaagaaattggagttaaagtgactttgagaggt
gcacaagctgaggaattcttaagaaaggtattagaagctataggatacagattaaagaag
agtagctttgacgattatggtaacgtatcttttggcattgcggaacatgtaattttgccc
ggtgcaagatatgatccagaaataggtatattcggaatggatatagctattacacttgag
agggctggctataggatttctagaaggagaagaaagaaggctaaaattccaaagaggcat
agggttacgaaggaggaagctatggagtttttaagaaataattttaatgtacagttggta
gaaggg
>SSO0705 (rps4E) SSU ribosomal protein S4E
atggcgcatataacaagatttgaagcaccttggtttttaatgataagtaaaaaacaatat
aagtggacggttagacctaatgctggacctcactctattgagaaaagcatacctttagct
gttgtaattagagattatctgaaacttgcggggacgataagagaggctaagcatataata
tttgatggcaaagttttagtggatggtaaggtaaggaaagactataagtatcctgttgga
cttatggatattgtttcaattccctctgctgacctatattttagggttcttccagataat
gttaggttcatgagattttccaagatatctgctgatgaggcccggtataagtacgttaga
attataaataaaactacgataaaggaaggaagaattcagcttaatctagaggatggaaga
aatatccttgtagataaagagactgccaagaatttcaaaacgcttatgacgttaaagatc
gaattacctagccaacaaatattagattcattcactatctcagaaagatcatatgcgatt
ttcgtaggaggtagaaacgtcggtattcacggtattgttaagaatataaatttgagtaag
tttaagtctagaaaatacagtgtgataaccttagaaagtagggacggtaatacttatcag
actaatattatgaacgtaatgagtataggtagggaaaaatctgacttgagagttgat
>SSO0707 (rpl24AB) LSU ribosomal protein L24AB
atggtatctcttaaaccttctaaacaaaggaaattactatatactttaccattgcatcaa
agaaagaagctactagttgctaaagtatctgatgatattgcgtctcaatatggtataaaa
cgtattagagtaagaaaaggagatactgttagggtaatgcgaggaggtaatagtggtaaa
gaaggaaaggtagttgaagttaatactaagaccggaagattagcaatagaaggaataacg
agaaaaaaagttgatggaacaccagtatatgtgtggattcatgcgtctaaagtgatgata
actaagctagatctgagtgatccaagaagacgggaaaagttagaaaaatctaagaag
>SSO0708 (rpl14AB) LSU ribosomal protein L14AB
gtgtcagaaaagattcaagttttaggatccagaaaaggtttaacgccagctctccaacat
tattcggtagttaacgttgctgataatagtggaggaaaggaagctatgataattggcgta
tatggttatagaggtgttttaagaagagttccatttgctaacattgctgatatggttatg
gtgtcaattaagaaaggaacgccagaggttagaaaacagaagtttagagcagtaatcgtg
agacaaagaatgccatatagaagacccgatggtacgtggatttcttttgaggataatgca
gtagttataataaatccagatggaacaccaaaaggtactgaggttaggggaccgatagcg
agagaagcagctgagagatggccaaaaatagctagtctcgctacattggtggtg
>SSO0709 (rps17AB) SSU ribosomal protein S17AB
atggtatctaagggaaagacggtaaaggacccgggaatacctaatattactattcccgag
aaggtatgtgaagatgaagattgtccttatcatggatcattgagagttaggggtataaca
ttagaaggagtaattgtaaagtatagaggtactaaagctgcagttatagaaaggcaatac
ttatactatgactcgaagtataagagatatgaaaggaggagaagtaggatccatgcccat
gtaccgccatgtattaatgttagagagggagataaagttataataggcgaatgtagacct
ctttctaaatctataagttttgttgtattaggcaaggtgagt
>SSO0712 (rps3AB) SSU ribosomal protein S3AB
atgccaaacattaagaggtatttccttgaaaagtctatagtgaaagtcaagattgatgag
tatttagctaagcaatattataacgcagaatatgcaggagtagaagtcttgaaaactcca
attggaactagagttataatatatgcaggaaggccttcaatgataataggaaggggtgga
agaaatataaaacagctggcgcaaattttcgaaaaagtttttggtctagagaatccacaa
attacaataacaaatgtagaaaacccagagcttaatgctagagtaatggcatttaggtta
gcaatagccttagaaaagggataccattttagaagagcagcttttatatcaatgagaaga
attatgaatgctggagcactaggcgcagaaataataataagtggcaagcttactacggag
agggctagatatgagaaattaaaagaaggtattgtatacaaaagcggacagcaattagag
aaaatgatagatagagccatagctatagcgatgctgaaacctggaatatttggtgttgaa
gtagttataactaaaccacttaagattgaagataaaattaatttgaaagagtctccttcc
gtacctcaagaagtgtcagtaactaatgtgacttttattgaagaatcgtcacaaaaaagt
gaggagaaaagtgagggtgagaaagaa
>SSO0713 (rpl22AB) LSU ribosomal protein L22AB
atggctagttggaagtatcctcaattagatgttgacgagttaaaaattgcaaaggctgta
ataagagatgttcctgaatctataagagatctttataatgtttgtaaagctattagggga
atgtatcttaatgatgcgaaagattttctaaatagagttttagaggagaaggaagcctta
cctttctggagatataataaaggtgcatcacacaagtctaatatatctgccaagtggaaa
ataaaagctggtagatatccaaagaaagctataaggcaagtgttgaaggtattagaaaat
gcggaggctaatgcgactaataaagggctagatgttgataaattaattataagacatata
gctgcccacaaaggtataacattacaaagatacatgccaagagcttttgggagggctact
gcaaagtatagaaggacatctaatattgaagtaatcttagaggaggtggag
>SSO0715 (rps19AB) SSU ribosomal protein S19AB
atgtcattagaaataccacctgaatggaagaactttaaatacagaggtaagagtatagat
gagttactaaatatgccaatggatgagtttatcaaattattgccttcaaggcaaagaaga
tcattaaagcgtggatttactgatgcgcaaagacacttgctagagaaagtaaggaagtac
agaagagaaggaaagtttaataaaaccattaagacacatgtcagaaacttagttatattg
ccagagctaattggtcttaaaatggctgtatataacggaaaggaatttgttgagtttacg
gttacgccggagatgataggtcattatctaggagagtattcaataacaactaagaaagtt
gaacatggagaaccaggattaaaggctacgagatcaagtttattcttagcaatgaaagga
>SSO0716 (rpl2AB) LSU ribosomal protein L2AB
atgggtaagaatttgttacagcaaagggcaggcaagggttctccaacttttagaaatcca
ggctggttaagaataggtaaggtaagatatcctaacatttttgggcattttataggcaag
gtaatagacatagtgcataatccaggtatgaatgcacccgttgctttagtgaaattagaa
aatggaactaagtttttaatgcaagcgattcaagggcttgttgttaatcagaagatagaa
tttggtaagggatctccaatagctaacggcaacgttatagaaataggcgatgcaccagag
ggtacaatagtatgtaacgttgaagaaaattttggagatggaggtaaatacgctagaagt
gccggttcgtatgcggtagtagtaggcaaaagcggtgatagggtgctaattagattacct
tcagataaaataaaagcagtttcgaataaggctagagctactgtgggtatagtagccgga
ggtggagtcatagaaaaaccactattaaaggctggagctaattattggaagtacaaagta
aaagctaagaaatggcctattgtgaggggcgttgcaatgaacgtggttgatcatcctcac
ggtggtgggctacatcagagtgtaagtaggccttctacggtatctagaaatgctcctcca
ggcagaaaagttggtcatattgcagcaaggagaacgggtaggaaggagggtaag
>SSO0718 (rpl4AE) LSU ribosomal protein L4AE
atgtatttagagctagttaagaagaagtctgatattttggataaagatggaaatagaata
aaagaggttgaattacccattattttttcgtttccagtaagaaaagacctaataagaaga
gtatttatagctgagtttacacattcgctacaaccaaaaggtagagatcctaatgcaggc
aaaaggacatcagctgagagttttggaataaatcttggtatggccagagttcctagagtt
aaaaattctggtgaagctgccttagcacctaataccgtaggcggaagattagcatttccc
ccctcagtaaacaaaaaacttgcagaagaggcaaacgttaaggagaaacgattagctgta
attagtgcactaagcgctacagcggacatagctttcgtcagagctaggggacatgtattt
aaagattcagtacgtttccctatagtagtaactgacgatattgttaatctaaaaaccaca
agtgaggtggaagagtttttaaagaaaataggtgtttacgatgatgtagagagagtgaaa
gaaaggattaggataagggctggaaagggcaaaatgaggggaagaaagtataaggaacca
ataggtccgttaataattgtacatgacagcaattccccaataattaaggctgcaagaaac
ttagctggagttgatgtagttaatgctaaagacgtaagcgttattcatttggctcccgga
gctcatccgggtagacttactatttataccgaaagtagtataaagattttagacgaacga
ttaagtaagagagtggtgagt
>SSO0719 (rpl3AB) LSU ribosomal protein L3AB
atgggtcatcgaaagttagcctcacctagacgtgggtcagctggtcttagacctagaaaa
agatcatccgagttattaccaacacctagaacatggcctcaaataaattcacagaatcca
aaattgttaggctttgtaggatataaggttggcatgacacacgtttttatgattgacgat
tggcctaactctcctactaatggtaaagagatatatatgccggttacagtcttagaagta
cctccaattataccgttggcgttaagagcttatgcaattgacggtaaaggcgaaccaaac
gtaataacagagtattggtcttcctcctctttacagttcttggatattacgagaagaatt
cattcaatttcatcttttttgaaagatgatgaaagtaaaaagaagttcgatgaaagattt
aatactaagttggatcttatcaaatctaacctagatagaatagtctactttaggcttttg
gtctccactcaacctaggaagataccatcattaggtaaaaaagcgccagatttagtagag
attcagataggtggaggagaaaagaaatcacaattggactatgcattaaacattctagga
aaagaaatcacaattagagacgttttcaaagagggtcaactaatagatgtggtaggagtt
actaagggtaagggttttgctggtgtgataaaaagatatagtgtggtagaattacctagg
tggcataagcatagaaaaggaagtaggaaaataggtactagaggtccatctttaggaaca
cctagttatacgcctcagcctggacagttaggttttcataggagaactgaatataataag
aggattataaaaattggtgatgagcctaaagagataaatcctgcaggtggttttgtaaga
tatggaatagtaaggaacacatatgttttgttagaaggctcaatattaggttcaaagaag
aggccaatattcttaagagaacccgttaggccttcttatgtttttgaaaatcctcctaag
ataacttatgttaaccttttaagtcaacaaggg
>SSO0720 Hypothetical protein
ttgggatatagaaggggaatcttatataatagggataaagaagtctacatgatgtttcct
tttccacgttacaaacctttaaatgttgtcctttttttatctatatttgatgttgaaaat
tctcttcttgaagttacgttaaaactttcatttatacttagagtcacaactacatttaga
gtgaataaaatttactggataacagattccctaaattctagaaaactagaaaaaataatt
acagatattactaaatatgctcttttaccaccgtatcttaaaaaatacgttcctattagt
cgtaatttgaagaaagttggtttaatgagtccactagggataccgtatcactttattttt
aaacaagctgttgaaggtgagataagattaggatataagggtgattttggtctgaacaag
aaattaaattcatcatcgaagactattttaattactgactcactaaaagctggttatatc
gactatcgtggtttctattatactggagtaaaaaatgagtttatagactttaaaaaggta
tttaattttgataatcttataattgctagtaggagtgggaaaaatcccttacaagctaag
gaacagctaaccaatttgtacaataaatatggccttaccttgatgattggaccaccaact
ggaaatctattacaaagattaggtaagcaatacttagataagtcgtataactttgttatt
aaacaaggagtttcagatattagggcggaagaggcattagcttattctctgtctattcta
aaccttctgttaagt
>SSO0722 (ileS) Isoleucine-tRNA synthetase (EC: 6.1.1.5)
gtgataaaggattgcatactgcgttatcagagggttctgggcaaaagggttcatgaccag
ccaggatatgatacacatggattacctatagaagttgcaactgaaaaactacttggaata
tcaaataagcaagagattatagataaaatcggagttgaaactttcattaataaatgcaaa
gagtttgcattatccaatgcagataaaatgacacagaacttcaagaacgttggagtcttt
atggactgggagaggccttactatacattagacccttcttatataagctcttcatggagt
gtaattaagaaagcttatgaaaaagggatgctagataaaggcactgcagtattgcattgg
tgtcctagatgtgaaacgactctatcagattatgaggtgtctgagtatagagacttagag
gatccctccatttatgtcaaatttaaaatcaaaggtgagaaaaacagatatctattaata
tggactaccacaccatggactataccatctaatgtctttgtaatgataaataaggactat
gattatgctgatgtagaggttaatggtgagatactcgtaattgcaaaggatcgtgtagaa
gctgttatgaaagaggcaagtataactaattataagatactcagaacctataaaggtagt
gagttaataggaataaagtacgagcatcccctaagagagtttgttagtgcccagactaaa
ttagatgactttcatcaagtcgttgatgctggtaatatagtcacattaactgatggtacc
ggtctagttcatagtgctactggacatggagaagaggatttcacggtaggtcagaaatac
ggttttccagtagtgatgttcgttaacgatagaggagaatttactgaagaaggtggaaaa
tataaaggattgaaagttagggacgcatctaaggcgataattagcgatttgaaatctaaa
aatacgttgttctttgaagggaaaatagttcatcgttatccggtatgttggagatgtaag
actccactaatacttagagctattgatcaatggttcataagagttacaaaaataaaagat
aaaatgctcaatgaaatagagaaagtaaactggattccagattggggtaaatccagaata
tctaacatggttaaggaactcagagattgggttataagtagacaaaggttctggggaact
cctcttcccatatggatctgtgaaaggtgtaataatgttatggtagttgggagtaaagaa
gaattagagagtatagcaatagatccagtccctaatgacttacatagaccgtggatagat
aatgtaagggtaaaatgtaacaagtgtggtggagttgctaagagaatccctgatgttgca
gatgtttggtttgatagtggtgtggctttctttgctagtttaggtaaagattggcaagag
aagtggaaggagttaggtccagtagatctagttctagaaggtcatgatcagttgaggggt
tggttctttagtttgcttagatctgggctaatattactagatagagctccatatacttct
gtattggttcatggatttatgctagacgaacaaggtagagaaatgcataagagtctaggt
aattatgttgaaccttcagtagtagttgaaaaatatgggagagacatattacgtttatgg
ttacttaggaatactacatgggaagatgcaaaattttcatggaaagcgttagagctaact
aaaagggatttacaaataatttggaacacattcgtcttcgcgtcaatgtatatgaattta
gataactttgaacccgataagtatactcttgatgatattataaaatatgctaagatagag
gatttatggatattatcaaggtttaactcaatgctaaagaaagtaaatgaatccatgaag
gattacaaggttcacgaaatgactaattacttgataaactttctaattgaggatgtcagt
aggttttacataaggctaataagaaaaagggcgtggatagaagctaatactcaagataag
atagcaatgtattatattctttattatatattaaaacaatggattatattagcttctact
ataattccatttatttctgaaaaaatatataaatcctttgtagttaatgctaaagaatca
gtttcaatggaatctagtatcaattatgatgagagatttatcgataatgaattggaaaga
gcctttgaagttgctagagaaataaacgaggcttcgttgaacgctcgagctaaagctgga
ataaaattaagatggccattggctaaagtttatatcttcatagaaaacgaggatacattg
gctaaggttggtagaataaaagatgtcttgatatctatgctaaacgctaaagatatagaa
ataagcaaaatagaaggatttaagagtttcagtaaatataaggtcgagccgaataggtcg
atcatagggaaggaatataagagtatgtcgccaaaaatagtagaatatattgagaataat
agagatataatagctatggatatacttaataaaaagcagcatgtcgctaagatagataat
tttgatataatacttaatgcttcgtatgtgattatctcagaagaaacagttgaaggattc
atttcatctaaatttagtaagggtattgtggttataagtaaggaaatttcggagagtgaa
gaggaagagggattaattagggacattataaggaggatacaattcatgaggaaacaacta
aaactaaatgttttagattatattgagattagcatgaaggtaccagaagaaagagtaaaa
actattcagaaatgggaggaatttattaagagtgagacaagggctagtaacataattcta
ggtgaagctaagggagatattacaatggattgggatatagaaggggaatcttatataata
gggataaagaagtctaca
>SSO0723 (leuB) 3-isopropylmalate dehydrogenase (EC: 1.1.1.85)
atgacttttcgagtagctgtaattcctggtgatggaataggccctgagttatatgaggga
agtaaaagaattatagctaagttaatagagaaatataatcttgatatagacttaattgaa
gttgaagctggagatgtcgcattaaataaatatggtgaagccttacctagacacacctta
gacgttatagaaaaggcggatatgattctaaaaggtccggttggagagaccgcaatggat
gttgtagttaaattgaggcaaatgtatgatatgtacgctaatattagaccggctaaatca
ctgcctaatgttcagtcgaaatatccgaacgttgatttagtaatcgtcagggaaaataca
gaagatctatataaggggtttgaattcgttacatctactggagtcacaatagctattaaa
gtaactactgagtttgcctctaaaagaatagttaacgtggcattaaattatgctttaatg
agacgtcgtaaagttacatgcgtccataaggctaatgttatgagagttacagacggactt
ttcgctagtgtttgcagagaaattttgaaaggtaaggtgaattttgaggagatgtatgtt
gatgcagctgcagctaatttagtacgagatccaactcggtttgatgtaatagtaactagt
aacgtttatggtgatattttaagcgatgaggccagccaaatagcgggaagtttaggtcta
gcaccatctgcaaatattggagataggaaatctatgttcgagccagttcatggagctgct
tttgatattgcgggaaaagggatagctaatcctacggcatttctattatctgtttccatg
atgcttagtagaatgtatgagttatctaaggagaataaatacattctggcatcaaagtct
ttagagaatgcgataatagagacttacaaaagtgggaataagttaacggaggatgttggt
ggtagtgctaagttaaaggatatggtggatgaaatttataaatatatg
>SSO0724 Hypothetical protein
atgaagaagtttttaaaaatgttctttcctcatgatggaatatacgaagtgttagttggt
acttcagggataaaacctataataaaaccacttggcataatagttgaagcaaatgaactt
aggtctaaaatatacaagagcacactaacttattctaatcttgaaaaaaataataaatgt
tctatacatgtaaccttagatacaacgtttttcatcctttccatgctagataaactaacc
tttagtatagatagtgattataacgttccagttctcaagaatctgaatgtcatttacgct
gagtgtatgaaaacttctagtactgatccgtcaatatttaccataaatccgctagatttg
gaaataaattctaacttaactagagcatataataggggagattacatttcggttgatttt
ctagtgaattatactagattagatatatacaaaggtgaagatttggaaaaacttgttaga
attctagagtacgagtggagtgttataaagcgtacatctcaatatacttctagtctctta
gaggagatattaaataagatgagatcaaaaggttttaagctagac
>SSO0725 Hypothetical protein
gtgctattgcattatctaaaaaccttatctaattacggtgaaataataacgggatcgaag
aatgaaacaaaattagtgaaagaaattagaaaaatactagaagataatagtgacgaaatt
agattaatcccaattagagtgctcaattgggaacagaaagaactaatatttgaatgcgag
tcaaaattgatagatgccatttcgctaccctattctttgtctaccgagattgaagcagat
gtagtagataactttaaagattgtaatggtagaaatttaattaaagttagaatccaaaat
ctctatgaaataaataaattgtatatagaggcagtagagaataattgtttaggaattatc
ttttcactagacaatgagaaaagaaaattcatgataaagtacggagatcttctaagtcat
aaacccagttatccaccaccaataccagcattttatgttaaagagaacgattttccctat
ataaagggtaagtgcagaatctcgctgaaaactgacttaaacccttttgcgacaggttat
atcgtagaagccataagaaattctagaaatgaaaataaaataatacatattactgcacat
cacgatcattggtttataggggagagagacaatcttttagcagtagctttattaagacaa
tttaggtctaatatctatgaaacccatttaatctcatttactgcagaagaatccggctct
ttcaatttctcaacattctcatggtctcacggttctagagaatttttgaaaaattacaaa
aacgttgatgatattctgcttaacatcaacatggataatataagtgaggaaagtttagtt
ttaaaaactgtacctggacttctagaactctctagaaaatactttaaaaacgttgttgaa
agtccagaaatttatagcgatgggtattcatacataaaagctggaattccaagcattaca
atagagagtttaggaaatatccactatcatggggaatacgatattatagaaactgataaa
ccaaatgtattttcaaatgtaactacaatattagatacaattaataaaataattaatgaa
aatatagagtataaaacacatgaaatgagagaccaacttaaaaacaatctttgggaatta
ccagcagaactaaaatcatacttagtgaatgtgaaggacatactcgataaaaattatacg
gaggtgtatagaaaaatagtaaaattatacggaggcatactagcgtttaatcaaccttat
tctaaagttgaattatttcacaaaattaagggactaaatatagcaagaaaaaatgatgtt
tgtattgaggatctaggatgtattaagagactaagaaatgatgaaatatataataggttt
tacttatattatattaatgaattaaaggaattaataactacagaatatattaatcagctt
tattttatattaaagaaattcttc
>SSO0726 2-haloalkanoic acid dehalogenase, putative (EC: 3.8.1.2)
ttgtcaattaattacaaattatttaacaatgtaaaggcagtgctttttgattttgatgat
acattagttgactttagttctaaggcgaaagaggcattagatgcagtaagtaaggatata
tatacttacataaaggaaaattatcaacaagagattaacataaatataattagaaaatta
gtagaagaggaaagtcggaaattagatagtcaaggagagtataatagaaataaatggtgg
gaaaatattctaaaatcattaaacatcgttcacatagataagtctcagctctatgattgg
actagtttgtattggtcaattgcaagtcaaactgaaccttatgaagatgcaaaggaaata
atagaatatctagatagtaagggatataaacttggtctagttacaaatagtgatggagaa
ggcgggaataaaagtagtagattaagaacttttcctttaatagataaattcgatttgata
ttgatagctggagaggggggtattagaccaaagcctaatctagagccgtttataatatca
tgcgaaaagctttcagtggagcctagttcgtgtgtttttgtgggagatgaaccagtaaaa
gattgtttagcagctaagaaggctaatatgattagtgtgctaatagacagagaaggtaaa
gtgaaggacgccgaactttatgcagacttcgtgttatccagtcttaagcaattagaagaa
tttctt
>SSO0728 (EF-2) Elongation factor 2
ttgcctagatataagacagtagagcaagttctaagcctaatgaaagatagaacaagagtt
agaaatataggtataattgctcatgtggatcacggaaaaaccacaactagcgatacgtta
ctggcagcatcaggtataatatctcctaaagtagccggcgaagctttggctttagattat
ttaaacgtagagcaacagagaggtataacagtaaaggctgctaacattagtttatatcac
gaagcggagggtaaaggttacgtcattaatctaattgatactcctgggcacgttgatttc
agcggaagagttacaagaagtctaagggttttagatggttcgatagtagttgtagatgca
gtagaaggaattatgacacaaactgagacagtattgaggcaaagtttagaagagagagtt
agaccaattctatttataaacaaagtagatagattagtaaaggaactaaagttaagtccc
caagaaatgttaaataggttattagatataattagacaagttaataatttaattgatatg
tatggagaaccggaatttaaagaaaaatggatgattaatccacaagctggaaatgtgata
tttgggtctgcaaaagataaatggggatttagtttacctatggcacagaaaaaaggaatt
aatatgaagaatgttattgatgcgtacactgcttctgataagtctaaacttgaagaatta
gccgcacaagctcccattaatgaagcattattagatgctgctataaagttcgttcctaat
cctattgaagcgcagaagtataggattccaaaaatctggaaaggggatctagataatgaa
ttagctaaagcaatgttaaatgctgatccgaatggtcccatagtatttatgataaccgat
atgaaggttgatcctcatgcagggttagtggcaacaggtagagtattctcaggtaccctt
agatctggtgaggaattatggttagttaacgctaagacttcacagaggatacttcaagta
agcttatacatgggtccaactagagaacttgcggaggaaattccagcaggcaatattgcg
gcagtattaggtttagacagggccagatccggagagacagcaatttctgttggtttcagt
aatgtccaaggaagttttgaaagattacattacatatctgagcccgtggttactatagct
gtagagcctaagaatcctaaagatttaactaagatgattgatgcattgaggaagcttagt
atcgaagatccaaacttagtggttaagataaatgaagaaactggagaatacttgctatct
ggaatgggtttcttacatttggaggtatcattacaattattacgtgaaaattacggtatt
gatgtagttactactccgccaattgttgtttatagggaaagtataagagccaagagtcaa
gtatttgaagggaagtctccaaataagcataataagttctatttgagtgtagagcctttg
aatgacaagactatagagctaataagtaatggtacgataagggaggatatggatagcaaa
gaaatggcaaagatattaagagatgaagccagttgggactatgatgaggctaagaggatt
attgcaatagatgaaaacgttaacgtgtttgtagatttaactagtggcgtgcagcacttg
agggaagttatggatacagtacttcaaggatttaggttagctatgaaagaaggtccttta
gctcatgagccaattaggggagttaaggttatcctacatgatgctgtaatacacgaagat
ccagcccatagaggaccagcacagatatatcctgcagttagaaactctatatttgctgga
ttcttaacttcaaggccgactttactagagccaatacagaaactagatataagagtacct
gcagatcttataggcaacgtcactgcagtcataactagaaaaagaggtaaaatccttgat
gtttctcaaatagctaacatgtctaggataactgctgagatccccgtttcggagtcatat
gatatggcaagtgagctaagaggttccactggaggtagagcattctggggtactgagttt
agcagatgggctccagttccagatagtatcttactggatgtagttactaagattagagag
aggaaagggttacctaaagaattgccaaaagtggaagatttcttgtcg
>SSO0729 (eiF4A) RNA helicase (ATP dependent)/eIF4A
atggtaattagaatttatgctgatgatagggaaaaggctagtggcataccagaattatta
aaggagttaggaattacagtaatattttctcaacttactgtagctgattatgtaataact
gatgatgttgcagtagagaggaaatcagtaaatgatctagtaaattcagtttttgacaaa
aggttttttgaccaaattagcaggctttcagaggtttatcgttttccaatattactcgta
gagggcgatattaatgatattaggaagataactgaaaagtggagagcaattaacaatgcg
ttaatttctgctacaattgattatgatgttaaagtgttttattctagggacaaaaaagat
acggcagaagttttgaaaaaaatagctgaaaaattccaatttggtgaaaacaagagtaat
cgaattagtttacataataaggctaaattggaaagtgtttctgatatacaactttacatt
gtagagtcttttcctaatgttggttctatcctagccgaaaggctactacttaagtttgga
actatacagaatatttgcaatgcatctatatcagaactggaaaaagcactaggtagtagg
aaaaaagctgaagatatttataaaattttaaggacgcattattctaaaactaacttagat
aatgatagtaagaaaactacctctttatttgatttcctt
>SSO0730 Hypothetical protein
gtggccgagaaattacctccagaagttcaagctcaactagctaagtttcaacagttaaaa
gatcagcttgatagattattgttagaaaagtctaccatagagaatgagttaagggagata
aataaggtattggaagagttatccgttctcaatgcagatgcaaccatttataagattgtt
gggaatctattagttaagtcagataagacatcagtagaaaaggagcttaatgataggaag
gaattgttagaactcagatcgaggacttatcagaagcaagaaagtattttaagaaagcaa
ctagaagacttgcaggctaaaataaatgacatgctatcgaagtattatccgcaaggtggc
caaacaggtataaaagct
>SSO0731 Hypothetical protein
ttgcatatacaccgtactagaatagttataacttcgtctagagaccctagtattaggaca
agaaattttttaaatgttttaacttttgtattgccagattcagttaaaattacgcgtggt
aaaaaaagtaagatagaaatatttgaaagggctattaatttaggggcattatatttattg
ttcgtattagccaagaatgggaatccactaaggataattgtttatgatttagagagcctc
tctataaaatacttttttaaattaagtggtttgtcgttaccttctgactacaacgtatca
ttaaaccagataaaagggcatagtaatgtgtgcataaaactaaacgaatgtgattttcta
agggattttctagttgatatgaatatgtacaacttaacaaataattgtgacgttgttgtg
aactcaaggcttatccataccaatatttgtgaacttctgtttatgttaactacgaaaaat
attaagtttttgaagatgatattagaagcg
>SSO0732 Conserved hypothetical protein
ttgtcttctactccatcaaaccagaatattatacctataattaaaaaggaaagtatagta
agtctttttgagaaaggcattaggcaagatggaagaaaattaacggattataggcctctt
tcgataacactagattacgcaaaaaaagctgatggttctgctttagttaagttaggcaca
acaatggtattagctgggaccaaactcgaaatagacaaaccttacgaagatactcctaac
caaggcaaccttatcgtgaacgttgaacttttaccgttagcttatgagaccttcgagcct
ggacctccagatgagaatgcaattgaattagctagagtagtagatagaagtttaagagat
tccaaagctttagatctaactaaacttgtgatagaaccaggtaaaagcgtatggacagtg
tggctagatgtttatgtattggattatggtggaaatgtactagacgcatgcacgttagct
tcagttgcagcattgtataatactaaagtgtacaaggtagaacaacattctaacgggatt
agcgttaataaaaatgaggttgtgggaaaattaccattgaactatccagtagttacaatt
tctgtagcaaaagttgataaatatttggtagtagatccagatttggatgaagaatcaata
atggatgctaaaatttccttttcctatactcctgatctaaaaatagtagggattcaaaag
agtggaaagggcagtatgtctttacaagacattgatcaagctgagaatacagcaagatca
acagcagttaagcttttagaagaacttaaaaagcatctaggaatc
>SSO0735 (rph) Ribonuclease PH (EC: 2.7.7.56)
gtgagagaaatgcttcaagtggagagaccaaaactaattcttgatgatggaaagcgaaca
gatggtagaaagccagatgaattaagaagtataaagatagaattaggtgttctcaaaaat
gctgatggctcggcaatttttgaaatgggaaatacgaaggctatagctgcagtttacggt
cctaaggagatgcatccaaggcacctatctcttccagatagggcagtacttagagtgaga
tatcacatgacaccattctctacggatgagagaaagaatccagcacctagcagaagagag
attgagctttctaaggttataagagaggctttagaatcagcagttttagtagagctgttt
cctagaactgctatagatgtatttactgaaatattacaagcagatgctggatccagatta
gtttcattaatggccgcctccttagcactagcagatgctggaattcctatgagggattta
atagctggagtggctgtagggaaggctgatggtgtaataattctagatttaaatgaaacc
gaggatatgtggggagaggctgacatgcctattgcaatgatgccatctttaaaccaagta
acgttatttcaactaaatggtagtatgacaccagatgagtttaggcaagcttttgatcta
gcagttaagggtataaatataatatataatttagagagagaggctctaaaaagtaagtat
gtagagtttaaagaagagggtgta
>SSO0736 Conserved hypothetical protein
atgaacatgagtcagtcccagaaaattgtcttacagccaaggtcaatagtagttcctggt
gagttattagcagaaggcgaatttcagattccttggtctccttatatactaaagattaac
agcaaatactactccacagttgttgggctttttgatgtaaaagatactcaatttgaggta
attcccttggaaggctcgttttattatcctaagattaatgacatagtaataggtttagtg
gaggacgttgagatctatggctgggtggttgatataaaagcaccttataaggcttactta
ccagcttcaaatcttttagggaggtctattaatgttggagaggacttaaggagatattta
gatgtaggtgactatgttatagctagaattgaaaattttgataggtcaatagatcccgtc
ttatccgttaaaggcaaggatctagggcgtgtaagtaatggtatagtcatcgatataatg
ccagttaaagtcccacgcgttataggtaagaataaaagtatgtatgagaccttaacctca
aaaagcggatgtagtatttttgttgctaacaatggtaggatatgggctacttgcccttca
cgcttttctgaagaaattttaattgaggcaattaggaagatcgagaatgagtcacatata
aaaggattaacagatagaataaaacaattcattgaggaaaaattaggtgagagaaatgct
tcaagtggagagaccaaaactaattct
>SSO0737 Conserved hypothetical protein
atgacgaaggagcgtgattatgtaatagttaaatatgagtcacatggagagaggtttgag
atattagctaagccaaaagaagcattagcttttagaagtgggaagagcataagtctttct
gatgtagtggtttctgatactatttataaggacgtaaagaaaggtttaaaagcgtctcca
gcatcacttaaaaaagtttttggtactaccgatttcgagacaattgtaaaagaaatttta
cttaaaggtgaattaccagtaactgcagaacaaaggaaagaaatgctagaaactaagaga
aagcaaataattgattttattcataggaacgcagttgatccaaaaactaatttgccaatt
ccgccaaccagattagagatggcaatggaacaagctagaatacaaatcgatttaaacaaa
gacgtggaagcacaagctatgcaaatagtaaaggagatttctaagataattccaattaaa
atagcaagggctttgcttagtattaaagtaccatcagaatatagctctaaggttaaatct
caattgcataacttaggggaggtaaaaaaggccaattggttagaagatggtacgctactt
gcggaattggaaatacctgccggtgcacagcaagacgttatagataagttaaatagtctt
acaaaaggagaagttgaagttaaagtattgcaagtgaga
>SSO0738 Proteasome subunit (EC: 3.4.99.46)
atggcgttcggaccagccgctatgggatatgatagggcaataaccatattctcgcccgac
ggatcactatatcaagtagactatgcatttgaagctgtaaaaaagggatggacagcaatt
ggtattaaatcaaagtctagtgttgttattgcaagtgagaaaaggaaagctcaatcttta
ctagatgtagatagcatagagaaagtatttttaatcgacgatcacgtagggtgcagtttt
gctggattagcttctgatggaagagttttaatagactatgcaaggaatatagcattacaa
cacaggttaatatatgatgaaccagttagcattgattatctaaccaaatcagttgctgat
gttaagcaaatgtatacacaacatggaggagttagaccatttggcgttgccctagtaatt
gcgggaatagataaatcagttcctaaattatttatgactgaacctagtgggcaatatatg
ccatatcaagctgttgcaatagggcagggttactatacagctactgagtttttagagaag
aattataaggaggatttgaatgtggaagagactatattgcttgctttaaaggccttatcg
gctactctaaagcctaatgaaaagttaactccaaatactgtggaaataggatatgcctca
acccagactgggttatttctgaaaatgactaatgaagataagaatatgtatttacagaag
tta
>SSO0739 Hypothetical protein
atgaactcaattcaattaataattgacattatattaatattatggattcttatattaact
gtattatattttaaaagaagacaattaaatgttgatattgtaaaaaataagaaaataata
agagctaaaaggtatatagtattttatgtaatctctgaatataaagtaaaaggcgatgat
ttagagagagttattcgcaactccttgaaggacttattaggtagtgtgtggcttaacatt
gcaaaccccaaagttgttacctatcgagaagatactcaagaaggaattatatccactaat
agggtaggttacaaggcagttttagctagtttaccctttgctaaggaaattaataataat
aaaattctaatagttcctagaaggacaaccggtagcttaaaaaaggcgaaaaaactaatc
ggattaaag
>SSO0740 Hypothetical protein
ttgttaatagtcgaatcatgcattctaaactctaagctgtttccttatgcaaaaaggcta
ggttataatacgatttttagtgaagatggtttagttggtataaaaagagttactataaaa
gtagaaaatggaaatcaactgaaaaaggcgtttaagaagcaatttgttagtaaggaagtt
ttggtttttgtaaaacccctttcaatagatgccttaaagtacgctgttatcaataagagg
gttaatgctgtggtattagatgatgataatattagaatatttaagaaaagcatgctaaat
ctgttaagatcttatggcaaatttgttgagatttcccttaaatcttctagcgggttatta
tataacgctatactgtttgcatataaatggatacctaatattattttctcctcgtatgca
agctcttttgatgaaatctggagtccaatctccaaaataagttatttgactgtactggga
gctgatgaagaggaagcttataagtttgttataataaatcccataaagttgttgaatgaa
ctcaattcaattaataat
>SSO0741 Conserved hypothetical protein
atgaaaataaatcaagcaataatttcagtttttattcatgagactgaggattacaataaa
atagtaaatactatagagagttttttctctcctcttatctctaactcaaagaaaaatgtt
acaactgctcaaggtcattacggtaataaaataattatattggaatacagatttgatagg
aagagtggggagcaattttttaaaataatattggagaaaattgaaacatcagaactaatg
cttattcttacaactatagattctcatatagatggaagtaagttatatttgagattcgat
aaacaatatttaattgctgagcatagacttgttcttaaagagggcgatgatgtcattaaa
tgtataatttcgtttaatacttccttggagaatataaaggaggagataaagaaacttgtt
aatagtcgaatcatgcattctaaactc
>SSO0742 (rpl15E) LSU ribosomal protein L15E
atggcattatcaatgtatcactatatagagaatacatggaattcagaagagtggaaaaaa
agtgtattaaggcaaagacttatcaaatggagaaaagaaccttcgatagttaggttagct
aaaccaactaggctaaatagggctagaagtttaggctataaggctaagcaagggtttgtt
atagttagagttagagttagaagaggaggtctaaataagcctagaccaaataagggtaga
aggccaaaaagaatgggtgtttatggttatagtccagctaaaggatatagatggatagct
gaggaaagggctgcaaggaaatatcccaatttagaggtacttggtagttattatgttgga
gaggatggtctctataagtattatgagatcgtcatggtggatccttctcacccggtaata
aagagtgatcctaagcataagtggcttcaagatcctagcaatagaaatagagtatttaga
ggtctaacgtctgcaggtaagaaggtcaggggattgaggaaatctagaggacttaagggt
accgtaagatataagtggaatagaaaacagaaggaaagagaagaaaagaaaagacatgag
gcaagtaagtattataaattacaagagtatgataaaataccaggaaag
>SSO0743 GTP binding protein
gtgtccactaaatcagaacatatgattaccattggaattataggaaagaccaatgtgggt
aaaagtacgttttttgcagcagcaacgctaaaagatgtggaaatagctaatagaccattt
gtaactataaatccaaatgaaggcataggatatgtaaaagtaaaatgcgctcatactgaa
ttcaatgtgaagtgtaatccaaaaaattctatatgtattgaagattacagattcatacca
gtaaaactagtagatgtagctggattaatacctggcgctcatgaaggaagaggattagga
aataaattcttggatgatttacgtcaagctgatgcactaatacacgtaatcgacgcaagt
gggtccacaaatgaagagggcgtcccagtagagcccggatctagagaccctgaagaggat
ataaaatttatagaaagtgagctagatgaatggttttattcaattattaataaagattgg
gctaaatttgccagaacatcagatttatctggaaaagatctagtagacgcgttattaagc
aaactatccggagtatctgtaaatagatcacacattattgagactttaaaagttacaaaa
ttggaaaacctaaaattaatgcagtggacggaacaagatctaagagtatttgctaaaact
ttacgatcagtaagtaaacctatgataattgctgcgaacaagagcgatctaccgcaagct
agaaataacattaggagattaaaagagaaatacaagtgggctattccaactagtgcagca
tcagaaatggctctacggaaagccgcaaaagctggaataatatcttacattcccggagat
agtgattttaccatacttaaaccattaaacgagaaacaaaagagcgctctagaatatatt
agaactagtgtactacaagtatatggaagcactggagttcagcaagcaataaatacagca
atctttgatgcgttaaacatgattgtaacatatccagttgaagatgagagaaaactaact
gacaaaaatggaaatgttttgccagacgcaatactcttaaagaaagggtctactccaaaa
gatttagctaatgccatacatacggaactagctaaaggtttcttatacgctattgatgtg
aaaagaaaaatgagagtgggagagaattatcaactacagaataatgatgtaataaagatt
gtttcaagtaccgctagaccttct
>SSO0745 Sugar phosphate nucleotydyl transferase (EC: 2.7.7.-)
ttgaaagcagtagtgttagcagcgggtaaaggagagagattagaaccaataacccataca
agacctaaaccttttgttcctgttcttgaaactcccttaattttaaggcatattcggata
ttaaagaaatatataaataagattataattgtaataaactctaaccataaggattatttc
aaaactattgaaggagttagtctagttgaacagactgaaggaaaaggtaccgctgcagct
ttacgagcagccgagaaatatcttgagggagatgaagaatttttagtaatttacggagac
cttctttttgaagaagatgcattggataaaatagtaaatactgagggggaggcaattcta
gctagagagtctgaagatcctagaaaatttggagttatagtgaaagactcagaaaataga
ttagtgagaatagtcgaaaagcctgagaatcctccgtcaaatataattaacgcaggtatc
tataagtttacctatgatattttctcatatattgataaaataagtttatcaagtagaggt
gaatttgagcttacagatgctgtaaatcttatcggaaataaggttaaggtagttacgtac
aatggaatatggttagatataggaaggccttgggatttaatagaagctaataaggtactt
ttagataaggagaaggatcgaaatctaggtgtaatcgaagaaaatgttaaaatcaaaggt
aaagtagttattgaagatggggttataataaaatctggtacctatatagagggtcccgtt
tatataggtaaaaattctgttatcggacctaatgcgtatataaggccatatagtgtgata
ggaagtaacgttaaggttggtgcgtttaacgagataaaggaaagcgtgataatggaaaac
gcaaagattccgcatttaagttatgtcggagacagtgtaatctgtgagggtgtaaatttt
ggagctggaactataaccgcgaatttgcggtttgatgaagaggaagttaaggttaatata
aaaaacgaaagggtaagcagtggtagaaagaaattaggtgcaatagtaggtgcccatgta
agaactgggattaatgtatcaatattgcctggggtaaagattggtgcatatgcttggatt
tatccaggagctgttgttgatagagatgttgagaaaggagagaaatatgttccatattac
ctaagaaggtctagcggtact
>SSO0746 (rps3AE) SSU ribosomal protein S3AE
atgtcagctaaaggaggagcaattaaggataagtggaaaatgaagaaatggtacagcgta
ataacgcctaaagcctttggagaggtttcgctaggctctaccccagcctacgacataact
caaactataggaagaagagttgagacgactctatacgatctcactggtgatttcagccaa
gtttatgtccacttatattttaaaattataggtaatgaaggggatagattaattacaaga
tttgtagggcatgaactctcaagggattacttaagatctttaattaggagaaaaagttct
aaaataaatagtatattcgatgttactactaaggatggttatgtggtaagggttaaggga
ttagttctgactacgtataaatgccatcaatcccaaaaaacagcgattagaaaaataatt
aatgagaccgtatctaaaaaagccagtgaactttctttcgatgattttacgcaagaggta
gtatttgggagattagctaacgaaatatttgaagcagcaaagaagatatatccactaagg
aaggctgagatagaaaaaactaaagtgcttaaagtaccagaaaatttaggtaaacaagtt
gaaagcagtagtgttagcagcggg
>SSO0747 Conserved hypothetical protein
atgataagggtagtattagtggagcctgagggtgaatacaatattggttttgttgctaga
ttatgtaaaaattttttggttgatgaactttatatagttaatccaagggctaacatttcc
gaagcttttaggttttccgctggcgggagagagatcttagagaaagctaaaattgtgaat
acttttgataaagctataaatgatgttgatattaagatagctacttctagtatagcagat
aataatggagatattttaaggaagtccataagaccttgggaaatattgcctttaattcaa
ggtaagaagatcgcattaattttcggtagagagagcgttggtttaactagggaagaaata
ttcaaatgcgattttcttctttatattccagctaatcctagttatccggttcttaatctt
tcacatgctgtcggcatagtattatatgaaatttggaaaaatagagaattattgaccaat
cctcagacttctacaatttcagatcaatccataaaattaatagataaatatactgaaatc
ctttataaattgcttaaaaggtctgatgatgattataagatgtatatagcactaaagcgc
gcaataataaagggagtaaaggacgaggaagaggctagggtcatcgtgcactttttgaga
aaactttataccagaataatccacaatgaaaaggagatgaataatgtcagc
>SSO0748 Conserved hypothetical protein
ttggcaagtgttagaattattgaattccgtgggataagattatgtttaaatgatcagaca
tacgaaccttctgacgatactgatattctccttagcttactcagagtaggtaaaggagat
aaggtcttagatatgggatctggttctgggattttaggaatatggtctctaatgatggga
ggaaaggtagtgtttgttgatataaatccatatgcaacattatctacattatgctcctta
aaagttaataatttatataatactccaaactattacggtgttcttaattgcgatttgttg
tcttgtctcagaaaatatgatttcgatgtagctatttttaatcctccctatttaccagtg
gaggaatataatgagtggatagagtatagctggtctggtggaaatgatggaagtaaagtt
cttattgattttttgaaaactgtaaaagctaatagaatttatactctgtattcttcttta
agtgatgaagagaagatagtatatgctattaataagtggagattcaaaatttcacagaag
tacgagaaggttatcggttatgagagacttataggattagagttggtgaaggagtatgat
aagggtagtattagtggagcc
>SSO0749 (erm/ksgA) rRNA adenine N-6-methyltransferase (EC: 2.1.1.48)
gtggataatgggattaggcccattttagagattggctgtggaaagggaaatattacaagg
tttttagaaccggatatttgtatcgaattggatgataaaatgatagagtatttgaaaaac
ttcaatcttgtaatagctgatgcaagatatttaccagtattaaggggacaattagtttct
tctctaccttatcagataacttcagattttttcaaagaagtgattaaacttaataatata
cgtaaacttacattaattttgcaaaaagattttgtagataagatttttaacgattctacc
tatatttcttttttgcttaactacatttataatatacaaatcaaagacataattccgcca
agttgtttcagtcctcgtccgaaagtctattcgattattacaatttttaataggataaga
gaatatgataaggaggttgatagcatactttcgtgtattagtagatataggaataaaacc
ctaagaaaggcctccaagttgtgtggttttagttctaataacgacttaaaggtgagggaa
tttaaaccttggcaagtgttagaattattgaattccgtggga
>SSO0750 Conserved hypothetical protein
ttgcaaagaaaaaggatagtaagagagcgagtagtttatgttttagattatatgagagag
ggtaatccattagataagcataagtttcatagggataagcctctcattcaagccgtaggt
gaagattatttcttgttgcttgaactaactcccttatcttataatttagatttccttccg
gaggataagatagagttagactcaaattccagcgttaaagtagacgctcatatttcttac
gaagaccttacatcagtatctagggataatttacctaagattttatataaaattgttttc
gagaaagaaaaagttttcgtagagatttttaataaagctgagccattaacgttaaggctt
catgcattagagttactgccaaatattggtaaaaagactttaaggataattttggaggag
agaaagaaaaaaccctttgagagttttaaagatatagaatcccgaataggtgttaaggat
gtagcttcaatactagtagagaggataataaaggagatgcaaggtggagagaaatactat
ctgtttgtataccctcttataccagatgaaaataaaagattggagcagcaattcatttat
gtgggctatattgaaaagctaaag
>SSO0751 (rpoF) DNA-directed RNA polymerase, subunit F (EC: 2.7.7.6)
ttgtcatctgtatatatagttgaggagcattatattccttattcagtagcgaaaaaatta
ctaactgatgtaattagatctggaggttcgtctaatttattgcaaaggacttatgattat
ttaaatagtgtggagaaatgtgatgcggagtctgctcagaaggttattgaagaattaagt
aatatcgtaagtagagaagatgttagagctattctagctagtatctgtcctactacatct
gatgaggtaaggagtattttagtaatggatactaataagacatatacttctgaggatata
caaaaaataattgatataattaggaaatacatcaagagt
>SSO0752 (rpl21E) LSU ribosomal protein L21E
atggttaaacattcgaagggttatcggactaggtcaaggagtctactaagaaagagtcct
agagaaaggggtgcagttccatctctaagcaagctaatggttgaatataaggaaggtgat
aatgtagtggtaaagataaatccatcagtacatcaaggtatgcctcataggcgttatcaa
ggtaaagtagggaagattattggaaaaagaggtagagcatatttagtttcggttacattg
ggtgataaggaaaaggtgataattgttaggccggaacatttagttccttttaattcaagt
ggg
>SSO0753 Hypothetical protein
atgcctagtgagtattgtacaagaattgtagtaggaactgtatttcaaccgtttactctc
gatttcaagtttaatgatattgatatcggtgctccattgttcagtagacaattctgtgcg
acctattgttcagaatttggattagtgggactaatcaaatccttctcgacaagagctatt
aatgtgccacttggtaataatttgcaatatccagtagaattcgtctttttggacgttatt
aagcctcccactgatttaactacagctggtatcgcaaattacactaaggagctgaacata
agcaagggatttggcgtgataatagatgcccttaataaggagaaaaaggctattgctggg
atttctgcagtttttccattagccattgctgagttagctgtacttgccattgat
>SSO0754 Hypothetical protein
atgatttcactgaaagagtattataaatataaaagagagggtaacaaaaagatgtatgag
atttaccctgccatagctgttgctgaaagaatattagctgttgccgtgtcaaacagttca
agtgcttatgaattgaaaactaagatttttagacaaggcattgtgattaggactgaggat
actggagaatattattacattggaggaatatcaccagtgtggataggtggtagtaatatt
gcagtatatcaaggtggtgcggcgtttaggggtttagtaaaattgcctgctaaggctagg
gatatttttataagtaatggagaaattggaattataccgttaaaaagggtatcagcacag
atcgaatggtacaatccagctaggtttaaatcttgccaaggtctacttggtgcaatttgg
gattacataactacagtaggtgttgctttagtggttgcaattgcaagtttagcatcagaa
ataacgctttcttctccaagaagtatagatgatttagtctatcccggtagtagtggtagt
tattatgtttcaaaaacgctcatagggagttcgttaggagcaaagagttctgatgaactt
cgtactatttctgatcaatatcctttcatctatctggctttggcctcatttaagcaagta
gctagtgggttaggtttatcaaattatcttgcagttacggttaatggtccaattgatgtg
gtcctaaataattgtaat
>SSO0755 (ahcY) S-adenosyl-L-homocysteine hydrolase (EC: 3.3.1.1)
gtgataaaatttgcatacttggataaacagataaaaatcctaagctttttatgttctttc
gataaaaaacttccgatgagctacaaaataaaagacctttctctcgcaagtgagggaaaa
aagcaaatagaatgggcagaaagacacatgccaacattgatggaaataaggaagagattt
aaagctgaaaaaccactaaaaggtattaacatatcagcagtgcttcacgttaccaaggaa
acagcagcactagttaaaacacttaaaataggtggagctaacgttgctttagctggaagt
aatcccctttcaactcaagatgatgtagcagcagccttagtagaggaaggaatctcagta
ttcgcatggaaaggagaaaatgagacagaatattattccaatattgaaagtattgtaaag
attcacgagccaaatattgtaatggatgatggtgctgatttacacgcttacattcatgaa
aaggtaagttctaaacttgatatttatggcggaactgaagaaaccacaactggtgttatt
agacttaaggcaatggagaaggacggtgtccttaagtatcctctcgtcgcagtaaacaac
gcgtataccaagtaccttttcgataatagatatggaactggacaaagtgccatagatgga
atacttagggctacaaacattctaattgcagggaaaattgcagttgtagctggatatgga
tgggtaggcaggggcatagctaatagattaagaggaatgggcgctagagtcatagtaact
gaagtagatccaataagagctcttgaagcagtgatggacggctttgacgttatgcctatt
gcagaggcctcaaaggttggtgacatattcgtaacagctaccggaaatacaaaggctata
agagtagagcacatgctcaatatgaaagatggcgcaatattatctaatgcaggtcacttt
aacgtagaggtggacgtaaaagggttaaaggagactgcggttaaggtaagaaacataaga
ccttatgttgatgaatatactttacctaacggtaagagagtatacttgttagcagatggt
aggttagtgaatttagctgcagcagagggtcatcctagcgaagtaatggatatgagcttt
gccaatcaagctttagctgtagaatacctagttaagaatagaggaaaattggagaagaaa
gtatacaatatgccaatggagttggattatgaagtggctagaataaagttgaaatctatg
ggcattcaaattgatgagttaacagaggagcaaaaagagtacttggaacaatggaaatca
ggaacc
>SSO0757 Spermidine synthase (EC: 2.5.1.16)
atgtttggttggcattggctcctagaatggcaaacgccatatgagtttcacggtcaccta
atagaaaaagtattagctgaagagaagactccatatcagcatgttacattagttgaattc
actaggtttggaaaagggcttatcatagatggaaaagtgcaatcaacactatatgatgag
catatttatcatgaattattagttcatccattattactatcattaacaaaacctcctaag
agtgtgttaattttaggcggtggagaaggagcaacgcttagagaagttcttaagtataag
tctgtagaaaaagcagtaatggttgatatagacgagaaggttatagagtttgctaagaag
tatctatatgagtggcatcagggagcttttgaggataagaggactaacctagtaattact
gatggtttaaagtttataaaagaaacaaaggagaaatatgatgcaataattctagaccta
acagatccaatcaagaattctacatcatatatgctttatactaaggagttctatgagaaa
ttaagagaaatattgaatgagagaggaggcatagtaacacaagccacatctccatcattt
tctctagaagtatatgtgacgatttataacactataaaggaggtatttaaggaagcatca
gcttcatacacctatatggcatcctttgatggattatggggattcgtctatggaggagta
aggccagacctactttcggaggatgaagtagattccaaaataaacgaacgtattgatgga
cagctaagattctatgacggctattctcataagatttcgtttagtttgcctaagaatata
aaaagtgaattccagaagataactaaaatatccacagaaaaagatccgatttacgttcct
gct
>SSO0758 Peptidyl-prolyl cis-trans isomerase, FKBP-type rotamase (EC: 5.2.1.8)
atgtttaagaataacgactttatttatatagaatatactgcaaaaatcaaggatactgga
gaaattgttgatacaactaatgaagaggaggcaaaaaaggctaatatctacgacgagact
agaaactatggtcctaggcttgtgattttaggtgaaaatagattaattaagggattagaa
gaggctttatataattttaatttaaacgaagagaaaacaatagaaatcccgccggagaag
gcatatggagagagagataacagcaaaattaagattgtacctctgggggaactaagaagg
caaggtataacagcagttccaaacagagtgttaagattaagcgatggtagtcttgcagta
ataaggagcgtaagtggaggtagggtggtcttagatctaaatcacccgctggccggaaga
actttagtttacaatgttaaggtcgttaaggttcttaataacgctaaggataagattatg
gctttgatagagcgtaggttttcctcaaaatacgcaaatggttttaacgttgagttagat
gatggaaagaagagtgttagaattactataccaaaggatctttacttagtagaggactta
cagattaatgtttactctttagcttatgagatagtaaactatgttcttgcagattatact
gttgaggttttacagcaatataataaaagtactttctcttcctct
>SSO0760 (gldA) Glycerol-1-phosphate dehydrogenase
gtgaatgtaaaagaacacgtgattagtctaccgagaagggttttcgtaggacatgatata
gtatatgacatttctatctacttctcacaactaggtgtaactcctccatttctaatagtg
actggaacaaaatatactaaaaaaatagcggataaagtcatagaaaatctcccaaaagat
gctaaatatgaggtagtcgaaatagatagtgctactttagacgatgtatatatggtagag
gaagttatcaagaggattagtcctagtttactgctaggtataggtgggggtaaagttata
gatgtcacgaaatatgctgcatttagaaatagcttagaattcgttagtatacctacttct
ccatcacatgatggaattacatcgccatttgcttccataaaggggttacagaagccagtt
tcagtaaaggcaaaagaaccattagcaattattgcggacatagaaattctaagcctctcc
ccaagaagattaatcaatgcaggaataggtgatacaatagggaagataatagcagtgaga
gattggaagttagcggctaagttaagaggagaatattatggtgattacacagcgtcttta
gcattaatgtctgctaaacacgcgtttcaatgcactaagattattaataaggacataaaa
tacggggtaagaatgttaatggaagcgttaataagtagcggagtagccatgggaatggct
ggaagcaccagaccagcaagtggttctgaacatctatttgcccatgcagttgagttaata
catccagagggaattttgcatggtgaactagttggtttaggaacaattattatggcttac
ttgcatggtataaattggaaaataataagaaatagacttaaaaaaataggattcccagtg
aaagcgaaagacttaggtctttctgatgaggaagtgataaaggccttaacaatagcccat
acaataagaccagagaggtacacaattttaggggataggggtctaacttggagttctgca
gaaaaaatagcaagagtaacaaaaattatagat
>SSO0761 mRNA 3'-end processing factor, putative
ttggtgaataggttggcatctctggataggtttaacagaatatcgttaatatattctgaa
ctaaaggaattagggataaccagaattgaatatgaaggaccgacaatagctgtgtatgta
aagaaaccagcactgataacagaaaagggagaagtaataaagaaaattgcaaaggatatt
aaaaagagaatagtaataaaagccgacccttcagtaaggaaagataagaaggaagccgtt
gaaataataaagaaccttgtacccgccgaagctgaaattgtagatataaaatttgatgat
gacttaggtgaggtattaataaaggcaaagaaaccaggattagtaataggaaaaggtggc
tcattacagcaaagaatatttgctgaaaccttttggaaggcggaaatagttagagaacca
ccaataaaatctagaacatatgatagtatcttagagcatatttacaatgagactgaatat
agagctaaaatactaaaggtttttggagaaaggatacacagagagacgatatttcaagat
aagtacgtaagaattacggcattaggaggctttctagaagttggtcggtctgcagtatta
gtagaaactccagaaagcaaagtattgctagatgtgggacttaaccctagcgcgaatatg
tttggagagaaattattccctaagcttgacattgaccagttgaagatggaggaattggat
gctgtagttatcacacatgcacatttagatcattgcggaatggtgccttttctatttaag
tatggatatgaagggccagtatacactactgtaccaactagggatataatggcattaatg
caattagactcgcttgacgttgcagaaaaagaaggcaaacccataccttactccgcaaaa
gaggtaagaaaggagttattacacacaataacgttagattatggagaagttactgatatt
gcacctgacataagattaacattctacaacgctggccacatattgggatctgggatggct
catttacacattggagatggaaaacataacatagtctatactggtgacttcaaatatgca
aaaactaaactgcttgataaggcaaacacggaatttccaagagttgacacgttaattatg
gaaactacttatggtgcacaagatcagccaaatagagaggaatcggaattagagttgcta
gagattataaataaaacacttaataaaggaggaaaagtcctaattccagtactagctgta
ggaagaggacaagaaattatgctcataataaacgattttatgaaaaagaagctaattcca
gaggtaccggtttacgtaacgggattagttgatgaagttacagctatacataatgcgtat
ccagagtggttaggaagagaagtgagagaagaaatattgtataaagatgaaaatccgttt
acctcagaacactttaagagaattgaaggatataaagaggatatagcaaaaggtgagcca
tctataattttagcaacttctggaatgttaaacggaggacccgctgtggaattcttcaag
accatggcaccagatcctaaaaatgcaataatatttgtaagttatcaagcagaaggtaca
ttaggtagaaaagtgagagacggcgcaaaagaagtacaaattcttgatagggacggaaga
gtagagtcaatacaaataaatatggaagtcgaggcagttgaagggttttctggacactcc
gataaaagacaactccttaacttccttagaaatatcgaacctaagcccaaaaatgtaata
ttaaatcacggagaagcatcttcaataagagcttttgcaaactatataagagaagataga
ttagggtataagcccaatatatatacaccagctatattggatagcctaagagtagcc
>SSO0762 Hypothetical protein
atgaactgtattgagaatcttcataaggcttatatcttaacgtggattggagattataaa
acagcaagtgaattagcaagggaatgtatgcaacttctttcagattctgtggagataagg
agaaaagtaaaggaagtattaaagaaagcggatagagaatacaagatatctaaaaaacta
agggaagaaagtataaatactaccgacctaattcaggtcgcactttattatttagctaag
agattatcagttaaaaaagataatgatatagaaataattgaaaaaggaaatattaaacta
tctgtgattgaacatttactagttaaagaggttagaggttattgtgagggatgtagagga
tataaatattctctgctgactagtgcaaaaggatatctaattctttacgacgaaataata
tatgcagagttctttgaaggtaacaaagacgatgttattaacgagatactaaaaaacact
aaactt
>SSO0763 Hypothetical protein
gtgaaacttaaaatttcatggatagagcttagtcaagatttattaccacattcagattta
gactccccagaagatctaaaattgataagtaacgaaattcttgaggccttcgaaatagga
gggcactcagaagaaatcgaattggatgataaaatattgacaataacttctattttctca
tcaaaactactacaagacattccaaagtcaataagaatttacgaaatgggaagatggggt
aagctattatccggagacgtagtcactgttataggagaaaccataacatatgctcttcta
aatcagttgtttaacataagtattaatgatatattaccatttagaaatgtaaagttccta
ggaacaatatcggatttggctataaatatagaaaaatacgatacattaagaaaattttta
aatgctaagagtggtttactatttgtagaagctaaggcaacaatgacctttaggagatca
caaatcgttaatacgatatcaaaaagtttagttacaatagaaaatctgaggtatccagac
aattacggtctaatttcttacattataaaatacaataatcaactatatgatctaatgata
ttaataaaaccg
>SSO0764 (adh-2) Alcohol dehydrogenase (Zn containing) (EC: 1.1.1.1)
atgaaagctgtagtagttccgggcaagcaaaaagggtatagaatagaagaagtttcggat
ccgattccaggaaaagatgaagttgtaattagagtaaatagagcggcactctgctataga
gatctattgcaactgcaaggtttctatcccagaatgaaatatccagtaattttaggacat
gaagtagttggtacgatagaacaaattggagaaaacgccaaaggctttaaagaaggtgat
aaggttatttcacttctttatgcacctgatggaacttgtcattattgtcaaatgggtgag
gaagcatattgtcactctagggtaggttattcagaggaattagacggcttctttgctgaa
aaagcaaaagtaaaagttacaagcatagtaaaagttggcactaacgttccagacgaggga
gcagttttagtaccttgtgtaactggaatggtctatagaagtttgagaagggcaaagttg
caaaagggggaaacagttttagttacgggggctagcggtggtgttggtattcatgccata
caagtagctaaagcacttggcgcgaaagtgataggagtaactacatcagaggaaaaagca
gctttcataaggaaattcgctgatcatgtaatagtaggtagtaaattctcagaagaggca
aagaagataggtgatgtaaatgtggttatcgatacagtaggtacaccaaccatagatgaa
agtctgaaaagtttgtggatgggaggtagactggtacaaataggtaacgtagatccaact
caaatatatcaactaaggttaggctacgtcatattgaaagatatagcgataataggtcat
gcctctgcaactaagagggatgcagaagaaactctcaagttaactggagaagggaaaata
aatcccgtaatagcagcaacagtagggttagatgagatagataagggatatgaaatacta
aaggataagcataagattgggaaggtactagtaaagcct
>SSO0765 (gatA-1) Glutamyl-tRNA amidotransferase, subunit A (EC: 6.3.5.-)
atgaaattagaagaattaaattcaaaatataatgcatttataaccctccatactatcgaa
gaaggaaacgataaaggcaaattaaaggatgttacattcggaataaaggatgttatttta
actaaggacgtaaggaccactgctggatcaagagttttagaaaactatgttccacaaaga
aacgcatacgttgtggatgctatacttagagaaggaggaaagataataggaaaaactaat
actcacgaatttgcgctaggtgctactaatacatcaagtataggaggacctgcaagaaat
cctgttgatccagaaagaataagcggtggttctagtggcggttccgctgttgcggtaaag
ttagatatggtcgacgtgggaattggtactgataccggaggatctgtaaggatcccttcg
tctttatgtggagtaattggatttaaaccaactactgggttgatacctaatgatggcgta
ataccctttagctggtcattagatactgtggggataatcgtaaaagataacattagatta
ttacgaagagtttttgacgttgttctgccaaatgaaaaaagaaaagttgaaatagctaaa
ttaagaacaagaccgcgtctaggtttatttctattcgatgatatggaagtttcaagaata
ttgctgaaagatatatatgctaaattatcttcacactttgatatagtcgaggttgatctt
cctttactaaggcaatatggctctaaaactagaagaactatatcattagctgaagctgct
tcttatcataaggattggataagtgaatatagtgataaatacttcaaagatacctatacc
ttactccttgatggtatgaaaatatctgctaccgactatatagatgcgcttagacatagg
agagtattaatagaagagtatgtaaaagtatttaagaatattgatttcattttatctcct
acaacaaaaattgttgcacctagaatttctgacgtaatctctaaccctcttcaatttaga
gaatatctaatagctaatactgaactatttaatgtagttggagcaccatcaataagtgta
ccattctctacccttaatgacttaccggctggtttaatgataagcggagaattgtataaa
gacggggatttacttgaagtcgctgaatatattttaaacattgtaggaaaacat
>SSO0766 Proteasome subunit (EC: 3.4.99.46)
atgaaccctaaattaactgtcacctttttattcttgcttttaatggtaattatggggaat
gagttgcaattagaaaataagatacttaagggaactacaactgtaggaattagagtaaat
gatggagtaatccttgcggcagatagaagagctagtgcagggtttttcgtagctaataaa
atggttagaaaagtattatatattacagataaaatcggaataactaccgcaggtagtgta
gcagatttacagtttatatacgatgtattgaaaaatatatatcattataatagtattact
aaatacgggccaatttctataaagggaattgcaaccaggctagcaaatgtattatctgca
acaaaatattttccctatatcgttcaaatcttgataggtggttacgatgatcagccaaga
ttattcaacttggattatttaggcgatataactgaagaaaattacgtcgcaactggttct
ggttctccagtagctatgggagtgctagaagatgagtataatcccaaaatgactttagat
gaggcagctgacctagctaagagagctgtgttctcagcaataaagcgggattcctttacg
ggtacaggtgttatagtagcaaaaattcacagtaaaggacacgaggaattagagttctac
ttaaataagaagatg
>SSO0767 Conserved hypothetical protein
ttgaatagtgaaagtatatattcgatgagagtagtatcttcagcctttaagaatgaggat
tttatacctattaaatatacttgtgatggacaagatctgtctccggagttagagtgggat
cttgttactaacgctaaaagttatgcgataatcgtagaagatccagatgcgcctggagga
actttcatacattgggtaatatacaacataactaccaatagattgccagaaggagtgcca
agactgtacaaatcacaatatggtgtacaaggtgtaaacgattttgggaatatagggtat
aacggtccgtgtcctcctaagacacatccacctcatagatattatttttatgtttatgca
attgatacaatactacttgaaattaaaaatattaatgctgataagttaaaatcactaatg
gagggacatgggatagagagaggattcgtaatgggtaaatataagagaaaa
>SSO0768 (rfc) Activator 1, replication factor C, small subunit
atgagcacgaaggtcgaagaaatactttgggctgaaaaatatagacctaagacgttagat
gatatagtaaatcaaagagagatcatagataggttaaaaaaatttgtcaaggaaaagaat
atgcctcatctactttttgctgggccaccgggtaccggaaaaactaccgctgctttagct
cttgtacatgacttatatggagataattatacagaatatttcctcgagctaaatgcaagc
gatgaaagaggaatagatgtaattagaaataaagtaaaggaattcgctcgtacggtaatt
ccaggtgatattccatttaaggtggttcttttagatgaagcagacaacatgaccgctgat
gcccaacaagctttaaggagaactatggagctgtatacagaaaacactagatttattcta
gcttgcaattatttaagtaaaatcattgagccaatacaatctagaactgcattatttaga
ttttacccgctgaaaaaggaagatgtcgttaatagattaatctatatagctaaaaatgag
aaagctgaatacgatcagaaagctttggaaacgatctacgatataactatgggagatatg
agaaaaagtataaacattttacaagccgcctcagcttatggcaagattagtgtagaggcc
gtatttaaggttttaggattagcacagcctaaggaagttagagagatgattaacttagct
ctgcaaggtaagttcacacaagcaagagataaactcagaactttacttattacatatggc
ctatctggagaggatatagtaaagcaaatacacagagagataacttcctcagagattcaa
ataagtgaagagttgagagttttactactagattatataggagagacagagtttagaata
atagaaggtgctgacgatgaaattcagttatctgcattattagctaaaatggcaatttat
ggaaataagtatataggcagtgagaataga
>SSO0769 (rfcL) Activator 1, replication factor C (RFC) large subunit
atgatacaatggtttttaaaatataggccgcgttctctaaaagatgtggagaatcaagat
gatgcgaaaaagcaactacaggagtggatagagtcttggcttaacggaaattctaacgtt
aaggctgtactattacacggtcctccaggtgttggaaaaactgtcttagctgaggcatta
gctcacgattataattttgagttattagaaatgaacgctagcgattcaagaaaattgcaa
gatataaagagcatagcggaaaaggcagcagtttatggcagtatatttggaacaaagggt
aaattaatacttctagatgaggttgacggaataaatgttcgtgaagatactggagctatt
caaggtattttagaacttattgaaaagacaaaatatcctattataatgacagctaatgat
ccatggaatcctggattaagagaattaagaaataaggcaaaaatgatcgaattaagtaag
ttaggtaagtatcctttaagaagaattttaaaaaagatttgccaagcagaaaagattatt
tgtgacgatgaggccttaaattatataattgatagcagtgaaggagatgctagatatgca
attaatattttgcaaggaattggggaaggatacggaaaggttactcttaatttggttgaa
tcattagctaaaagaaaagaacgtgaattagacccatttgaaacgctaagagatatattc
tgggcaagatatgcatggcaagctaaaaatgcagctacaagtgctcaaatagattatgat
atgctaatcagatggatatcagaaaacatacctatacaatacgataatattgaagatatt
tggagagcttttgatgctctctctagagcttcaatattcctaaagagagcaaaaagcggt
gattgggacttattatcttacgcgtatgatatgatgagctctggagtagcttttgcagaa
cctgaaaagaaaaagccaaattggaaaccaaaatggaaaaaatatcaattcccgtcgtat
atacaactactatctaagagtaaagatataagggatacaagggacgaaatcattaagaaa
ctagcaatacattcatcctttaataaggcactaaatgacacatatccatttttcctacta
ttctataaaaaatacgataaacatcttaatttaaatacgaaagaaaaggagtatcttagt
tccatatctaaatct
>SSO0770 (moaC) Molybdenum cofactor biosynthesis protein C
atgagttccgaagctaagatggtagatatatctcaaaaggaaactgtattaagagaggct
gaagctgagggattcattaaactaaagaacgatactataaagagaattatagaaaatgaa
atagagaagggtaacgtaattactgttgctaagactgcagggattatggctgcaaagaaa
acttctgagcttctacctctatgccatttaataccattagaaaatgttgatattgatata
aaaattgagaatagtggtataagagttagatctaaggtgaaggcccattataagactgga
gtagaaatggaggcactagttgctacatctatctccttgttaactatttgggatatggta
aaaaaatatgaaaaagatgagaacggaaaatatccatataccatgattgatgatataaaa
gtaatagataaaataaaggagaaagac
>SSO0771 (cdc6-2) Cell division control 6/orc1 protein homolog
ttggtttcagctaaggacatactttcagatagtttaagatcatctgtattgataattaaa
cataaggacaagctttcaccagattatgtaccggaaaatttaccacatagagaagagaag
attaaggagttaggatttatattcaaagatctattagctggagacgctaaagattctgaa
agagttgtaatactaggtaggacaggtactgggaaaacagctactgttagattgtttggt
aaaaattttgaagatattgcggagagagaatatggggttaaagtaaagtatgttcatata
aattgttatagacatagaacgctgtatttaataagccaagaaatagctaacgcgttaaaa
ctacctataccttcgaggggactatcggcacaagaagtatttaagatgatccatgaatat
ctagatagaagaaatatacatctaatagttgcactagatgaatttgggcattttctaaat
acagcaaatactgaggaaatatacttcttagtaagattgtatgatgaaatatctgcaata
ataaagagaattagttatatatttatagttaatgagagtcattcaatttataaattagat
agaagtataagggatcatatagctagaaggttaattgaatttcctccttataagtctatg
gaactttacgatattttgaagtatagagtggatgaggcttttaatgacaatgctgtagac
gatgaggtattacaatttatatccaatacttatggttatgataaaggaggtaatggtaat
gctagaattgcaatagagactctaagtttagctggagagatagcagagaaggagggatcg
ccagtggtattgttagatcatgctaagaaggctaattctacaataaatccggagattcaa
gagattatagatagtttatcgtatctcgatttgcatcaacttatactcttaaaagcgttg
ataagagctttaaataagactaaagctgatgagatcacaatgggaaccttagaagaggaa
tacatatcattatcaagagagtttaatgaggaacctagaagacatacgcaagtttatgag
tatctgagaaaacttaaggtaatagggataattaatacaagacagagtggaaaaggaatg
agaggaagaacgactctcgtttctctttctcttccattagataaaagattagacgattat
attatgcaacaaataatggtgaggttaaaatcgagagct
>SSO0772 Hypothetical protein
ttgggttctgccacatcaaatataaggttttgtattaagaaaaaatatattatgatcgaa
gtaaaactcagagctattaaaagattgtcaaatgtttacactcgccgagttatgataata
gaggattggaatggaagctcaataacaacgggtaacattgagttagtaaaaggaagcgaa
aatcagttaccacaatggttagctattatcttagaaggaaaaaaggtagctaaaatagaa
gataaaatctcaattgaagatttaggaagaattcttttccaagaaaggcaaaatatgaac
acgccagcttctttagttccattaggtaaggatttcacaagcagagtacaactttatcta
gaaaccttaaggaaagacaacaatgttgagagtttagaaaaacttagaaaatcaataggc
atactgaatgaaatcattaaaataagactaagaaaactaatccaactcgcatttcttaac
atcgatgatcagaacttaattaatggaatgacagaagaagagcttttaatctataagaca
ataaaacaacttattaaggaattatatggtgatataattggaaattcc
>SSO0773 Hypothetical protein
ttgatgtggcagaacccaaaggctcttgtaactacaaagcctggtaaaggtcgaaagtgt
ataaatgagattttgaataggatacttataaaggatattgatgctagagttatagaatat
gtgcaaaacgtagctattgtttactcaaatttagattcattagtggtttatggtttactt
tttgcttctcctccgtcttgtgctgaaaaagtatatccatttcagttgattataaattcc
accaatgaaaaggaaattgttgttaatgtaataaattttataaaaaataagacaaaagat
ctcaaaacattttacgttcgctgttataataggggaattgacgtaaattgtagagaaatt
gaaatgggagtaggaatagggctgaagggtttaattaatgttgattttaaagatcctgag
gttgtacttcacgttaatgtactaaaggaatttgctgggatatcgcttttgagaaagaat
caagaaaagtttcgggctactctcttagataaaata
>SSO0774 Minichromosome maintenance protein MCM
ttggaaattcctagtaaacagattgactatagagacgtatttatagagtttctgacaact
ttcaagggtaacaataatcaaaacaaatatatcgagaggataaacgagctagtagcgtat
aggaaaaaaagtcttataatagaattttctgatgtactttcgttcaatgaaaatttggct
tatgagataataaataataccaaaattattctaccaattctggaaggtgcattgtatgat
catatcttgcaattggatcctacatatcaacgagatatagaaaaagttcatgttagaatt
gtaggaatacctagagtaatagaacttagaaaaataagaagtaccgatataggtaaacta
ataactattgatggaatcttagttaaagttactccggtaaaagagagaatttacaaggca
acttataagcacattcacccagactgtatgcaggagtttgagtggccagaagatgaagag
atgccagaagtattagaaatgccaactatatgtccaaaatgtggtaagcctggacagttc
agactaatcccagagaaaacaaagttaattgactggcaaaaagcggtaatccaggagaga
ccagaagaggtaccctcaggtcagttacctaggcagttggaaataatacttgaagatgat
ttagttgattctgcgagacctggagatagggtaaaagtaacgggaattttagatataaaa
caagactccccggtcaaaaggggaagtagagcagtatttgacatttatatgaaagtaagt
agtatagaagtttcacaaaaagtattagatgaggtaatcatctctgaagaagacgagaaa
aagattaaagacttagctaaagatccttggatacgtgatagaatcatatcatcgatagca
ccatctatttacggtcactgggaactaaaagaagctctagcattagcattatttggagga
gttcctaaggttctagaagatacgagaataagaggagatattcacatactgataataggt
gatcccggtactgccaaatcacaaatgctacagtttatctcaagagtagccccaagggca
gtttacacgaccggtaaaggatccacagctgcaggtttaacagctgctgtagtaagagaa
aagggaactggagagtattacttagaagctggtgcgttagtacttgctgatggtggaata
gcagttattgatgaaatagacaagatgagggatgaagatagagtagccattcatgaggca
atggaacaacagacagtctcaatagcaaaagctggaatagtagctaaattaaacgctagg
gctgcagttatagctgcagggaatccgaaattcgggagatacataagtgaaagaccagtg
tctgataatatcaacctacctccaacaatcttgtcaagatttgacctaatatttatacta
aaggatcaaccaggtgaacaagatagagaacttgcgaattacatattagatgtacattca
ggaaaatccacaaaaaatattatagatatagatacattaagaaaatatatagcatatgca
aggaaatacgttacaccaaaaattactagtgaggctaagaatctgattacagatttcttc
gtagaaatgaggaagaaaagctcagaaacacctgatagcccaatattgataactccaaga
caattagaggctttaataagaatttcagaagcctatgccaagatggctcttaaggctgaa
gtcactagagaagatgcagaaagagcaataaatatcatgagacttttcctagagagtgta
ggagttgatatggaaagtggaaaaatagatatagatacaataatgactggtaaacctaaa
agcgctagagagaaaatgatgaaaataatagaaataatagatagtttagctgtaagttct
gagtgcgcaaaagttaaggacatactaaaagaagctcaacaagtaggcattgaaaaaagt
aatatagaaaaattacttacagatatgagaaagagtggtataatatatgaagcaaaacca
gaatgttacaaaaaagtc
>SSO0775 Hypothetical protein
atgccaaaaaagtataacagactttacaacgaggttataaatagctatgtaattttgatt
ctaatatttattttaattattggtatattgggagtcattgcttttccctattatatttca
ccgttaaataacggacaagcattaaatagtgctggttaccttgcgctaggagttattata
ataatatttttgctcctgggagtttacttcatggagagaaatgagcatagtttaggtgca
atgtcaattctaatttcgcttataattttagttttagccatatggtctatatacggaatt
aatgcagtaaaatctatatttgggata
>SSO0776 Conserved hypothetical protein
ttgtctatagcatacgatcttttattatcaattctcatatatctacctgcatttgtcgct
aatggaagtggtccattcattaaaagggggactccaatagattttggtaagaatttcgta
gatgggaggagactatttggagatgggaagacctttgagggcctaattgttgcattaact
ttcggtactacagtaggtgttattatatctaaattttttacagctgagtggactcttata
tcgtttttagagtccttattcgcaatgataggggatatgattggtgcctttataaagagg
agacttggtatacctaggggtggaagagttttaggtttagatcaattagattttgtctta
ggagcttctctaatacttgtgttgatgcgtgtaaatattacgtggtatcagtttttgttc
atatgtggattagctttctttttgcatcaagggacaaactacgttgcttatttgctaaaa
attaaaaatgtcccatgg
>SSO0777 (radA-like) DNA repair protein radA homolog
ttgaatttgtcaacatttgtatttgaaaggggaaatttggtgtcaatatacggcgagtct
ggggtaggaaagactagtctttcgttagaattggccttggaaataaggacttccgttttc
atctcgactgaaggttctcttttcgaggctaggttagaaaagattaaggttggtcaagga
gtttatttcgcttctgttaaaagcaatattgaactatttaatggaataatcaattctttg
gaatataagcccagtcttatagtagttgacacaattaatacgttttatagatatgaacgg
aatgtacatagtttcttaaagctattaattattttgaggtcgatcgcccagtctaacgta
aaaattctattagtttgggaagtatcagccaataataaggtggctggggaaaaatttatg
cgaaagttctccgatgatgttttgaggattactaaatcttatattataggtaaccttagg
agatgtaaatttaagataactgaaaggggtgtaattggttgtcta
>SSO0778 Hypothetical protein
gtgaaaataaaaaatgtagcaattatcactgattctcctaaagtatataagaacatatta
gatgaactaaagagaagaaatatacagatttctgagaatggagaagtgaaaatagtaata
gattcagtaaaggaaagaagtgatattcttagatatgtgggccgtataatagctatctca
aggggaaaacaagaattcaacgaactactaataggcatagataccaattcaccctatcta
actgttgttgcactcatagatggagaattgatagaatatagaagatcttatggacttcaa
cctttaattaacgcaattagtgaaatcctaattacatacccagcaaaaagaaaaataata
ggagtaggtattggaaataaatatggaaaagaaatatatagtgttctctcaatgatctat
gaaaatgtaaagagtatagacgagaagtacacaaatgcgaaatcaccctttaatcagata
aaggataaagacataagagcagcgtatagtatagccttaagggcatcttca
>SSO0779 Conserved hypothetical protein
atgaaaaaagaacagataatacaagggccttgtacaataaaagttttagagggagaggct
agaatactcggaatagagatacagaaaaacgatttgttaacaataccatcagataagacg
tatactcttgtttatgatgaaaatacaaggttagagacggattgtaaaaagctgttagac
aatttaaatttaagatgggatgaaatagttgaagagattataaacacagtaggagtagta
ttgcttctaggaaatgtagattccggaaagacttacttgaccaatctattcaccaatctt
gccacttcttacttgaagattatagatgcagatgttgggcaatccactttatttctacca
accttcatagcagaattaaaaccgatgagaaaaacccttaatctagaggagcttggatat
gatactctagaattctttggagatataacaccttcaacgaatcctagactacatgttcaa
aaaatattgagactctatgaaacaacaccaaaggaaagactaacagtaatagatactgat
gggtggactgttggactaaattcaatgttacacaaattcgaattaatatacacaattgat
cctgattatataatagtatttgatcagaaaataaaagattcattacctgaaaattataga
aacaaagcaattcttttaaaaagtgtaaatctgcataagtctagatctgaaagaaaagca
aatagaatagcaaaatatgagagatattttaaggaagcaaaaaacataaaaaccctatct
gaaaatttattaggaaaacaaatatcaaacattctatactgtgcatggggagagtatata
caattatcagacgaagaaccatgtacagactattatataccacttaatttactaaaagga
gcattactaggcataatagaaaataagaaagtcataggagccgccctattagatgaccta
aaagaaaacgaaataacaatactaagtagagtaaacaagtttacagggttagttttaggg
tatattagcttaaatgataaatttgaggaaagaagaattagatttagaaaatgcaaaagc
>SSO0780 (tmK-1) Thymidylate kinase (EC: 2.7.4.9.)
atgcaaaagctaattgcaattgaaggaatagatgggtcaggcaaaacaacacttgcgaat
ctattaaaggagcatctagaatctaaaatgaaactgaacgtgattgttacgagagagcca
ttttctgaagatataataaagttaatagaaaaaattggctggaatgatccaatcctatta
gtattgctctttgcagcagaccgagaaatacacgttaattggctatctaaaataaaggat
gctgatctaataatacttgatagatattatttctccagcatagcctatcaaggggctcta
ggagtagatgagcaatggataaaaatggtgaattcctatttccctaaaccagatatggta
atattattagacttaccaattgaggttgctatcagtagaataaaaaatgataaattcaac
ttcgaagaaaagattaaaagccttgcaaaagttagggaaaaatacctaaaacttgcaaaa
gaatataatttctacgtagtagatgcaagcaaggataagaatgaagtattagaacaagca
ataaaaattattcagaagaatttattt
>SSO0781 Conserved hypothetical protein
atgactaacgaaagtgaggtaggtgttaagaaggctgctgaacttttacgtcaaggcgct
acaatgttagaagaggcttgtcctatatgcaaaatgccgctatttaaattgaaaaatggt
gatgttgtatgtccagttcacgggaaagtttatatagtgaagagtgatgatgaggagaag
atcgtaaagagaaatttgcagttagatgaaatagaaagtatattgattgatggtctatat
ttaagcgcaaaaaagatgaaggaggatccattagattctgaaaggataattcagatcata
aggtatttagatgcattagaacgattaaggaagattaaaataaattcttctgaa
>SSO0782 SSV1 integrase fragment homolog (orf D-335)
ttgataaaagagaggggaattagtgagaaaactgccagagaatatgtttccgccttaaat
agaccttatcgtgaaacacgaaatacgcagaaagcttacagattatttgcaaagtttctt
atgtcgcgcgggataataagcgagaattttgctgaaaagatattaaaaatcataaaagta
aaaaaagcgaatgtagacctttatataccttcaattgatgaggtaagacaaacattagag
atcgcccgcgaatatagcgaaaacatctattttatttatcgtctcgctttggaatctggg
gcgagactttctgaaattttgaccgtattaagaaaccctgacagagatgtctgtgaggac
atatgttattaccctctgtcatgggaacgtggatttaagcgcagtttttatatttttcat
atcacacagctgaaaaaaatagatataacgcagtgggcggtaagcgattttgaaaaaagg
tatgatgttgttaaaattaaatatattcgcaaattcgtggcgactaagatggctgaatta
ggcattcaactagatattatcgatttcattcagggcagaaagccttcccgcgtacttaca
caacattacgtctcattgttaggcatagctaaagagaattataagaaatatgcggagtgg
ctgaaaaacgttttgcaa
>SSO0783 Hypothetical protein
ttgcagcaatggaactacaccattaaagaatttataataaacttaataaatgtcttcaca
catgatatatactatatgaaatcgttaagccctaaagaactagaaacttatgttgatgag
gatttattaagggttataaatcgggagcaaattaattttatttatttcattaacgctaga
ataatttctagttatgaaaagttctttagattttttattcctgatagtactaagtattta
gtattagtgtcgtctgatcttcatttaaaattcataaaagagagcgtaattagagctaag
gaacctttagaagtgtcttgttacgtctcttctaaattaccccctatgagtttcttaata
atagttgtagagaagaaggaagttaaa
>SSO0784 Hypothetical protein
atgaggaagtcagttagcagggccagcagcatcatcacgggattactagtaatgagcata
gggttgaacagcaccgaatacctctctatttataagctaatattatttaataaaaagact
tgtatgaagttaaaaactcattttgtgttttctattgggttgttgactttggctagttct
tttttcggtttttctttgataatatctgctattataagtgtcttaggaaatacccttatc
gataggttggggcataaagagataagtacaaggtatgggaaaattccggttaggactcct
ctaactcataccctgccaagaagtgttttttggggtttaatttcctcaatgccagtaata
atagtgttaggtttagcatacggtatgttaaacacaaaaattttgacagcgttaattgat
gggattttagttggaccatcacatatgctattagacgtcttcactgagaatgggatttac
gttaagagaaacggaaagtggaagagggtagcattagcccacttctcgtatgatagctca
ttaattaacggattggcaatagtactaggaattataatgatatttgcagcaatggaacta
caccat
>SSO0785 Conserved hypothetical protein
atggggctactattagttgatataggaatgaaaaagctatatagcgtaaaggttagaata
ttacataaaggatgttggactgaaaaaataaaacagtacaagataaggactattaagatc
tctccttacgggagcaaaagagtgaaagttataatagcgtcaccaagtcatcagataata
aaggacttaaaggagtcagaaaacgtaaatgaagtcattaaatatagaaaattaaacggc
ggatatttaattgagttttcggaagataaggataatactatagctggaatgctattagaa
tttgaagacaagatattgaattactctaacgtcatcaataagggggttgagttttgggac
ttcgttgctacaagtaagggcgttataaattctcttaaggagaggtttggaatagaggac
atcgaagttaagggggtgagtttagataaatttttaggaaacgcgttaactgagaaggag
gtattgatcttaaagatagcattaaatatgggatactttaactatcctagaaatattaag
gcaaaggatatagctgaaatattaggtatttctaaacaagacttcctttatcatctaaga
aattccattaataaaataattacctcaatagatttagacaaa
>SSO0786 Amino acid specific permease
atggacgaaaaaagagagctaaaaagagaagtattgggaacatggctagtcgcgagttat
ggaatagccgctaacgcacctatagctgtagcgacactatattttgttggtattgcaggt
ttagctggaggttcaatgccattggttacagttctctcatatttgatctacgccacaacg
ctcctagtggtttacgagtggagtaaagatattgcagcatcctacggttatctcgctatg
attaagaagggattgaatagtagcttagcagctttcactgtagggtacggttatatatat
caatatttagttgcgggagcagcaggtttcggagtattaggggtaacttctttcctctat
ctcgtatccccttccatagcctctagtatgccttggttatgggctgtaatatcagtaatc
gtaacattagaaactacgttaattatgtggcttggcgttaaacctggaggtatgttaaat
ctcatagtgggcttaatatctatagtatacctaataattacttccatagcccttatcatt
atagccggagataagaacaccttagcaccctttacagcacagccggttaacggaaattgg
gtgttaatattaacttcaatgatattcggaattactacttttggaggtgctactacacca
gtaggagttgctgaagaggcgaaggtacctaagaaaactctacctaaagccttattattg
gaattcttactgttgggagtagggctaatattgaacgcttacgctcaaaccgtagtctac
ggtgtaaataatatgttcaattacgctaatcttccagatcccatggtgataatatacagt
aaatatttcagtaccattacagtgttaatactaatagttttagtagcgttcatgttcaac
tcttccaccatagcttttgctacgagtggaagtagaatgatttacggaatggcaagagat
ggagtactatatcctaagattttcactaagataaataagtacggggtaccaggtaacgcc
attctgttaaccggtataattacgggagccctcagtttgataagcggatatatattagga
cctttagaggctagcatatttctgataactttcggctctttttacgtgtcattgggccat
ctatttgccgcaatagcgttaattaggcataaggttaaggtgagaatgattaatatcgtt
aaacacgttttagtacctatagtttcctcaattgcttatattcttacaatttacttcggt
acttatcccgctccagctttcccactaaatatagcggtttatgcggcgtgggctgtactc
ttaatacacgtgattctatactatatattaaaatctaggaatccagaggccattaagaag
ttaggagatttcagtctg
>SSO0787 Transposase ISC1439
atgcaaaccatacaagtatccaaaacggagctgaagtccctcgctataaatttagcaaca
aacaatattaacgttatctctcaagatctagacccggaaatagtgaaagcagcaccatcc
ttgctaaccggaaacagaggaaaatactacttgaaggtagtaagacgaggcgagaaagta
attagtaaaggtcagagaaccttcaagttctacccaatctacagagaagtaaagggagag
atcaacgtagtcgctgtagatgagaccggattaaccgtgggagaaaaggaacaagaaaaa
gcagagggctttctactctacaactggaagagaaaaggagtaaagatgagatccttggac
ctcgtatatcccttaaggttacccctcctagtggaggtagcagatttgagaagcgacagt
ccatcacagttcctactcaggagcgtgagggaagtaagccaatacatggaaatagattac
gttgtagctgacgccggattcttgaacctaggggtcatcaaggaaatgcccgtgaagacc
attgtgagagggaagtcgaacttgaagggattcaaggaactatctaacgttccattagtt
gagaagagatacgaggttaaggacaaggtttacgttgcgtatagggtcttgaaatttgaa
gggctttattattacgatgtggtttacgttaagggaaagccgaggcactttatgttcgtg
acgaacttcgagggagatccctatgaactggctgaactctataggttgaggtggcaggtt
gaggagggtttcaaggttaggaaggcaaggataaggtatgttaggaagttgagtaataag
atcttcttgttcctctattacacggttctggattctgcgtggaatctagtgaatcatctt
ctctttaacttcaagtccacgtgtaagaaggttttgtccttcgattcattcgtcaagctt
ctc
>SSO0788 Conserved hypothetical protein
ttgaaattatgtgatgagtatagaattccattagtgccaagaggtgcggggacttctact
atagggcaagtccttcctatttactcctcaattatattagacatgaatgatatgaaggag
gttatagagattgatgacaaatgggttaaggtcactcccagcgtgaagattttaaggact
ttagattacttaaggagaagggggaaggagttaagggtttaccctagtagtttttacatc
gcgacattagggggatacatagccggaggagatgttggtattggatccttccagtacggt
tatcatttcgataataacggtattaattccgtgagagttttaggagtcaccggtaagtat
actttaaatggaaaggacactttagcagtggctcaagcagcaggtactactggagttata
actgaggcggaattggcgataatagactatgaagactggaaagatcaattaataaggtta
aatgatttagaagaggtagtgaagattttaaagaagttaggagagtttaggagtaaaatt
aggagaatcacagtagaggattatgaggcattatccttagttgggaaggataggttagat
aaagtagggaagtggaacgttatagtagcgagtactttaagcttcggagaggaggttaat
ttgaggtttttagatgagttagctttcgctgctatttacgttacgatgagtaagctgact
aaatttaaggattacttttacgaggttaggttgctttctttggatagctttctgagggtt
gttaaacaagttaaagaagctctaaactctaacgttttaatacacggtgatgtaatgact
ttaagaggtgaaataataatttatactgtatttatttctgataaatcaaattttgaaata
atagactcgataatgctaaaggaagggataccgtttgaaatacactcaatagaggtaaac
gatagggttgatgaggaatatagacttgaattaatgaagaaatacaagcgaattatggat
ccacataatattctgaatccagggaagttgagacta
>SSO0789 Conserved hypothetical protein
atgatgcttaaatcattaattgatgctatagaaatactcgaatctaaggaccctttaaat
ctactgagaagtaaattaaagggtgtggagtacgaagaaaagaaaataggagaagtaact
ttcgtaaaggtatattacgggagtgggggaagggaaaaggttgagattttaggtagatta
ggagcaattcagatgcaaaacgcaagcaaaggattggtttcagatgccgatggtgcgata
gtaacattagctgtacttctagagctcttaaaccttaaggagaagggaatagctttagac
ttagacgtatctttcgtaacgaatatttcacttaacgctaagctaattccccatcaacca
tttaactttatggtacctcttataggattagatgaggcgttaaaggaagaagtagaccct
aaggctggcctaatcctttctatagattcaactaagggaaatagattagctaagtttgat
gacttcgctcttacacacgtaattaaggacggttatatattgaaattaaaagatgaggta
atagacatttataatagagtaactggacatgaagtgtatttagtttctttaactacgggc
gatctaactccattagatttcaatgtttaccatataagtactttaatttccccttggctg
tatacggattcaccaataatcggcatagctactgtttctaagcagatgattcctggttac
gttacgggggttcaagacatagaaatgttagaacacgcttctagattctgcctagaaatg
ctaaaatacgttgaaggtggaggtaaggtctatgacgagaacgagttaaaagaattaaag
gagaagttaggagaatctaacctacagagggtaaagaaatggaaaacg
>SSO0790 (argE-1) Acetylornithine deacetylase fragment (EC: 3.5.1.16)
ttggtaggtgataaggcttatggaaaaggagtatcggacatgaagggaggagtagttagt
atgtatttagccttaagtgaaactaaaagaccagtggaaatttcactggtcccagatgag
gagagcggaggtataggtactaaatatttaactgaagtgaggaaaataagagctaaatac
gtaatcataggtgatcctagcttccctaatatatacatagggcatttgggaataataagg
ggtgttattaggcttattgagaaacaagctcacgcaagcaagactaaagaaggagaaaat
gctttcataaatggggcaaaattagctttagaaatacagaaaatttatggtgttaaagaa
gtatcgttaaatctaggcggatatacgatcaactcttcagataatgatggcgtagttccg
ggggagtttgttttcagtttctacagaagtactttacagaaaaatgaaagcctcgccatt
cacggtagactcaaaatcacctccttaagcgtttctactagatggaaaaattctctggat
caatatcctatt
>SSO0791 Glycosyltransferase
gtgatgtttaccatcgctttaagagttttatggaatggaggagttgccagaattgcagtg
gaacaggctaggaacgctaaggctaaattattagtatatagagaatccttctacaattac
gatctcagtggaatatacgttgaattcttgagaaggaaaggagagaaaggatttctcaca
cctctctttaggaggataacggaaatttacgctaaaaataggggtgatgaggcaactgtg
gatttagatcttatagttaaggcgtctagaattattaagggtcccgcactgtttcacgat
caatttgctgggattactggttatttacgtaaggtatttgatggagaagattacgctata
taccttcatgaaacttctttaactttaaagggtattaaatatttaatacctaaagtaatg
gaaagaaaagtactggaagacgctaaaatcgttcttacaaattcacaatggaacaaaaga
atcctagaggataaaggtataaaagctgaagtgttatatccaggttgttatccaatagat
aagattgaagaagacaaggaaaatttcgttctaacggtgtcaatgtgggatgaggggagg
aaaccagaaatttacggcgagatagctaaaagaataaagggaaagctaataatggcggga
tcttgggcaagaagggatactatggaggagtttaaaagaaaatacccagaagttatagta
actggcaatattagtgaagataaactgagggaactttataaaaaagcgtccttaactata
cgctttggatttaatgaaagaggaccaggtatggctgtcttagagtctctatgtaatggt
acggctgtaatagcaaatgacggattaggaggaaaggaattcgtaattgaaggggaaaac
ggttatgtggtaaaagattggaaggaggctgtagacagaataaacgaggttttggagaat
cacaagcttagaagaagcctttcaattaacgctttagaaacaagtaagaaatactcttgg
agaaaccacgcaaataagttaacggaaattatggaaaagttagtt
>SSO0792 Hypothetical protein
atgagtgaggccgtttatacatttgacgtgactctaattaaacctaccgtgttcaagttc
acaattggggaggaaatagtcaccgtaatgctttatctcatccctcaagctgttataatt
tcagaaaaagaagaagaaggaaagaaacttccctcagtagtatcgatgggcaccctcact
gtagtgtctaataagccaaaaatgggtgagttatgctctgcagataagttctcaaggcac
acgccttttattccaaaaatagaaattgtgagcaatggagtgactgaggttaaagttaac
tatatgaagattaagattagcgcaaaagtcactaacgttaacgtttacccagatttgaga
gatagtttgggaaacccgtgtgtgaacgtttcatggattcaattgataagtgtagaa
>SSO0793 Hypothetical protein
gtgtgtgaacgtttcatggattcaattgataagtgtagaatagagtgcaaattcgttgag
aacaaggataaaagggagtttcttgctgaaaggcttaacaatctcacgaggtatttagag
agaatatgcagggctctaaacgacgtctgtaaaaattcggcaacagtgtcttgttaccag
tgctttgacgaggtaaacaaggcttataatactgccgtctgtgaggattcgtgcaagggg
aaaagtaggttatcgttttgcttcttactgagtgaggggctaatacttaatgttatagca
gaagacgaaggaggatgcagaacaataattactttttaccccattaatagagaccgtgaa
aggactatagaaaagaagtgcgataaaatattcaaccaggtt
>SSO0794 Transposase ISC1476
atggcaccctcctctggtcaactcttaggggatgaggagcgggagccgactcctactccc
gcaatgccagaggagggtgtctacgaagttaaatactcaaatcgaagaaccaatgtagtt
cgtcttcttccaaatggttttcaagaaagaaagctgaggaggttagctaatctctctgca
aaactcttcaacgaagtgaacttcgaaaggaggcaacaattctttcacgaagggaaagta
gactttaagggaacgtggaacaaatactacgagaagtacaaggccatactgggtgttaat
gctcaagctgtccttcagaagaataatgaagcgtggtcatccttcttctccttgttaaaa
ctgaagaaggaaagaaaactaccaccacacatgaaccacgtttctccgcctagatactgg
aaggacagagaagcagggaaaagaaagctaatactagttgttagacaagatcgttacaag
gtagatgctggaaatcacaaattaatcctcaaggatttcgacatggaaatagactttgtc
ggtagactaaaatggtatggtaaacaaggtagactagaaataatttttgacgagaccaag
aacgcttggtatgctcacataccaattgaagtaggtgttgaggaaactggaaagaagagt
aagcacgtcgtcaagggtgagagaaagtccatccagatttccaaaccaaagggaaacaaa
gtaacttcaatcgatctaggcatcaacgtaatagctagtgtagtagttaacgacggaact
tggttgctctacaagggtgttagaacaaaggaggactacttttacttccaaagaaggatt
tcagaagtgcaatcgttagctgacagaaccagaaacattggtgaatatgatgcgtaccta
gaattgttgagggaaaagaggaggttttttaagaaactaactaggaggctccttcacctc
taccgtaatctagcctcccaccttattgaaacactccacgaactaggagtgtcaacaatt
tatctaggttatccatttaacattgtgcaggagaagggtaataagtttacagtgaacatg
tggtcttatcgtaagttgatggtgtctctcgat
>SSO0795 Hypothetical protein
gtgaatatggagacttttttcttagatactaacattctcgtaaaatggatatatagaaag
ctcttgaacgagaaagaagatattgaaagatttatttcttcattgagcaaagatcaatgt
attatacttgatattaacttatccgaattcgaatcgataatcaatgacgcatataacatg
gtatctcatatcatctacgagaagatactgtcaagatctgattggaaagaattagatata
aaaggtaaatttcaaattattaatgatataagaaagaattttgatcggctttatgatgaa
atacgaaaaacccattataatgaactgatctcgcccggcggaataaggcaaatacttgcg
aaggagttctttaaaaagttagaagataaggtagttaacttggatccggaagtccttaga
aaccatatagctttaaatgggcgaactgaagatctgattgactatctgtctagtgtaaaa
gctataatcaaacaaaaatttactgtacttgacaacgttaagatacttattaatgattat
gttattaaggaaattcaactaatttatgagggtattaatagacatttgcgtaatttaaaa
tcccaaggatataaaaaagtaccaagtaggaaggatcagttaatattccaatatcttttc
ttgcttttacgcgaaggaatttacgataatattgtttttattactgatgataatgatttt
gaaagaatgtatagggctattctaaattattctgatgatattataaaggggaaagtagac
cctcgcggagaatttagaggacatgcaatggaaattaagaatacattaggcaagttagta
atcaaaaatattaacgagttaatttccaacaaa
>SSO0796 Hypothetical protein
ttgtgtagattgatatctatgtcagtagaactttcaactccttttgagcaatattacgag
actttacagagagtgaaaaacaggaattttcctttacagtatttagaaaagatgctggac
tatttgcttgagaagtatgagacaaatttgtttgagatttatgaaggcatattggcaata
gctctgaaccctgaagatttagatataaaaatgctattagaggaggttaggaaaataaag
gaagattttgaattatacgcctctttgttcgaaaataatactaccataagagaatactta
gaaataacaattaacgcgttgggcaaacttattgacggactaaggaaaaatgagaagaag
ttttacgatgaagtaaattctactaatcctaatttcttattaactacgtactactcactg
tatctgcgttatttaacaatcgtgtatgcaaaattgtccaagttaaatatacagaacgac
gtcaaaacgaaagactctccgtttaagaatacgcttcatttcgttaatttaatcgttgga
ctactcggcatgcctattctgcactatctaaagacgaaggaggtatttccttatatatcg
gagctaagtggagtattgctacacacattaaccaacgaggcacctattccctcaagggac
tcgttaggatattatcttttttccagaattcatgcaaaaaatgag
>SSO0797 Orf in partial transposon ISC1913
ttgcaagtgttaagcatgatatttactagagagattctagaggaggcaataaattacggg
cttacaaagaacacaacatcattcactagaattaaggccgggatttacaagactgagagg
gagaagcatagggacttaccatcccattatatttacaccgcttgtgaagatgccagcgag
aggctagatagcttcaataagttgaagaagagaggaaggagttatactgacagaccgtca
gttaggagggttactgtccatcttgacgaccacttgtggaagttcagcctcaacgtgatt
tcaattgctactaagaggggtagggtttgcatttccccaatctttccaaagatcttctgg
aggtattataacgacaattggttaattgctagtggggctaggtttaaactgttgaagggg
aatgttgtagagttctttatagtttttaagaaggatgttaaatcttacgatccaaggggt
tttattccagttgatttgaatgaggattcagtctctgtattaattaatgggaaaccgata
cttttagagactaacactaggatgattactctgggttatgagtataaaaggaggtcgata
actaatggtaggtctactaaggatagggaggttaggagaaagttgagggagagggataag
aagcttgatgttaggaggaagtttgctaagttgattgttaaggaggcttttgggagtagg
agtgctatagtcttggaggatttgccaaggggggttccggagcatatggttaagggtgtg
aaggataaacagcttaggttgaggatttatcgttcggcattttcttcaatgaaaaatgct
attgttgagaaggctagggagtttggtgttcccgtaatcttggttgatccttcttatact
tcttctatttgccctgttcacgggtcgaagattatttatcagcccgatgggggctctgcc
ccaagggttggtgtttgtgggaagggaggagagaggtggcatagggatgttgttgcgtta
tataatttgaggaaaagggctggagatgtgagccccgtgccgttgggctctaaggagtct
catgacccacctgtcgtgcaggtggttgagggc
>SSO0798 Conserved hypothetical protein
atgaaaggtaacgggtttttattcgacgcttcagctttatacccacttttagactacatc
gacaagattgacgtcaagaaaatttatatacttaccttgactttttacgaggtaggaaac
gcgatatggaaagagtattatatacacaagaaggtaaaggacccaataaccctttctatg
ctttttaacgatttacttaggcgctttaacgtagtagaagacccacctttagataaggta
atgaaggtcgctatagacaagggtttaacttattatgatgcgtcttacgtatacgttgct
gagtctttaggcctcactctagtatctaacaatcgtgagttgataagaaaggccaacgct
attacattagaggagttgataaaaggggtt
>SSO0799 Hypothetical protein
atgcaggttgtagaatattcgatatcaacatatctacccagagacgtagtttactttgac
ggaacctccgttacgttacctcacgaatatgtaataaaggaaggtaatttaagactgttt
gttccaaaaaataagattaatgatgtagttaatgctttaaagagtgcagggtttaaaggt
gagaaatactctttatcgacaaagtttttcaacatctgggaacttcacgtcagaatatat
gatgatggctttattgacgctcattttgaagtcagtagggactatcttgaacacttgacg
tatcccacaatcccttcaatttatgaagtatttgaaatctacagaacagtttatgataaa
ttacacatctttgacaacggtgctaagaaatggattaaagaagtaaagacgcactacttt
gtaaccttaaacccacccagatcaataacagctttgcagccaataacagtcagtgtagga
gctttaagtgcaattggaatcttagcttatcttctctcgagactagataagggagaggat
aatattagggaagttgtagaaaaagccttggatgaggcaataaaggagaaggaaaaagaa
aggcttagagaaactgcgctaaaaattaaggaacttatgaaagacgtgaacgaggaagaa
tgggcaacagtcataagggaaaataggaatgaaagg
>SSO0800 Hypothetical protein
ttgtttaaattcgtgatagcaacgacgtcacgatcaaacgaggggcagcgaaaagcaatc
tcaaccatcttcttaccacactttggacaagagacggaagagtacctatggattaacata
tttaacaatcattccgtgcttcttagcctgccattctatccaatactgaatacgacgata
ttgcatcaaatagagtttatcgtgaaactcagctggcagtttattaacgttcttaatgag
gttcttcaagtcctccaactttataacgttggcacccaatttctcagcaatctcaacaac
ccactttcc
>SSO0801 Transposase ISC1476
atggcaccctcctctggtcaactcttaggggatgaggagcgggagccgactcctactccc
gcaatgccagaggagggtgtctacgaagttaaatactcaaatcgaagaaccaatgtagta
cgtcttcttccaaatggttttcaagaaagaaagctgaggaggttagctaatctctctgca
aagctcttcaacgaagttaacttcgaaaggaggcaacaattctttcacgaagggaaagta
gactttaagggaacgtggaacaaatactacgagaagtacaagactatactgggtgttaat
gctcaagctgtccttcagaagaataatgaagcgtggtcatccttcttctccttgttaaaa
ctgaagaaggaaagaaaactaccaccacacatgaaccgcgtttctccgcctagatactgg
aaggacagagaagcagggaaaagaaagcaaatactagttgttagacaagatcgttacaag
gtagatgctggaaatcacaaggactttaacatggagatagactttgtcggtagactcaaa
tggtatggtaaacaaggtagattagaaataatttttgacgagaccaagaacgcttggtat
gctcacataccaattgaagtaggtgttgaggaaactggaaagaagagtaagcacgtcgtc
aagggtgagagaaagtccatccagatttccaaaccaaagggaaacaaagtaacttcaatc
gatctaggcatcaacgtaatagctagtgtagtagttaacgacggaacttggttgttgtat
aagggtgttagaacaaaggaggactacttttacttccaaagaaggatttcagaagtgcaa
tcgttagctgacagaaccagaaacattggtgaatatgatgcgtacctagaattgttgagg
gaaaagaggaggttttttaagaaactaactaggaggctccctcatctctaccgtaatcta
gcctcccaccttattgaaacactctacgaactaggagtttcaacaatctacttaggttat
ccattcaacattgtgcaggagaagggtaataagtttacagtgaacatgtggtcttatcgt
aagctaatggaatccatagaattgaaagcacaagaatatggtatgaaggtgtttgaggtt
gttgagtacaatacgtccaagtattgcgcttatcatgatgtggaagtaaagaggaaccca
agaggtgttgtcaaccgtcctttaggtcataaacttcacagcgatttgaatggtgcgtta
aacattctaaagaaggcattaggagtaatcgccgaagccgtgaaaaaaccattatccttc
attgtggatcataaccgagtagcacccataaaggggtgtaaccct
>SSO0802 Partial transposase in ISC1190
ttgttaatatgtgagtttacgttaagtgatgctagggagttgacgagtcaatgggatttt
atcgttaagagtattgttagggttaagaacaggttgaggagcgacttaatcctcttgggt
tatagtgatagcttgtctaggaagaatttgagtgaagtattggagggtggggataatatc
atcttgtctgaggttaagtttcttttggatgagttggagaggcttgaggctaggaagagg
gaggttgagaagaggcttgaggatgttgttcctagggatagtttgatctttactataccg
ggtattgggaagacgctgggtttgataattttagggttaggtgatgttaggcgttttgat
gataagaggaagtttgtggcttattgtggtcttgatcctgttgttgagtggggggagtgt
tgtgtcgcgaggtgtctcaaggagggg
>SSO0803 Partial transposase in ISC1190
gtgatgttaggcgttttgatgataagaggaagtttgtggcttattgtggtcttgatcctg
ttgttgagtggggggagtgttgtgtcgcgaggtgtctcaaggaggggtgatgctgttttg
aggagggctttctatcttgcagctttgactgctatcaaggttaatccggtgatcaagcgt
ttttatgaggagcataagggtaggttaaagggtaagaagttgattgttgcatgtgctatg
ctgttattacttgggctgtgctgtattataataagccatttaatgctaacgggtgatgac
gagggcttttgtttgcataag
>SSO0804 Hypothetical protein
atggagtcaaaaatacccgccatagagaaacacagagatgcttacgtaaagataaggata
atagaaagcctagatgaactagctttaggattaaaattactaaaggaagggtttagcagg
aactccgctaataaagtatttcagtcttggaaggcaataataagtgcattaacagtcata
aaccttgagaaaatgcctagaaacgaaaaagagaaggagtggtattataagtctggattc
cttgcccctaccactggattaaaaggaatttcacagaggcttgaagaacttggatataag
gtaaattccctaacttcggttgcgttagaattacataggtatgcttataatgggctttat
aaaggggcgagcgactattacgaaagggaagaagctattaatgacatcatttacttgtct
aaggaaattatgaaggttataaaagaattctttaaggaatattgggatgaggaaattgaa
gaacattacaatcttgctgagaaggaactgatgaaa
>SSO0805 Hypothetical protein
atgacaggtcaaaaaaacagtgaaagtctagttggcgagctggttaaccaaattaatgag
ctatacttatccaatccgaatcaagtcttaatgttggcgaaacaagcgggtattgaaaac
ccaacattcctagccacaccaccaacgaaaccatccggtgaactcagtttcgcgaaatta
agcaacatagcagagatagtgacaaaactcgaaaattatggtttaccgtcacttttgcgc
caatattttatgaatgttgtaaagaacccagtagtgttaaataacgtggttgaaacttat
tataaaattgcaaagataattccgaaagaagttgagaacgaaaaacctttagtcattgag
aacgaagggtttgcgtctaagtcaatcccgcctgtggtaaga
>SSO0806 Hypothetical protein
atgcagagcgcagaaagcggtttgttaatactttcttctcatcagccactgcagaggaga
gttctgaagattaaacgtattctctcttattcccgcgatacgaaagtttcacataaggta
gtactcgcgtatttccgcaaacattattggttaattgcgaatggattttgcccttattgc
cacaaccactataggaattttggaatactctctaaccatatcatgcgcagccatacgctg
gaggttgctgaagattattttaagctgagagaaaagattaaagaggggggggggaaa
>SSO0807 Hypothetical protein
atggaaaaagcttatgactttgaggtagaagctcctccagaggtggttagagattatctc
atgaatcctgaaaacttaatgaaatatattcctcattttaaggatttaaaacgagttgac
gatggctgggagttatatgtaagctggttatttacaataaaattaaaagttaagagagtt
ttcactaatacagatatcatctatttagtggaaaaaagtgaaggtttaataaagataaaa
tccagtttaaggtttacaatttttccttcgaaaggaggaattactatagtaaggttagta
ttcttttatgatggaccatttgaaagtatagtcaaggggcaagctgatgcgttctataga
aaaggaaaggaagtgtttaaaactgaaatgacaaaggaaaaaaggattcaagaggaacag
aatggcgtaaagggagaagtatcaatttacgaaatgaaaacgatattttcgggtaaaata
aataaggatgagttagaaaagtatctggaaatagcgatggttaagagcgttaattcaaca
gttgttgtaattttatctgatgagagaaatattatagagataaaatttaagggaggagag
ctagtggcgcagaaaggggatttagacagtctttcgtctccaataacaatattaataaag
caa
>SSO0808 Conserved hypothetical protein
gtgttttcaattcaaatcccagcacttcacggtaagtacttaagagaggtcttggaatca
ataagggagcaaacttttcaagattatgaagtagtagtggttaactctggaggaggagta
atcagtgatatagttcacgagtacggtttcaaagaagtgagaaaagacgttaaacttttg
gaagctcgttatttagctaacaaggagagccggggtgattacgcttttttgcttgacgag
acgagacccttaaggaaagatgctcttgagatactctctaagaaccttcacgacatggtt
ataataggcgagagggagttaggtgactcgttctggagtagggctgcccagttggacaag
gagaacataatggaatgtaactcaccggaagcggttaggggctttgccttgcctaggcta
ttcaagagggagttactgactgcttcgttagagaagctaagggaaaatttgagagaaaag
ttcagccaagtggttttcccggatcacgagctaatttattacgaggcatccggattctct
aacgacatttttgtaataaaagacgagttagtttaccactacggcgattttaccctgaag
gagatcgtgaggaagtattaccgttacgggaagagcttgaaagtgcttaaagacactcct
tactcctttatgacgtctgtgagcaggaagaggagggaaatatgcgttggtggtattaaa
ggacgacttaccctttatatactttacttagccagaggtattccttttctgttcggtaag
tttagttta
>SSO0809 (galE-2) UDP-glucose 4-epimerase (EC: 5.1.3.2)
ttgttgatgaaaatacttataagtggaggagcgggattcttaggttctcatctaacagag
gcattgttagaaaaaggagaggaaataacaatagttgatgatctatcaaccgcaaaatac
tttaatatacgaaaagatgtagaatttattaagaaaaaagttgaggaatttgagacagaa
aaaaagtacgacgtcgtcatccatttggcagctagaccttcaccggaggactacatagaa
catccagtagatacagctctttctaattcactaggtacttacaaaatgctcgaaatagcc
agaaaaagtaatgcaagatttatatacacatcttcatctgaagtatatggttctgcctca
ataattccgacccctgaaacgtattggggttacgtaaatcctataggaataaggagctgt
tatgacgaaagcaagagattctcagaagctttgataatggcttaccacagacaatataag
ttagatacaagaatccagaggccttttaatgtatatggccctggtctaagagaagatgga
acttatggtagagtggtttcaagatttatttatcaagcactaaaaggagaggacgtaaca
gtgttcggagatgggaatcaaactagagcttttctatatatatctgactgggttgatgct
acaataaaattaatatacaaagatggactagaaggtgaagtatttaatataggttcagac
aaagaaataaagattattgagttggctaatatgataattaagcttaccggtagcaaatct
agaattaaatatcttccccctagaccagatgacccacctaggagagcagctgacataact
aaggctaaggaaaaattgggctggtatcctaaaatttccttagaagagggattaaaactt
accataaattggtttaagggtgtattaaaa
>SSO0810 (ugd) UDP-glucose 6-dehydrogenase (EC: 1.1.1.22)
atgagaataggtgttgtaggattaggtgttgtaggattagtaacgggggcagtattagca
gatcaaggacatgaagtagttggagtagacattgatcaaaataaggttaaaggtttacag
tgcaaccgttctcccatttatgaaccaggtttagatgaacttctcttaaaaaataagaat
agatttctcttcaccacagattactccgcgttaaaagacgtggatattgtctttattaca
gtcgctacacctaccgtagaagggaagaactatataggctatgttttagacgctgctaag
actatgaaaccttaccttaagagggatgcgatcgttgttgtgaaaagcacagtagttcca
ggtacaagtagaaaagtaaaacagatagtagagagggaagtagtagctaacccagaattt
ctaaaagagggtagtgctgtaatagacaccattaaacctgataggatagttattggaagt
gatagtaaagcggctggagatgtaattgaaaacttatggtcatttacaaagactgtggtt
ttaaggacttcaattgaagaagctgaaatgatcaaatacgctgcaaactcttttttagcg
acaaaaatttcatttattaatgaaatagcgaatttgtgtgaggtaatacctaactgtgat
gtcaataccatagctaaagctataggattagataaaaggatagctccctatttcttaaac
gctggcttaggttacggaggttcatgtttccctaaagatactctagcttttgcatccttt
gctagagaattaggcgaggaattaaaaatagtagaagccgcgataaaagttaatgaggaa
agacctagaagagctgtaaagataatggaagagttattaggcgaactaaagggtaaaaca
atttgtattttaggtattgcatttaagcctaacacggatgatactagagaaagtgtagcg
ttaaaaattgctaaacttttagtcgatattggggctaacgtcatagcatatgatcctaag
gctaaaacatcgttagtggaaatggtaagcagtaaggaggagtgcgtgaagagatcagat
ggtgtaataatagcaacagaatgggatgaattcagaggcatagagcatatgcttaaagat
aaggctgtcttagatggtagaagagttcttgaccctaataagatgtcaagaagtaaatat
agggcaataggattatctaaggtgagg
>SSO0813 UTP-glucose-1-phosphate uridylyltransferase (EC: 2.7.7.9)
ttgggcactagattacttccagcatctaaagaaattcctaaggaaatgtttcctatccct
tttaatgggcaatttaaacctataattcagattattttcgaacagttatatgacatcgga
ataagggacttcgttattgtagtcggaagagggaagagagttattgaggatcacttcaca
ccagactatgactttattaattacctcgaagctaagggcaaggttatccaagcaaattat
ttaaggcaattttaccagaaagttgagaatagtagaatagcttttgttaatcaaccagaa
cctaaaggtttcggcgatgcggtgctaagggcagaaccttttattcaaggagaatttcta
gtagtggccgcggacacaattctacccatgatacctatatcatcaatggttgttaactca
tttttagttactactgtccaagacccaagaccttacggtgtcgttttagtagataagcag
gggtgtgtgatagatatagaggagaagccgaagcagcctaagtctaacttggtcgtagtt
ccttattacatgtttgatgaagagatattcgatgaattaagacaaataaaatacgaagag
gaattgcaattgacagatggtattaaaggtcttataaaaaggggtagaagattcaaggct
ataatggttgataaagtttacgacttaggcactgtcgagaattatatagaatccttaaga
agattactaaacaacgat
>SSO0814 Conserved hypothetical protein
atgatggtcgacttacgaccttttacggggattccagctaaggcgatactctcacggaga
agtgactttgccgcattttatcaagttataatagaaaatatttactctcacctactttca
agtattagagaaggagatgtagttatagatgcaggggccaatataggcttgttttctatc
cttgcatcatttaaggttaaggaaaagggaagagttattgctatagaacctgagcccaac
aacttaaaaatcttaaaacagaacgtagagttaaatggactaaacaacgtgatcattatt
cctaaagcactgtacgacaaaccaggtaaaagggtcaatatgagaggagaaggtgtagga
gcttttgtatctgaggacggtgaaggtactgttgagacgaccactcttgacgtgatagca
gaagaaaaccgtttaagacctagaatacttaaaatggatatagaaggagctgaaggtaaa
gcgcttctcggcagcataaacaccgtgaaatacctagaactaattgagatggaggtacat
gacgaggaaaacatgaaacaagttgaggaaatactatttaggtttaagtttaaaaagaaa
gaggtggcaatagaggatttaagaaacgtttacagacagttcataaggcatccaattaat
atacttaggattgaggcagctaataggttttctactacaaaacgtgtattattatcaaga
attaatggtggtaaggtttctcttttccccaaacaaatagtttactataggggc
>SSO0816 Hypothetical protein
gtgaatggcttctcgtcattgctaacttgttggaaaaactacgtcgccataatctttgca
tctacgcttttatctttgttattttcattcttgaacttgcttatatctgcaagtatactc
acactattttatctcatagacttaattgtaccgccattttatccagctaacgtgatggaa
aagcctatagtcttcctttctccgatcctaattatatcgattacaatttatattttggtg
aaattattttttagtaatttaatattttttatatctcttattatattgtttattctagac
gtgatattgtcgtttaaaagagcaaaaaat
>SSO0817 Hypothetical protein
atgtactcatatatgcctaaagacccaataaaggaattctacgagcaacactacgctaag
ttagagttaacagcccacatgcttaggaggataaaactaactgaggacgcgattgaaaaa
tttgcaaaaagtaaagagtcgatattagaaataggctgcggtactggagagaacttgtct
tactacgttaacaagtttcatttcactaacgcctactgtgtggaaatagcatcttttgct
gagatggaaattagggagaagggcataaccccgtttatacttgacgtaaacgttactgag
attcctttagagatttcctcaatcgatgttttggggagg
>SSO0818 Conserved hypothetical protein
gtggagttcattccgcctaaacgattgcttgaattaataagacaatatagtacgactttc
gagaactggcattcagtaatgctcagtatttatcttcataaagagaggataaagtgtaaa
ctaagaaatgggcaactactgtatttgaaacctaacgagatagtcttgctggctgggcta
aagatcgttgaacttaatgaagatagtgtgagatttcaatttaatggaagggaaatttgt
ttgaagggttggaaattaagttatccaggtgattccttctcagattattggagaatagac
gttaggggaaagagagtgttagatataggggcagggattggggattccccaatttacttt
tccattgcaggagcgaaagaggtggtagcagtagaagtagacagtaagaaagttgaacta
atgagggaaaacttaaaggctaacagtatcaataacgttattgtggtagacaagggcgta
ggcataaaggacgatgaaaattatatcagttggccaaaattaatctctaattatggtcca
tttgatgtagctaaaatagactgcgacggatgtgagaaaatcatagtcccttatatcaag
gaaataccgagtttgctcatagaatgggattataactataaggatatagtaagtaatctg
actaaaaacgggtataaagtaaaagttgagcacaccctaaagaacttagggtttatttat
gcaaagaagcgg
>SSO0819 Conserved hypothetical protein
atgaagatctttttcctcaccagtcgtcttaaagaaagagacggggccagtagggctata
ataaatttttctaaaggaataaaacaaataagtcgatatgaaccagtaattatttcatta
tctacctcaataggcgtaaacaaacttggaaacatagaaataattaatatcgataaaggt
ttagggctgctttcaagctttagaattcttttaggctctccgtcccctctaaagcccttt
aaaaaatatcttcatgatgatggaatatacatagtcgctgttgaagacataattcccgtt
tcagaatttaaagacgacttaatctattggagtcaaggagtgttaactagtgtatttttc
tgggaaccgtttattagaaggaataagctagtttcagcattagcgtctccatttctccta
tataatgcgataaaattctcgaatttcgttaagaaatataaggttgtattagcgaatagt
aaaacctcagccgtctatgtttctttactttacaacagaccccctaaggcagtagtttac
ccgcccttaaatacagatttctttaaaccttctaagaataaagagaagttcgtgttagtg
tttctaaaaagaggatatccttctcacgtagatctgctaactaaaatcgcggaaaaagta
aagatgaagagcatagggtataagatacctaacgccgagtatttagagagagtttctgat
gaggaattaagggatctctactcttcagcattggttacattgtaccctattgacttcgag
tattatggttatataccggttgagtctatggccgctgggacaccagtaattgcttttagg
tattctgggggaccagctgagactatagtagatggggaaacaggttggttagcatcagat
gaagaggagttttatagactaacaataaaagtttataacgaaggttacccagaagatact
agtgtgaaaagcagaaaaagagctgaagagttttctatacaaaatcagactaaactgctg
ttatctattattgagaaactaaaagca
>SSO0820 Conserved hypothetical protein
gtgttaagatcaacagtaatcgttacagcgcataggaggaaggcgtttataaaggacgct
attgagtctgtcatggaaaattcattgaaaccaacagagattatagtagtgaagaatttc
aaggactatcagattgactcgtttttagaaacttatcatgttaagaatatttatactgat
gatgaaacattgggcggaaagatttcattaggcatatatcagagttctggcgatatattg
ttctttttggatgatgatgatttatttagtaaagataaaattagggaagttatctataaa
ttcagtaaatatgatatagggttttatcataacgctcaagaggtaattcataacaagtta
actggttctaatttatctacggataatcaaagatttatgtattatactagtattgacact
cgaaggctgaaggaacttttatacaagtttaaagcagggtttaacggtagttctatagta
attagtagagacttggcgatgagatgcgttgacttattgaaaaatgttaatatatctgtc
gatacatttctattattttgtgccgtagaaaataacctacctataatgatagattttaga
aagttgacttattacaggattattatgagccaaaatagtaatacagaggtaaatgacaaa
ttgtttaagatgctatacgaagacgcattgtattttaagcaaatatttagtagcaaagcc
ctgagagattttattgaaatgtctattattcagcatgatttcttatataagattatttct
aaaaaagaaattagtaaaagagacgctttaattagcatggtaaagatgttaagatattcc
ctaaaataccctaataagtggaatttcttcctacaaggactttccttattatcagtgttc
tcagcggagaaaagcagaagtctctatctaaaaaaagttcggagtaactcaatgctctct
ata
>SSO0821 Conserved hypothetical protein
atggctaactatgcatcatttatagaggtactaataagtaatttcaataggtatccatat
acccttttccctttatatgcaaaagcatacaaaaatccattaattgtagccctcaaatca
ttattaagacattacccatttgttgttgaattaaaaaacggagaaaaggttttagtgacc
ggaaaagggtataagatcgcctcttattatgcttttctctatttagctcgcaaaaaaggt
aaaaaaataaatataatagacatagatgagaatacaattaaaataatttatgatactaat
gagataattttgaaggattatactaaaggtgatatcattggagtttacattaaggaagaa
tatcaagatgtaaacgtaaaagataaaaccgtcattgattgcggagctgcgataggagat
tctgctatttacttctcgttaaaaggagccaaaagagttattgcgatagaagcgtatcca
aagatagctaaaattgcagaggaaaacgtgaaactcaataactttaagaacatccagatt
gttaatgccgcgtgcggaactgatggtattgtaacggtgaatccgaggctaggcggtgga
ccaacaccactgatgagttcaaataacggttatactgttccgtcgttctcgttgcaaggc
ttaataaaaaatttccaagtagagaaaggaagcgtgttgaagctagattgtgaaggatgt
gaatacgaattcttattaaatgctgatagttccacattagagtattttgaccagatcata
atggagtaccattatggatattctcatctgaaaagaaaattagagaaggccggatttaaa
gtgaaggtaaccaaaccagaactatggaataatcaatataaaaagggtttaatcctaggt
aaattatatgcttctagagaa
>SSO0822 Hypothetical protein
gtgttttttgctaggctaattccactaaaaggagttctagagcttccatttatagttaag
gaagttataacaatgagcggatataaggagttaaagatagtagtcatgggaaagtttcct
gatgataacttaaaagcaatttttttcgaaattgttaagagacttcaattagaagataac
ataatatataaaggatatctgactagtagagaagaattatttaatatggtatcggaagct
agatgcatgatatatcctacacatgaagattctttttctttagctatattggaatcaata
actgtgggaactccagtggtggcttatgacatacctgggcctaaatctgtatatagtgga
ttaagtgcggtaaaattcgttgaggaatataatataaaacttatggcgaccgaagttaca
aaaatcttaactatgaatgatgatgagtacaactcccttatttttaatgacaaaatggat
aaatttatcgaaaaacatactgactgggatttagtagtcgaaagatattatagagattta
atgtcgttattt
>SSO0823 Hypothetical protein
gtgtgtcagattatagcacaaaaaattttagttcttatggatccgcaaccagagggtggt
tcagcatacgtggaagctcaaattagcaggaggttattaaacaaattcggcgataatatt
aaggtggcatacaagattaatgattggagttatattgataaaatgttaaatgagttaaaa
aatgataatattaaaatgatttttgacctaaactattggcctattaattatcatcaaatt
aaattttttaagaataattttaaaataaacaattatcatattctattggatcatagttat
tattattctagaaaacttaaagtcagaagcgctttgttgcttcaaggtatgggtttgcat
gcatctaggcttggaattccttacaatctaattaagtacttgaaaataaggaaaaacttt
cctatagatatctttcttagtactaggaacaagcttatatacatttta
>SSO0825 Hypothetical protein
atgttaaagcaaattagacccttatatttattactctacttaactcctttaatgtttgat
attatacttttatacacatatcttgataatggaataatatactggttagactctaattat
cctttttctccattaatattacttaggaaaattttattttattattggaacgatcccttt
ttccctggagctccacttttctattctcaagattcattattcatgggaattattattttt
ctactatacaatatattccatttttccttagagttatcagagtttatttacttacttctc
tttatttatctatctcaagtgggttttgtaaaactcttaaatattatatttgaaattctt
gagaagcgatacagttcctattttaccttaatagctggactattagggggatttatatat
tcatggggattttattcttatacgccgcctatattaggagtaaattacccgttttttatt
ttttatatgttatttcctttagtcctatattttagcataaagtatattttcaaggaaaaa
gtcatttcattctctttaataattttgtatttaattctggctagtgggactctattttcc
gaatttacgtacctactttggtctatagtgctctatttatttactgtagttccaatatgg
ttactttcacgtaaaccttcttttgtacagtttaccgtaaagaacctcgttatagctcta
attgtcatcgtagctggattagaacagctttatcagacatataatgcatcaataggagca
tatcaagttggtgttcacggtgagtttctagggaagccaatagttatatatgaaacagag
gcacaatacaaaaactttcctttatcttcttttatatctttatattcgccagaaaaatat
gaaattattggggtattaatatttgtactgattttcgctacgatactctttataaaaggt
aaaactggtaaattctttgctccccttttatttctattattaataataggaggattgtct
actggaatcataaatgttttacccttatattctttacactctactcccataggtttcatt
gctataggcttaatgtacagtatacaatacatcttttctggttttcctgtttcctttgtt
agtagtctaataataggttatacactcttgtatatccttgaatatctaggcaaaagaaga
aattacattaagattcttttcatcttaatcattttgcttttatcctcgtcttatatttac
tcttttagagctggcgaggtacacccagaaattagggcatttaacttgccagttaatgct
acaaatattttctacccaccccctgagttagtcagtgtgggaaactatctttctgtgcac
gacgaattttataatgtaattgaattcccaatgcagtatgctgcgggaatgtacgataat
aacggaacaaaagctgtatggtatacaatttatcctttgtcagactacattatggggcaa
gttataaaatctcctgctcttgctaacaacgcgattataaaatctcttgctaacagcgcg
atttaccccatttataagtactttccagcttttaacataactaacataaccaactatttc
gtattattaggggcgaagtacattgtgttaaacaagcaagaatatccaggcccaggcgtt
cctctgggttacgctggaggatatccttggaattacacgaaatttattgaggctttagct
cgtacccctaatataacgttagtaatggaaaatagttattacaacgtgtatatgataaac
ttaaacgtaagtctattatatccatctgaggggcttgcggaaaacctaagtagtgaccag
ttgttctttctttacgcgaataatatgctaaaagcacagaaacagagcgtgatttacggg
ttaggtgcgattaatataactaatatctctggcgttcatattagagtggttaacgattac
tgtaacgaggtatacgagattcaagtcaatgcctcaagaccattttatttagtcttcgat
gaggggtattcgcccttatgggaagttacaataaacggtgagataaatacccatcactat
atagctaatggttacgcaaatgcgtggttaatgccagctggaaattacgtagccacatta
aaactgagtatattacaaaccgtgcacataacgtatttattggtctttctgggcttcatt
attctggtcttaatctatgtgttacaaagatttaagatatttagatattttaaaaactat
>SSO0826 Hypothetical protein
atgcagataatttatagattaagtaaaggttcagaaatagagaaatttttgaggtatgac
tatttgttcttgaaagtactgcacaaattatttagaaacactaaaaagaaaccatcagat
gatatctgcaaattgaatttttatgatatccttaaggttattaataatccatacgccgaa
gacagacttagaaactttatccttgcaatcgcttcctatttcccattcacattaaggaag
atcattctaagaaggatttataattttagagttaaaatgtacaataatctgtttggt
>SSO0827 Conserved hypothetical protein
atgagacgatggttaaaaactttactctttactaggattaatacaaaggctatcgtagcc
aattttgatcaagctgagatttctaggtatttatgtaataaatggaaatttattcagtcc
aaaaatagatggatagggcccaaggtttctgaagcactaaaagaaacatctggtgatgtg
gtagttttcttagaggatgatgatctatttgaaagaaccaaattaaaggtaatatatgat
atatttaagcaaaatcaaaatttaggtttttatagacataaagttaagattattaatgaa
aacggtaaggaagcaaatttaccttacaacctatataattctggtaaaattgttatcaag
aaaagtcgaaatattggaaaacaatatttattaacttacacagaggcggttatgtgtccg
tgtcttccatggcaatcagaagagaaattt
>SSO0828 Hypothetical protein
atgagcgtagagaatatctctttctttggagaatttttgattataagtccatattatatt
ctaagaaataatggaatattgttcgatgaaacctatattaatggagtagaagattttgat
ttatttttaaatatattaagcacgggttcttataagtctatacgctttaatattgagcat
ttaggtggtagatcactaggaaccgatgataaaagatttctaagaaattatattaatatg
atatatttaaattataaaattgtaaataaagttataaaaattaagaagattaatataaaa
tta
>SSO0829 Conserved hypothetical protein
atgggagtgtttagtaaattaagaaaatctgtggggtttacacgattattattacgatat
gttgacaattggtttgacattttataccttactattgctaataaaaaattggcattttta
gaagttaaattaaaagacaataatagaatatttttaaaaaatagtatttacgatttatac
gctcttcttagcttattaaaaaaaggttggaaggttaaagaagcagacgagaataatgct
attttatgcaaagaagtctgtttgaaaattagaactaaaaaaggtgcagatattggacat
atagatgaaatatatgagtgcaagacctatggtgagtcttttaaaggagttgtaatagat
gtaggagcttccaatgcagattcgtctattttctttgcaactaacggggcagaaaaagtt
attgcgttagaaccttttcctgagtcttatgaacttggaaaatataatataaaaattaat
aatttagataataaggtaattttattgccttatgcattaactaattatgaggggtatgta
gattttattatttcttcagacaatcctaatgtaaatactgttagcccttctactcaagtt
atgggattattaggaattaaatttgaccaaaagattaaggtgcctacgacgactcttgca
tctttaattcaaaaatataatattgatagagtatacttacttaagatggattgtgaaggt
tgcgaatacgctatattaagggatcttcctgcagaagtattgaataaaatagaaaatata
atattagagtttcacgattatccgcaagatcttccagatattttaagaaaagctgggttc
aacgttaattacgagaataaacctataggaattttaaaagcatataaaaacgataaacta
gcg
>SSO0830 (rfbB-1) dTDP-Glucose 4,6-dehydratase (EC: 4.2.1.46)
atgaaaatcatagtagttggtggtgctgggttcataggctccgctttcgtgagggagttg
aacaagaggggtataaagcccatcgtagtagacctcttaacctacgctggaaggaaggaa
aacctcattgggacagactacgatttcgtccaagccgacgttaggagcgaaaaaatgcat
gatataattaaggagtattctccagacatcgtcataaatttcgcagccgagacccacgta
gataggtcaatttataaaccacaagatttcgtaactactaatgttctaggtacggtaaac
ttacttgaggcttcacggaaattcaatttcaaatacgtccacatctctacagatgaggtt
tacggtgaggagtgcggggatgagaactcacctttaaaaccctcttctccttatagcgcg
tctaaagcgtcagctgacttgttcgtaaaggcttacgtaaggacttatgggataagtgcg
gttatagttagaccatctaataactacggtcctaggcagttccctgaaaagttaatacct
aaggctataattaggactttactagggatacacattccagtgtacggtgatgggaaagct
gaaagagactggatatttgtagaggacactgctaggataattttcgacgtggtgagtaga
gctgagtggaaaggggaagtatataacataccgggagggcagaggtataatgtgctcgag
atcttgaagatgttggaggaagtgagcggtaaagaggttaagataaagtttgtctcagat
agacctggccacgatagaaggtattgtatgacaacaagtatgaaatatgaagtaacgcca
tttaaggagggtctgaggaggacttatgaatggtatttgaataacagatggtggtgggag
cctttaattaatgataagttcttcgtagaagacgagccgtggttgacagtt
>SSO0831 Sugar phosphate nucleotydyl transferase (EC: 2.7.7.-)
atggaggcagtaatcctacatggagggcaaggtacaaggctcaggccgttaacccatact
ggcccaaagcagttgataaaagtcgcaggaaagccggtttcacagtgggtcttagaacag
atcagggatgcagggataagggacgtgattattgtacttggagacaacgcgccaacacgt
gtcgtggagtattacggagacggtagcaagttcggggttaggataacctacgtttatcaa
ggtaaggctagaggactagctgacgcggtttataaagtgaaggacgtggtttcggacaag
ttcttagtctacttaggggacaacttagtcccttatgaccttagcaagttctcctctttc
aaaggctcagcttcaatcctactagccaaagttaataatcccaataggtttggcgtggct
gtaataaaagacgggagggtcgtaaagctcatcgaaaagcctaaagaacagatttccgac
ctagccctagtaggtgtttacggtttcacaagggagatctttgacgttattgagtcgtta
aagcctagctggagaggtgaactcgagattactgacgcaatacaagggttaatagacaga
ggtagggaagtaaattatgaaataatccagggttggtggaaggacactgggactccaaag
gacatcttagaggctaacgcgtttctactagacagatacgctgaaagtaggattgaaggt
gtagtagacaactctacagttgacggcaaagtgataattgagaagggggctgtaataaag
aactctgtggtaaggggaccaacttacatagggagggacactaaaattatcaattcctat
ataggtcctttcacttctattggtgaccagagcgaaataacggacagtgagatagaatac
agcgtaatccttgacggcgttaagataaggggggtgacactaatggactctttaataggg
aataactctactgttgaaaaaggtgggagatggcaaaagctaattataggtgagaactcc
tcggtgatatta
>SSO0832 (rfbD-1) dTDP-4-dehydrorhamnose reductase (EC: 1.1.1.133)
ttggaggatttcataattaagactaggcctgatgttataataaacactgcagctatgact
gacgtagacaagtgcgaggtagaaagagaaaaggcttataaaataaatgccgaagcagta
aaacacatggtaagagctagtagggtagtggaagcttactttattcacgtgagtacggac
tacgtttttgacggcacgaaggggaattacaaagaggatgacttaccaaatccaataaac
tactatgggctgacaaagttattaggagagacctttgccttatcatacgacgacagcctc
gttataaggacttctggggtattcagacacaaggggtttccagtatatgtgtacaaaacg
ttaaaggaagggaagacagtcttcgcgtataaaggttattactcgcccatttcagcgagg
aaactagcatcagcaatagaagagttactggcccttaggaaaactggtttactaaatgtt
gcaggagagagaatatcgcgttacgagctggctctaaagattaaggaaaagttcaatttg
ccaggagaagtgaaggaagtagatgaggttaaaggatggacagctaggaggccctttgac
tcctctttggactactcaaaagctaagaaaatcttatccgtcgatttttacagtttagac
ctagaaggtatggtgttg
>SSO0833 (rfbC-1) dTDP-4-dehydrorhamnose 3,5 epimerase (EC: 5.1.3.13)
atgccttttgactttgaagacctaggtatgggagttctgttaattaaacctaaggtcttc
cctgacaaaaggggtttcttccttgagctgtttaaggctactgacttcagcaaacacaac
attcctatgccagttcaagttaacatgtccttctcagttagaggagtagtgaggggattg
cattatcagataacgccaaaggaacaaggaaaactagtattcgtacctaaagggaaaata
ttagatgttgcagtagatgtcagaaagtcttcaccaacttttggaaagtacacaagtgcg
gaattaagtgagtctaaccaccacatgttgtggattcccccaggctttgcccacggtttt
caagctctagatgattcactagtcgtttacttcgtaacccataacgactactcgcctcaa
cacgagaggtgcataaactactcatatatcgaatggccgattaaagaaatcatagtcagc
gataaggacaaacagtgccccccacttgataaggcagaagtgttttct
>SSO0834 Hypothetical protein
ttgtcttgctttatctaccgaataaaaatgaaaatgacaaccacaaaaggaaggtttaat
gaaaaatcaatcgaaagtctatcaatgggtataggtataatatccgttgtagttctatta
acaacaggcggttcaattagcatagcatccatggtattgctatcaacggcaatcattttc
ccaatatcatttcttttaataactaaaagaaacataaacagacttgtgataaggctaaca
agacctataataaatgcaagtgggtttgacgataaaaagttagaaattggtaatgtatta
ttattactgctagtaggactgctagtaataatctatatcatcgtaaaatgtatccccaaa
gcttttgaagaatacatatctacagtatcgccatcaaaccctctatataactccattatg
accattatgactatctataagccatggcaaggtctaggtagtttattcagcagtcccatc
ggtttaatcataataatcttaatagtagtcatgatagcagtgataattgccctaaagaaa
agaagtttctccagttatgcaggcaca
>SSO0836 Partial ORF from ISC1904
ttgagattcaaagaagaagacgtagaaagattaatgggaattatcaggaagaggaaagta
atactatacgccagagtatcatcaaacaaagacgacctgataaaccaagtaaagtactcg
aggagaacgtcaaagattacgaccaagtcatcaccattttggattaaacatgaagagaaa
agattcctcaaactactaggaatgatactcgacaatgaagtatcaaaagtagtcataaca
tacccagacagactagtcaggtttggtctcgagtatccaaagcatacaactgcgaactcg
>SSO0837 Polysaccharide biosynthesis related protein
atgaatcctataaagaacgcgttgaagagcctcagcgtaatcaccactaatgtcctaatc
gccttaatcttcttcatagtcactgcaaaaatttctaatccagcgttctttgggaaagtt
gcaataattcaacttcttgaagtagttacttttacgttcttttactttatcccgggacaa
ataataacaagggaaatatcttacctttacgcaaagaaggaggtaaataaaggggttgtg
ggaaagttcctctcattccctttcctcgctataccagtttttctaatcttcctacttttc
ccaaattacgttaagttagcgatcccttatctctttctctaccttctgaataatgtccta
gttgctataatgatagggatggacatgtttactgagacagcaataactgggaaccttttt
ctaatcataagatgggggatttcaattatcgccgtcctctctcacaatatttacttattc
gtagaaatatggattttgggaggagtactctcagtcctccttaactactcttttctgtct
agaaaagtggggctagtcttaccttctctagactttgcatttctgtttaagcacttcaag
gaaggcttacctctctacttgtcttcttcagctaatttcctctcatcgcaaggggacaga
gttacaacagcctatttgttaggctcttactatctaggtttataccaattttctgcatta
gtagctggggttcctgcaatggttttaggggcgttgaacaacgttcttttacctactgcc
tcattctataaggctttaggtagtgacgaaaagaagatgtcttcaatttcttttcgcgta
ttggctttaatctcctttctgtcagtaattatttcaatacctattgctatcctggtcgtg
gaaaggtttttcccagactacactgagggtataagagttttgatcctactacttttagct
acaaccctaccttttcctataaactctctaacgaacttcataatagctgctaagaagtct
ttaaggccctttttattcctttcgctgcttaatgctggtgtagtcttactgacttccttc
cttctaattccaagaattggaataatggggggagcaatttcccaagtaatagtcaccgtt
atctcctcttcttttatccttgtgtacgctttaaggacttcaacatttattttgggcaaa
agggagggcatattactgactgcaatgcctttaatagctctttatgaagttttcgtagat
cctccatatctcgacctccttttgcttctctcggttattgttctttttaagttatttaag
ataatttctactgaagaggtgagattaatagagtcttttttaccttctaagctaaaattc
atagcctcgctattaaaggtaattagt
>SSO0838 Conserved hypothetical protein
atgattttcacatatggcaagactaagctgaaagtcccggagggttacgaatacgtttat
tacgctactttcatagccgctgaatgggacttcttgaaagttaaggacatggacactgtg
cttgatgcgggcgcatttattggggatttcaccgtaaaggtggctaggaaggctaaggaa
gtagttgccgttgaacctttaccttgggctttcaaactgttgaaggaaaacgtggagata
aacaatttaaagaacgttgttttggtgaacaaagctttatatgatgttgacggtgttaaa
ctaaagattgtcgatgaggggactggctcgaggattggagaaagcggggtcgaggtcgat
agtgttagtgtgaactctttaggcaagttctcagtagtgaagatggacatcgaaggagct
gaggggagggtgatgaaaagcggggagtggttagactacgttaagcaaatagctgttgaa
ctccacggtagagaaaacatagagattataccacacttgttgaggaagaggagttttgtg
atcaggttcatgacaaggggtgatttggttagaaacactgtaaggaacgcgttactccac
cccatttcgtttataaaggctgaggctaggactaaagtggtcttgaactactttaagagg
aagtactacgtaccggctctgagcggggatgagtataagatcgtttacggtaggaga
>SSO0840 Hypothetical protein
atgagattactattgttactattaatgttgacaattaccttactttcatcagtaagttcg
ttcactgcctcagtttctgtgcaatatccaaaggaggtaatattaggtagtaaaatttcc
ataaacttctcgttaactcagcaggagataaatagcaccgccttccctttcataactgca
ggggtaagagagataagcgaagaaccactaatacttgagggggcggggatagcaggatca
ttcgcagtatttaaaataaacaactcctcacaagttgtggtaattacgtttataggtaaa
gataatacatctccagggtggaatcctggcatagtagtttatggagggaattttaatcct
cacgtatcagatttatcgcagggagactttaccgcagtcttaattaccttcactggtaga
ctttgggttcacactccttctaagggttggtttactctttcttgttctctccctagcata
gctcctcaaagggacggttggattaacgctactaagcctttcaattacactgcaatcttg
gaagacgttaacggttcgatttttgttaattatgtaatccttaacggcgaaaaatacatt
gttgactatcaaactcctattccttggaatttcacttacgtgggagttagaattgacccc
tctacggtaactgtatgcggtttttatgtaacaattccttctcctcatcaaccttacgta
gtttacgttaacggcaaggaatacactaaggggtatacaaatagcctgggtgaaggttca
gtttcacttactatatcttctccttccatggtcgttaacataagtttcccttcagcccac
gtctttcgtgttataacaatttctgctcaaagagacgccaatatacacgttgaataccca
atccttcagtatgcacttttaggtgtttctgtagttttggttgctatctcgataatttgg
aggaagagacta
>SSO0842 Transposase ISC1476
atgccctcctctggtcaactttatggggatgaggagcgggagctaactcctactcccgca
ataccggaggagggtgtctacgaagttaaatactcaaatcgaagaaccaatgtagttcgt
cttcttccaaatggttttcaagagaggaagttgaggaggttagctaatctctctgcaaaa
ctcttcaacgaagttaacttcgaaaggaggcaacaattctttcacgaagggaaagtaaac
attgaggaaacatataaaaaatattatgagaagtataaggtcatactgggcgttaatgct
caagctgttctcaataagaataatgaagcgtggtcatccttcttctccttgttaaaactg
aagaaggagggaaaactaccaccacacatgaaccacgtttctccacccggatattggaag
gacagagaagcagggaaaagaaagcaaatactagttattagacaggaccgttacaaggta
gatgctgaaaaccacaaattaatcctcaaggatttcgacatggagatagacttcattggt
agactaaaatggtatggtaaacaaggtagactagaaataatttttgacgaaaccagaaac
gcttggtatgcgcacataccaattgaagtaggtgttgaggaaacaaaggctggaaagaag
agtaagcacgtcgtcaagggtgagagaaagtccatccagatttccaaaccaaagggaaac
aaagtagcttcaatcgatctaggcatcaacgtaatagctagcgtagtagttaacgatggc
acctggttgttgtataagggtgttagaacaaaggaggactacttctacttccaaaagaga
attgcagaagtgcaatcgttagctgacagaaccagaaacattggtgaatatgatgcgtac
ctagaattgttgagggaaaagaggaggttgtttaagaaactaactaggaggctcactcat
ctatatcgtaacttagcttcccaccttattgaaacactctacgaactaggagtgtcaaca
atttatctaggttacccattcaatatcgtgcaagaaaaaggcaataagtttacagtgaac
atgtggtcttatcgtaagttaatggaatccattgaattgaaagcacaagaatatggtatg
aaggtgtttgaggttgttgagtataatacgtccaagtactgtgcttatcatgatgtggaa
gtaaagaggaacccaagaggtgttatcaactgtcctttaggtcataaacttcacagcgat
ttgaatggtgcgttaaacattctaaagaaggcattaggagtaatcgttaacgcagtgaaa
aaaccattatccttcattgtggatcataaccgagtagcacccataaaggggtgtaaccct
>SSO0844 Hypothetical protein
ttgggttatagtgatagcttgtctaggaagaatttgagtgaagtattggagggtggggat
aatattatcttgtctgaggttaagtttcttttggatgagttggagaggcttgaggctagg
aagagggaggttgagaagaggcttgaggatgttgttcctagggatagtttgatctttagg
aaggtgctgggtttgataattttggcgagggtaggtgatgttaggcgttttgatgataag
aggaagtttgtggcttattgtggtcttgattctgttgagtgttgtattttgaggtgtctc
aaggagggt
>SSO0845 Hypothetical protein
atgcatagtattaggatgggattgctaggggatatgaggctctatctcgatatagagacc
tataggcctaagagtgcatttgtaaacgagaaggtaattgccataggattgatagctgat
cagacggattataaacctgaatcctcaaacatatgggatcttcctaaggtggagttcaaa
tactttaaagagtggaagcgtgacgagcgtagtgaagagtgggagcatgacgagtatagt
gttgttacccaattctacaagtatctaaaagagctgatagagaagtggagacgtaaagag
atgtatatcgaggttgtagggttcaatatacttaggttcgacataccgctcctcattcag
aagggggtagaacacagggttggaagtctagaagagctgaacagtctatggcacaatact
ttcaccagagactacctccaaatggccttgccccttaataacatgcggtttaaggggctg
cagcttgaatatttggcagagatgctcagggaaaaaggtgtgaatgtgcctaaaccatat
ggcaagggtgaagaagtaaagagcttatacgagaataagaaatatgatgaaataattaag
catttagaagcagacttgaggattacacgcataatagatctaaactggcctcggcttttc
aaacccacacct
>SSO0846 Hypothetical protein
ttgattgatctttgtgtagtaaaatgcgatgaaaatgaagttaaaaagaaatctaaggaa
atagttgaaggtcttaaggaaatatatgataattttaatgattcactcataaaagagatt
agagttgaagaatcagtatttggtataaggggatcttacaactataattccaagatatta
acattatattgtattaattgtgtaatatgtgttgaaactattgtccacgaaataattcat
tcaaatagctataagcgggcaagagatatgtattttgaaggtttaaccgaatttcttaca
ttgtattatctaaagaagagagttagagcttgcttagatcatagatttattgatgaaatt
tgtcgaattaataaagaatacgaaatatatgctacattttggggtaatctagctttgatt
ataggaataaaagaattgtggaaatattattccaaaggatataatcataataatatagat
aatttggtaaagaacgatatttacaaagcttcttttgagttagcaaagagatataatact
aagttaatggatttaattgatgttatagagaaattagaa
>SSO0847 Hypothetical protein
atgagttttggtttttattatgctggaataattaccaaggcagacgctataaggattatt
gacttattaaataaaaagggtctttctaagtcggagatagcaaacaggataggaataact
aggagttctatttatcagtggatttgggatattgtgaaagatatagactatgaaaataaa
gtaaaacttcttgatttattttatgaaatagataaattcgaagctataaattttatagaa
gaaatactaaaggagcatctaaaaattctagaaaaggaaaaagagataaattttaagccc
acgataaaagtagaaaaaatactagttcctgcttcaactacagttcaattaggagttgta
gattat
>SSO0848 Hypothetical protein
ttgatcataaaaagcataagaattttgtttaagttttcctatccttatactttagactta
agggacatgattagaatcctcaaggacttaagctacgttatctctagtaatttaccatta
actcctccagggtctatgatattaggaagtgtaactgcattaaaagatgatttaatagta
gaattcaataacattactggtactataagtttctttattcaatccctagataaaatagac
ttagttgaggaagactttagcaggattgttggtaatttaaacttgggcaagatagattac
atagaattatcattagaaatgatattaaatggaaaattaaatttaaatataaacatgcta
ggaggagaagttgtaggtctggaggtatcgtcagagaggaagaacgttagaatcaactct
tacatggcaatggctaactcctattccgtgctaattacttataaattaaacgaaattaaa
gatctagataaagtcactgaagaaataaaaagagatattcaagaacttgagaataaagga
ttaaga
>SSO0849 Hypothetical protein
atgaatgaatatattgccagatatgttgtatctaaggatcatagaataatcggggtgata
aatactaggtacacggcaaataacgacgatgagagtattaaaattgctaaatccgtttgt
gagaagttaggtgaagaagacattgaagaactaataataggaaaggtaataggtacagtg
agcgtagacgtaataggtaacttattaggaaagtccgatgatgacaaattgctcggaacc
atagctggtgcaatagtaggcacattagttggtcacgctatagattctacaataactaaa
gtaatatactccaaaaagtatccttgtatcaagcctaggccttttgaagatattgttaat
tatgttgacctcgaaagattagaagagatagttaatgaacgt
>SSO0850 Transposase ISC1190
atggaggccccagttgcagggatagatgtatcaaaagataaactaatagtatattttcaa
ggtaaattctacgaatttcctaacgataagcaaggttttgaggaagtgaagaaagtcctg
ccaagaggttgtaaagtaggtattgagagtaccggagtttaccacgttaaccttgccaag
tgcttgatgaatgagtatgaggtgagggttattaatcccttggtaatcaagaagttcaag
gattttaggggtaagaagagtgacaagaatgatgctaaaaaactcgctgaactagttgtt
aatatgggtagtgagtttacgttaagtgatgctagggagttgacgagtcaatgggatttt
atcgttaagagtattgttagggttaagaacaggttgaggagggacttaatcctcttgggt
tatagtgatagcttgtctaggaagaatttgagtgaagtattggagggtggggataatatt
atcttgtctgaggttaagtttcttttggatgagttggagaggcttgaggctaggaagagg
gaggttgagaagaggcttgaggatgttgttcctagggatagtttgatctttactataccg
ggtattgggaagacgctgggtttgataattttggcgagggtaggtgatgttaggcgtttt
gatgataagaggaagtttgtggcttattgtggtcttgatcctgttgttgagtccagtggg
gggagtgttgtgtcgcgaggtatctcaaggaggggtgatgctgttttgaggagggctttc
tatcttgcagctttgactgctatcaaggttaatccggtgatcaagcgtttttatgaggag
cataagggtaggttaaagggtaagaagttgattgttgcatgtgctaggaagttagctgtt
attacttgggctgtgctgtattataataagccctttgatgctagtgag
>SSO0851 Transposase ISC1290
atgaagcattggatagaatactacaacggcccggttccctatgaacatttatcagcaagg
cataaaacacttgtgaaaatgaactacatgctgatcacgtctgaagtgctgtcgcgtctc
tctgacctcttcatattgagagcgttaatagtaatgattgtgtggacgtgctcctacagg
gacgtgcggagctactacgagtcagacgtggtggtaaggtggttcctaggcgagtacaag
tctaagtcggagatccataggagggcaaagaaatttaggggagaggtaaagactctgttc
aaggagtacgccaaggagttggaggggaagatgagtagacttgccgactacttacctagc
agtgcgttatacggaaaggttggaaagctgtggatcgtggattccttcctaatcgaggta
cccttcgggaagaggaacaaggaaacattgaagaagaagtttgagctagacctaaggcag
aggaagtacagggaggcggctaacacgctcttcttttacattaagtgcaaagcgaggagg
aggttcaagggagagtttacaaagaagaggaacaggagttacttcggcttcaaggtcttc
aacctcatgtcgccaacaatgatagttcacgagattcaagtggaactggccaattttccg
gacaataaggttggcttctctcgcagcggttataaggtagtggataggggcttcgtgggg
aagtcctcgacctggttgataggtttctctagtttcaggaggtatgtggagttctttggg
atcttcttgaggaggtattggaggccttacgctactgaaaagggtatggtcgagttcttt
gtctacgttatcgcgttgatttacaactcctacatctacacttctgtgttatcgcgtgtt
ccggagagtcaactcgcccac
>SSO0852 Hypothetical protein
ttgcacttgggacactctcttgaaaggacagatagaacctgggagggcgatccattcaaa
aagttcgacttctatattcctaaatataatttatatttagacgttactggtacatcattc
accaaatcagagagtataaaaagggcgcatatgctgcaattgagaggagcaataatcgct
attctgggcataaaagtttcggtggcagaaatacttgctgcgaaaggctatagaactgct
tttgctaatgttgcagagagagaaggtgagataaggtttatgccatattctagactgaag
gtcttagaaaagaatggaagggccattatcgcccaaccagaagaaatagagtttgcgaaa
ggcgaaagaacgtatatactcacaagatggacagattggttaaaaccaaatcaatttttg
cgttggctaaagctaaag
>SSO0853 SSV1 integrase fragment homolog (orf D-335)
ttggcaatcataatacgtgagggaaaaatgacaaaagaaaagacgcgttataaatacggc
gatataattatacgcgaaagaaaaggtcggtattatgtctataagttggaaatgataaac
ggtaaggtaagggaaacttacgtcggtcctttaattgatgttgtcgaatcgtttataaag
ttaaaagaaattgggggtgtggggatatcccccacaacggacccgccgggatttgaaccc
gggaccaccggctccgaaggccggcgctccatcctagctgagctacgggtcccctta
>SSO0857 (argS) Arginyl-tRNA synthetase (EC: 6.1.1.19)
gtggatataataggaagagctaagaaagaattggcggaatatgtcgctgcacaattaggt
ataagcgaggaggaagtctttaaaaatattacatatcctcctagggaagaacttggcgac
ttatcattagcgttaccatcattaataaagggaaatataaatgagaaagcgaaattatta
caagaatataaaggtgagttaatagagaggatagaagtagccggaatatatcttaatgcg
aggcttaatctaagaaatattttcgtgagtatctttagcaaactagacgatagttatgga
ctggaaaaaatcgaaaagccaaaaagaatagtagttgaacacacgagcgctaatcctata
catccgttacatataggccatttgagaaatacgatacttggagatgcgcttgctagagcg
ttaaaagctagaggtcactcagttaatgttaggttttacgttaacgatactgggaggcaa
gttgcagttctaatttacggcctaaaacttttaggttttcctgatccagagccaaatgta
aagaaggatctatggttgggtataatatatgccatgactaatgtaattttagaaattagg
aagttgagagaggagttaaagaaactttcagagtcagagtatagggagaaagtgagagaa
ctagatgagctaatagtaatagcgaatgatctaaggaatagaaatgaggtacttttcgat
aagttagcagacgctataaatgctaaggaggagccggagaaggagataggagaaatcata
aagaaatacgaagagggtaatgatgaactaaaggggattattagaaagtacattagttat
gcgctagaaggctttagtgaaacgttatccaaacttaatataagatttgacaatttcgac
tatgagagtgacttgttatgggagaatatggttaatgaagtattaaaggccttattgtct
tcctcggctaaaataccatataagggagtaatagcattggacttagatagtttcttaggt
gatgaagctagatctaagttgagaattccaaaagggctcaagatacctcctttagtgttg
atgagatccgatggaactacattgtataccgttagggatattgcgtatacaattttcaaa
tttaatcagtttaatgcagattttgttataaatgtgatcgcagaagaacaatacattccg
caaatacaattaagaggtgctctagagttactcggatattcgagatttgcggaaaattta
ttgcattattcatatgggatggttaacatccaaggactaagaatgagtggaagactagga
aagataataaccattgacgagatatatgaaaaactagataacatagttagaaataagctg
aaagagaaaggtggtaatatggaaaatattgatgatatagcaaatgcagcgcttagatac
gcaattttgtcagtttctgcaaataagcctttatcatttgatttaaacaggataaccagc
tttgagcagaacagtggaccttatttacaatatacttatgctagagctgctaacatatta
gctaaatctactgaaaacttatctatggataaggtagactttagtgatttagttggagat
aagaggaacatattaatcttgatagctaaattccccgaggtattcaagaatgctgtagat
aacttaaggttagaagatttagtagcgtttctgagagaattatctgacatattcaatagt
tggtatgataaagagagagtactacaagaacaagatccaaggaagagaatgttaagatta
tatatagtaaaaggagtgtcagttgtattaaagaacgggttaagcgtcttaggtataagg
agcttagaaaggatg
>SSO0858 Hypothetical protein
ttgcagaaacataacgtatgtccctattacaagaatggctactgcacatcacctgcatta
gataagccttctgatatagtgacttctagtaatagatgcttcggtcaatttaaaacgtgc
agatatttcttaaacgacgggagtgacagcaaaataggattagataaattcaatgaagaa
aaaacaatagaacaagaaattagattttacccaaaaataaacgaattagaaaatattgta
gacagtggttgtgaacattatcgactcataaaaagtgaaaaagggttcatagcatattgt
aatgcgattaaaagagttttagtaacaagacaaaccctattatgtaataaagagttccaa
agatgcccttatagaaccttactcagtgcc
>SSO0860 Conserved hypothetical protein
atgttgaatcaacctgacttccttagacatatagccagtaagatcctatcaccactaaca
atagattcgaaaagattagacgaagcaagaagaattttaggagaagcagaagttaaatac
aacttctcctcatatggaggaaatccaaaaaaactaatagatttcctactaagcccggac
ttcacagaacttagcttaattttaggcccagatatgacaaaaaaactattagaagctata
aaagataattatacagacgaagacataaaaaaagtagtagataagatattagaggaaata
aacggatatacggaaaacactgaggagacaaacgttaaagtttcggttaataaaaaatat
ttagtctcc
>SSO0862 (thsA) Thermosome alpha subunit (thermophilic factor 55) (ring complex alpha subunit)(chaperonin alpha subunit)
atggcagctccagtcttattgcttaaagagggaacaagcagaactactggaagagatgcg
ctaaggaataatatacttgctgcgaagacattagctgaaatgttaaggagtagtttaggt
cctaaaggtcttgataaaatgctaattgatagcttcggtgacgtaaccataactaatgat
ggtgctacaatagtaaaggatatggagattcagcatccagctgcgaaattattagtagaa
gcagctaaagctcaagatgctgaagtaggtgatggtactacaagtgctgtagtattggct
ggtgctctattagagaaggctgaaagtttattggatcaaaatatacatcctacaataatt
attgaggggtataagaaggcatacaacaaggccttagagttacttccgcagttaggaact
agaattgatataaaggatttgaattcttcagtagctagagatactctaagaaagatagca
tttactactttagcaagtaagtttattgcagaaggtgctgaattaaataaaataattgac
atggtaatagatgcaatagttaatgtagcagaacctttacctaatggtggatataatgtg
agtttagacttaataaagatagataagaagaaaggcggaagtatagaggatagtgtacta
gttaaaggactagtgttagataaggaggtagtacatcctggaatgcctagaagagtcacc
aaggctaagatagctgttttggatgcagcattagaggtagagaagcctgaaatttcagcc
aagataagcatcacatcacctgagcaaattaaggctttcttggatgaggagtctaaatac
cttaaggatatggttgataagttagcatcaataggtgctaatgttgtaatatgccagaag
ggtattgatgatatagcacagcatttcttagccaagaaagggatattggctgtaagaaga
gttaagaggagcgatatagaaaaattagagaaggcattaggtgcaagaataataagtagc
attaaagatgctactcccgaagacttaggatatgctgaattagttgaggaaaggagagtt
gggaacgataaaatggtatttatagagggtgctaagaacttgaaagctgtgaatatcttg
ttaagaggttcaaatgatatggcattagatgaggctgagaggagtataaatgatgcattg
catgctctaaggaacatattattagagccagtaatattaccaggcggtggtgctatcgag
ttagagttagcgatgaaattaagagagtatgctagaagtgtgggaggtaaggagcaatta
gctatagaagcatttgcagacgcattagaggagatacctttaattttagctgaaactgca
gggctagaggctatatcttcattgatggacttaagagctaggcacgctaagggcttgagt
aatactggtgtagatgtcataggcgggaagattgtagatgatgtatatgcgttaaacatt
atcgagcctattagagtaaagtctcaagtgttaaagagtgctacagaggcagccacagca
atattaaagattgatgatctaatagcggctgccccactaaagagtgagaagaaaggagga
gaaggaagtaaagaagaaagtggtggagagggaggatctactccatctttaggagac
>SSO0863 Hypothetical protein
atgatgtgcgaaagatgtaacaaaagaaatgccataaacgtagtaggaggaagaagatta
tgtgaaatatgcagtaaagatgagataaccaagagaattaaaagagagctttatccgaga
aagataatagtatataaagacaagatcttattcgcttatccctcttacttaagctttatt
cgtgaaattctaaaaaatataataaacaaaatctacgctaaatttaacttacaatattac
gaaatcactctagaaccacaacactctatcttagatgatatgtggaatttaatcgtaaaa
agcaagcggttctcagaagagaacggaataagtaaaatctttttaccatttactgcagat
ttcttgatggcttacttaatatactcaataacaaaccaagattatacttatataaagatg
ataggattagaatataatgtaaataatatttcatttctaattccattttacaacacctct
ttatatgaattacaaggcttcttcactaacgaatctaataatatatttgaaacgaaagat
gaaattttcaatgaaattctagcatgggaaagagatacattaaaagaaaattatgaacta
tttcatgcttttcataattctaaaaaattatttgaaacgaaagaaaaagaatatagatgt
gaggggtgtggaggagtaattaactccccggtaaaatactgtgcgagatgctctctaatt
tactcttctcctccttat
>SSO0865 Conserved hypothetical protein
gtgccaagacgtaagaaaaatgaggaaggaaaggctgatagtgaaaagaatactagtaaa
gaggagattagaaagaaaaaatcttccagtagtaaaaaagcagagaagtatatagatcca
gataaggttttggatgaatatttaaatgagatagtcaacgcattggggatttcatattta
aatctttcagtagatgatttaaaggaggtattaagggagccctttgccagcgcggtagga
gaggtaaaaacgaagcctaaagtatctacaataattaatagactcaaggctatgggagat
aggttaatggaaattatttcttataaactactacgtttatatgatgtggagaaacttagt
gaagatcagctagagtttatagtgacttatggtaaaggtggcctgattccaataatggat
aagttgtataaggagtgtttaaagagaaataggaaagacttaatagatctattacgagta
acttggtcaatgttcgcaagtatcttaagatctcctattaaatgtcctaaatgtgaattc
gattcagtaatgccagatttatcttgtagggtctgtgggtacatgttaagtatgaaggaa
ttgaagaacaccatacacgtaattgatatattacaagactttttgaaaatggatcgagac
ggattttatgagatcttaaaatcgggttttttctattatacttcagaaggacctattccg
ccgtctagatttaaacctactcaaggacaaatatattttgaagttatcctcaataaggag
gagaagagtaaattagagagcatctcgcacagtattttaccggggagt
>SSO0866 Conserved hypothetical protein
atgtcaactaataaatcagtgaaaatgtctgaagacgagataaataaggcattagcaaag
gccgaaaaggaggcagaaaaaaaggaccataagaaacaatggatagaacgtatgataaaa
agcgctaaaacttactataagttatgtccttattacgataagaagaacactaagtgcttt
ctcacattgggtgataaatgtcagcgtgatggtaaatacgagacttgtccaatatttatt
tcattcttagataataaatatcaagaaattgttaataagaagaagatgctaccaatggat
tttcaagatttagcgttaatgact
>SSO0867 Conserved hypothetical protein
atgagtgaggactatcgaaaagatgatatagaggctatagcgcagcagataagtgaggaa
gagaaaccaggaaaggagtctcccagatccaaattggttgaggcaatactacttcttctc
tacgctagaccactaagaacagcagaaatagcagctaatttaggttatgaaactaaatac
ataagtagctatctcagttattggaagaagaagggattagtttatcaagaaggaggaaga
tggcacttaagcggaaaaggagagaatatagctagagatattattgaatcccaaaataat
tctaagttcaaagaatatttattacttgctaagcaagtgctagagagtgaaaaggttcgt
cagacaaaaaacaacaaagttgagaaaaaagatgacaaaaaagcacaagaagttttgtgg
tttattgaaggaaaaaccagtaaggaaaacaaaaaacaacaaaagtctaatccaacggat
tgtataaaggagattttgaataagttggatgatgatgaaaaagaaatactaagtcactta
ttaaacaagtatagggaatggggtactacttatatctaccttgaccaactccaagaggaa
atgaaagctgatactagttggttatttagagtactcaagaacttgcagattaaaaggctc
ctttacatctatcaagatcctagaatgggtgttagaataggcctatcaaagagtataaaa
gaaacgatatcttcttgt
>SSO0869 Conserved hypothetical protein
atgttaaaaaagattgggtttcttgtgaatccatatgctggctcaggtggaagaataggg
aaaaaaggaagtgatgagttaaatatagagaatccagaaataccgatgagagttaccaga
tttttgagtaaagccccagaagatgctatctatctaacaccaagactaaagatgggagaa
atacattttacaaaatcaaaactgaaatatgagactatacctataggtgaaaagaaaaaa
actacaagatatgatacaattgactctgtaagagagtttgttaaaagaggagtagatatt
attgtatttgttggcggtgatggaactgctagggatgtggctgagggactgcaaggcgca
gaaataccaattttaggagttccagctggtgtaaaaatgcatagtggagtttttgctaat
accccagaggctgcagcgatattattaacaaaatttttacatgatgaggcaaaaactgtg
aaggaggaaattctagatattgatgaagaggcatatagaaaaggaacatattttgtcaaa
ttataccatatagtcctcacaataagcagtaataatttactaactccaagcaaaggggaa
atgcaatatagtgaggacgaattaggggaaatcgcagactatataatagataacatggat
gataatataacctatattatgggccctggaagtactgtaaaatatatagaaaggaaacta
aagatcgatactccatttttaggtatcgatataattagaggaaagaaattaattaaggaa
aatgttaactatttcgatttaattaatttaaccggggagttaaagattgtgcttacccca
attggcaaacaaggatttctgataggaagaggaaatctggaattagggccaatattctta
agaaaagtgaaaaaagatgatcttatcgtagtctctactttttctaagctttatactatt
aattgtcttagaatcgacactggagatgagaatttagataagctcttttctggcgtgtat
aacgttatagtgggctacaacaaattttatgctattaagacttgccaa
>SSO0870 Conserved hypothetical protein
atggatatccagattgtgcttaccaaagctgtagagaccagacaaggcaataagcctaaa
ttcgatgaagggcatgttataatgagtctattttacataagtcaattacaaccagtagga
aggatattgttaatgaaaaaaactggactgtcagaagcttcaataaaaacattactaaaa
cgattaagggagttaaatttaattcaaactgatctagtaggaggaaacactctcacagag
caaggaaataaaatagtttcatgcattaaaaatatatcaacaataaaagacgttacttta
aaatctttaggttggaactcatcaatgcttatcgtaaggggaggtgcggaactattaaaa
gagatctcagttttacatttaagggatgaaataataagattaggtgcggaaaaaatatta
gtgtgtgtttatacagaagaaggaaaaatagaaattccgcctaagacggaggaaatgtca
ctcagaggtctattagacgagataaaggaaaattgtaataattgtggacctaacgatctt
attatatttctagttcctaacgaagaacacttaggatatctaaccttaaccttcatactc
aaggtgctaaagaaatgt
>SSO0871 (argF) Ornithine carbamoyltransferase (EC: 2.1.3.3)
atgtttagaggaaaaagtttgttatgtctgcttgattttcaaacacatgaaatagagaaa
atgctagaagtctcattcttgatgaaaagttatgtttattataataaagttccaaattca
ttaagcggtaagagggtcgcattacttttcgagaaaccgagtactaggactagggttagt
actgaattagcagtatcgttattaggtggaattcctattgtccttaataagcaagatttg
caatggtctaggggagagcttatcgaagatactggaagggttttaggcagagtcgttaat
ggaataggggccagagtactaaatcacttaaccctagttaaactaaaggaatcatccgga
gttccagtatttaatttattaagcgatctttctcatcccttgcaagcactagctgactta
atgacaattagggaaaggtttggtaataatcttgtgaagatcgcatttgttggcgatggg
agtgataatgtattattaagcttaatggctattgtggctaaattaggattagagttacat
gtagcaactcctaaagaacttaagcctagggacgatttgtataagataataagtgagatt
gcagaagatactggcagtgttatagaatttcatgaggatccctatgaggctgttaggggt
gtacatgtagtctatactgacgtttgggttagcatgggtcaagagaatattgctgaacag
aagaagagaatgttacaaaactatagggttaccgcagatctaatgaagtatgcggttaaa
gatgcgatatttatgcactgtttgcctgcaaataggggagaggaagtagaccctgaggta
atagatggatctaaaagtgcggtctgggatcaagctgaaaatagattgtatacaacaatg
gcagtattttcattatttatt
>SSO0872 Conserved hypothetical protein
atgcacaaaattccagcagaactatgcatcaagtgtaagagccacaagaatctttgtgga
ttaccgtattgcccaataatggagagatttagaggtatggttagtagtcttcagaagatt
gaaatagatacctcatttaaactggttgaaggctctactcctcctagtggaatagttgga
gagaaagggtatcctaaagtttcactaattgtaaatattccgccctcagtatatggggaa
gatgccagaaaatatgagaacgttaaggagtggtggggaaggataaatttaggggatata
ataaagttaagatcctctttaatctcgagtataactacagttaaagtcgaaaaagctact
gaatattatgatacggaaattccactagctataatttcagataatccaatagtaactgaa
gccaaattgaaaacattagaggcaaaattaaagtttgatggagtaattttaccaagagga
ccaagtggaatcgcagagcagataaaagttttggataatcctaaagtcccaactaaatta
gataaactgatctttgatgatgcaaaatctactgaagcaatcttagaactatatagatat
aatgtggattattataagataattcacgcattatcgtttggacttttaggcaggaaaaag
aatagacgatttgtaccaactagatgggcaataactgcagttgacagtatagttggcaaa
tttctatataataaaataataaactataatgagataaatgagatagaagtttaccacagc
tcgtatttaggcaactacttttatgttatactttacccatcgaagtttaattcaacatgg
atagaaatatggcatccgcttagtttatggtctcaagaactcacgatttcggaattgaaa
gagaacttctggggagagtatgaatatttagatggaggttacatggctgctagattagca
gtgctagaacatttagagcaaataaaaagacaatcagggattataatcattagggagata
accgaagaatattttgcaccagttggaaattggcacattagagaaactgtgaggaatgct
atgaaaaacagattaggaaaatatgataatctaaatttagccatatcagaagtaaataaa
aaattaaaagccaaaataaacttatttgaactacgaacgataaatagtctaatcaatcaa
aaatcaatttatgatttcttcaaa
>SSO0873 Conserved hypothetical protein
atgttttttgatcttcatgtacattctagatacagtgatggaaagtatcttcctaaggat
attatagcctatgccaaggctaaacatatacacgtagcaattacagatcacgatacttct
ttaggtttaaatacggttaaagaagagaaagtgatccctggacaagaagtcactactgaa
tatggacatgttgtgatattatgcaattttccaccatctccacctaacagaatagctgaa
ttagtagactacgctaaggagaactcttgtgtggtatttccctcacatcctttcgatatt
tttagaaaaggaataggtgataagacatttcgttataaattcgatttaattgaaatttat
aactctaaggctcctaaaatggctaataataaggctaaagaggcatccataaggttgaat
ttaccgggggtctcaaatagtgatgctcatgtaattcaagctataggttccgcatataat
gatttatacgagataatagagtttaatttggacgatattctagataatttaaggagaggg
aaaataagaaatataatcaacggattatcatttagagctaaattttccattttacaatgg
tatattgagaggaaaataagaaatgcacaaaattccagcagaactatgcatcaagtg
>SSO0874 (asd-1) Aspartate-semialdehyde dehydrogenase (ASA dehydrogenase) (EC: 1.2.1.11)
gtggctgataagataaaagtttcgttactaggctctaccggaatggtagggcaaaaaatg
gtaaggatgctttcaaaacatccctatatagaattagtgaaagtaagtgcgtcacctcaa
aagattggtaaaaaatacaaagacgccgtaaaatggatagaacctggggatattcctgaa
aatgtggctgaattaccaatagtctccaccgagtacgaagatcataaggatgtcgatgtt
gtcctttcagcactacctaatgaattagcagaagatgttgaattaaagttagtaaaacag
ggaaaaatagttgtatctaatgcctcaccatttagaatggatccagatgtaccactaatc
aatccagaagtaaattgggagcatttagagttattaaaatatcaaaaaagcagtaaaaac
tggaacggtctattagtcaaaaatcctaactgtactgcggcaatactttccatgccaatt
aaacccttagaaagattaatcaaaattaatgctacgtatatagtaactttacaagcagta
agcggagctggttatagtggtttaccgtttatggcaatagatgggaatgtagtaccttgg
attaaaggggaagaagagaaaattcctaaggaaataaataaaatgttaggaaaattcgaa
gccggaaagctaaaatcttccagcttagaaattcatccaaccactaccagagttcctgta
aaagttgggcatatgggtgtaattaatattgtaactgatgataatgtagatgaaaaagaa
gttcaaaaagcgttagatagttttgcgtcattacctcagcataagaacttacctactgca
ccaaataaaccaattattgtatttaaggatgaggatagaccccaaccagctagagactta
caatattatgatggaatggcagtaacagtgggcagagtaaaatttgaaggaaatgtgtta
cgattagttgtccttggtgacaatctagtaagaggagctgctggaataacgattttaacc
ctagaggtcatgaaagaattaggttatttc
>SSO0876 (akH) Aspartokinase (EC: 2.7.2.4)
atggctctaatagttaaaataggcggatctatacaaaaagatgaaaaagattatgaactt
atcgtaaagaagatacaagatttttcaaagaaatcagataagattatagtagtaacatca
gccattaaaaacgttactaatgagttaataagcgcaacttcgaatactgataattctcca
aatattgtgactgaaatctacgagagacacataaaactattatctaagttagcagacggt
aaggaattcgagaattcgtttaaagatatatctaggcttagcgatgaattgttcagagta
gcttggtctataagggtattagacgaagtgacccctagagttagagactacatactttca
tttggagagagaatggctaccctactcctttcagcaatattaagaagtaacgggattgaa
gctgaaggcataattactcctccatttttaactgatgagaattacggtgaggctaacgta
attgaggatctatctaaaaatgaaatcgccaacatattagagaatgcgaaagctaatgta
atagtccttccaggatttatagggagaactagagagggaagatatactactttgggaagg
ggtggtagtgactatacagcaactttgctaggtaaactagttggagtgagagaagttaga
ctagttaccgaagtccccgggataatgactggagatcctaaaaaattcgaaaatgctaaa
acgatatctagactctcgttggaagaggctattgaactctcacagttaggagctaaaagg
ctgcatcctagaacttttgatccagtctttggaagtgatatgaaggtaatagttgagtcg
ctgtatgaagacggatttaccataattaatggagaatgccaaaataatgatgggcttaaa
gggatttcactcctagataatgcgaaattaataacagttgagagtacgaaaattgttgga
aaaataggatctgctgcaagaataacaaatgaagcaaaggaagctggagttaacataata
tcaatttctcaaccagctagcgagactacaatacaactcgttgttgactcactttctgcg
aacagactgttatcgaaattggaagagataagggggactttagttaaagatattgaggtt
aatgatattaatatcgtaggtatagtagggtgcggaataaagaagaaggagatctctacc
aaggttctttcaatagcctcaagttatgatccgttagcgatttctaggggaatatctaac
gtaagcatgacctttatagttaataaggatgaaggagaaaaattagcaaaagagttgcat
aaggtgatcgtaagtggc
>SSO0878 (thrC-2) Threonine synthase (EC: 4.2.99.2)
atgaagtgcttgaattgtggatatgaaacggaaatagatcaaagtcagatattatgtcca
agatgtggaggactattagaaattatactagaaccaccaaaggacttctctttcagtaaa
ttgagaggaagaggagtttggagatataaagaattaatagcaggcagatacaaaaatatt
gtaagcataaatgagggaaataccccactaattagatcctcaaatataaatgataatctt
tattttaaatttgaagggcttaatccaactggtagttttaaggatagaggaatgacagtg
gcagttagttctgcggtaagcttgaattacaaaactgtaatagccgcatccactggaaat
actgcagcttctgcagctgcttatgctgcaagagctggtataaagagctttatcgtctta
cctaaaggtaaggtagcattaggtaaattagctcaatcaatactttatggctcagttatt
ttagaagttgatggaagttttgacgttgctatggatgcagtaatgagattatataaggat
ttaaaagtagtatatccattaaattcctttaatccatggagattagaaggacaaaagaca
atcgcatttgagatagcagaagaactaggagttcctgacaacgtgatagtcccggtaggc
aatgcaggcaatatctacgccatatggaaaggatttaatgagctagttaaaactggagtt
attaatactattcctagaatgattggaatccaagctgagggcgcatcaccaatagttacc
gcaataataaaaggaaaagattctccagatttcatagaaaatccagatactgtagcaaca
gcaataaggatagggaaaccagttaattggcaaaaagcgatgaaagcaataagggaatct
aatggaaccgcaatagctgtatctgattccgagatattagacgcacagaagaccctagct
agaaaagagggcataggagctgagcctgcttcagcagctgccttagctggttatattaag
gcaataaatgaaaaggtggtagataaagatgaaaaaacagttttaatcctaacaggacat
tcgttaaaggatcccgatagtatgacaaaagctgaggctaaaagaatattagttaatcct
ttacatatggaaaaaattatcctaggtgagataaatggctctaatagt
>SSO0879 Conserved hypothetical protein
ttgttgaagtatagtaatcatatggcgtttaaagatctcagagaatatatcgaatttatg
aaaaagaaaggtaaattaattgaagtagatgatgaagtaagcgttgatttagaaatagct
gaaataacgagaaaagcaacttatgctcatttaccccctcttttattcaagagagttaaa
aattatgagaattggaaaatagtttccaatattttttactcaattgaaagcttgtacgag
atttttggaacgaataaactagaatcaatatccgaaggatttttatcaaatttatccaat
atgcctatcacattttttgataaaataaaatcacttagagaaattttgggattaggaaaa
gtaatgcctaaagctaagtcacctagttttaaagaggaaaagaacttagatctgactaag
attcctgcaataaaaacttggcctaaagatgccggaagataccttactttttccataaca
ataacaaaggacccagagacagatgtacataatctcagcgtttatagggttcaaattcta
aacgagaaggaggcaataattcattggcaagcatttaaaaggggtgcgcttactgctaaa
aaatatttagaaaaaggtattagtaagatacctattgccgtagtaaccggagtagatcct
gccatagcatttacagcggcttctccagtccctcatggaatcgataagtatatgttcgcg
ggaatcttgagaggtgagggtattgacgtagctgaattagataatcaattactagtacca
agccattcagaagtagttttaactggttatgttgacttgaatgatatgcgtctagagggt
ccctttggagatcatatgggttattatacacctgcagattactatccagttttcaaattg
gaaagagtatatattagagaagatcctatatttcatgtaacatcagttggcaaaccacca
cttgaggatgcttggataggtaaggctgtagaaagaatattcttaccttttgccaagatg
ttagttccagaacttattgacatgaacctaccagaatatggattgtttaccgggattggg
atcttctctataaagaagtattaccccggccaggccaagagagttatgatggctttatgg
ggtaccggccaactaagccttttaaaaataataatagttgttgatcaagatatagatgtt
catgatattaatcaagttatttatgctattgcagctaatgtagatcctaaacgcgatgtt
tgggtaatagaaaatgcacttactgactcattagaccctagtgttccatttccaccatta
ggtagcaaactaggtatagatgctactaggaaatttaaagaagaaatggggaaagaatgg
ccagaagaggttagatcagatgaggtagtagctaaaaaagcggaccaaatattgaataaa
attataaagagatatcaaacctcc
>SSO0881 Conserved hypothetical protein
atggcctcaagtaaagtagaagatttcgtaaagaattggggaggtaaacaagagccaagc
attggtgaaagaataaagaatgcattcaagccacagcaaccactaaggtacagactagta
atggcaaactacagactaaggacgatggtaagtcgtcttgacgtttatatttcaagatta
caagagagggataggactctattcgaaaaggttgtagaatcacaaatgtcaaaggataca
gctagagcagctatgtatgctaatgagatagctgagattagaaagatttccaggcagtta
attacgacacagattgctctagagcaagtgcaactcagactagagacgataactgagctt
ggagatgtatttaatagtctaataccagtacttggagttataaaggagttaagaaatgca
atgaaaggagttatgccagaaataagtctagagttggcagaactagaggagggactacaa
gaggtagtaatagaggcaggagactttactggtgcaccggccaattatggtgcttcaagc
ccagaggcaaggaagatattggaagaagcatctgttgttgctgaacagagaatgaaggag
aagttcccagaattgccaagcttcgtcacctccactcagaaagtatctaaccaagaacag
aaa
>SSO0883 (ppsA-1) Phosphoenolpyruvate synthase (EC: 2.7.9.2)
ttggggagtttccttttggttgaggcaattagtagtgaagaagatcttattctcgacgta
agtcaagtcactaaggatatggtacaattagctggaggcaaaggtgcaaaccttggggag
ttaaccagcattggagttagagtacctccagcctttatacttacttctaaagcttttaaa
tattttcttgaatacaacaatctttttgacaaaattagagacactttaagtagttctgaa
acctcagaggaagctagtgaaaaaataaaacagttgataaagaatgctaagatgccagat
aaattaagtagcatgatttatcaagcttatgatgaattaagtaaaaaggttggaaaggaa
atcttagtagctgtaaggtcttcggctactgcagaggatattgagacagcaagtttcgct
ggacagcaagatacttatcttaatgttactaaggatgaacttattgacaggattaaggat
gtatgggctagtctctataacgcaagggctatggaatatagaaagagtaaaggtatagac
gacttatcaatacttatagcagtagttgttcaaaaaatggttaattcgagatctgctgga
gtaatgtttactctccatccagttactggagatgaaaagtatatcatgatagaatctaat
tggggtttaggagaaagtgtagtcggtggtaaggttaccccagatgaggtcttaatagaa
aaatctaccttaagaattgtggaaaaaaaggtttctaataagaatattaaaatcgtatat
gataaacaacttaagaagaatgttactattactttagatgagaaggaatccagattaatg
agcataacagacgaagaggcaatagaactagcaaaattagcacttaagatcgaagaacat
tataagaggccaatggacattgagtgggctatcgataatgatctaagtttccctgagaat
atcttcatagttcaagctaggccagaaactttctggtcttctaaaaggaaagaaaataag
aacattgcggaaaagagtgctcctataggtggtaaagtactagtcagagggcttgcagct
tctccaggtatcgcctttggtaaggcaaaaatcatacttgacattaaagatcctaaagtt
catgagtttcagaagggtgaaatcctagtcacgaaaatgacagatccagattgggtacca
ttaatgaagatagctggggcaataataacagatgagggaggaatgacaagtcacgcggct
attgtatccagagaattgggaattccagctatagttggaagtagagaagcgactaagata
atacgagataatcaagagatcactgtagatgcaattaggggtattgtgtatgagggtaag
gtattacaaacaagtgagactgtatctcaacaagctcaaccatctatcggaattcaagga
ataagtagggaagttctattaagtctttatccggttactgcaactaaaatttacatgaat
ttaggtgaacccgatgttatagataaatatttggatcttccctttgacggaatagggctc
atgagaattgaatttattgtaagcgaatgggttagatatcatccgctttacctaataaaa
ataggcaatgctgaattatttgtggataagttagcggagggaatagctaaagtagcaagt
gcaatataccctagaccagttgttgttagattttcagatttcaaaactaacgaatataag
aaattgattggtggagaggagtttgagccagatgagaggaatccaatgataggttggaga
ggggtttccagatatgtaagtaaagagtatgagcctgcatttaggctagaggctaaagct
atacgcaaagttagggaagagatgggacttaagaacgtatgggtaatgtttccctttgtc
agaactacatgggagctagagaaggcaataaaaataatggaggaggaaggtttaagaaga
gattctgatttcaaggtctggataatggctgaagttccctcagtagttgttcttgcggaa
gagtttgcgaagatagttgatggattcagtgtaggtagtaacgatttagcacaattaact
ttaggtgttgacagggattccgagttactagcgaggatgggatattatgatgagagggat
ccagctgttttagaatccataagaaagctaatcaaagctgcccataagtatggcaaaaca
gtctcaatatgtggacaagcacctagtgtttatccagcagttgttgaatatttagtcaaa
gctggaatagatagcattagtgtaaatccagatgcggttattaatgttaggaggcaagta
gcttcgatcgagcaacaaattatacttagaaaccttaatggaaaaaggaagaacaag
>SSO0886 Conserved hypothetical protein
ttgatgattagagtagcaatagctggcttaggtaattgtgcatcaatgttaattcaagga
atagaatattataaatcaaaaggcgataattattatgagggattaattacccccgtaatt
ggtggttataaaattaccgatatagaagttgtagcagcattcgacgtgtcaaaaaataaa
ataggaaaggaccttgcagaggccgtatttcaacctccaaatattacaccaaagatagtg
aatatggaaaagaaaggcgttaaggtaagtgcaggacccgttcttgatggcgtagcgcaa
catatgactaacgtttttaatcctacctatgatggcacattggaaaaagcgttagatgaa
ttaaaatctagtaaagcagaaattctagttaatttattgcctgttggaagtgaaaacgct
acgagaacgtacgcaaatatagcactaatggcaggaactgcatttataaacgcaataccc
gtatttattgctagtgatccttcaggctactttcctaataaattcaaagagaaaaactta
ccattagccggtgatgacataaagagtcaattaggggctacaatattccataggtcaatt
acttcgctctttagactgcggggagtaaaagttgaggaaacttatcaattaaatgtaggc
gggaatacagactttctaaacatgaagacagaagaaaggttaatatctaaaagaataagc
aaaacagaggcagtaactagtacactagataacggagaggtaataaaaagtgagggcaaa
ataaggataggacctagcgattatgttccatttttaggaaatacaaaagtagcttacatt
tacgtaaaaggaagtgcatttgcaggcatgccaattaaagtagaagcttccttagaggtt
gatgataaagctaattgtgcagcagtattagtagatgttataagggcagttaaggttgca
ttggataggaagataggtggtccacttgaaaaagtatctgcattttactttaaacaccca
ccaattcaggctaaagacgacgaagaagcctataggtggtttaaagagttcattgaaatg
>SSO0887 Acylphosphatase (EC: 3.6.1.7)
gtgaagaagtggagcgacactgaggtgtttgaaatgctaaagcgtatgtatgctcgcgta
tatgggttagttcaaggtgtaggttttagaaaatttgtccaaattcatgctataaggtta
ggtataaagggttatgctaagaatttaccagatggttcagtagaagtagtcgcagagggt
tatgaggaagcgttaagtaaactattggaacgtattaaacaaggcccaccagcagctgag
gtagagaaggtagattactcatttagcgaatataagggagaatttgaggattttgaaaca
tac
>SSO0888 (trpB) Tryptophan synthase beta chain (EC: 4.2.1.20)
atggtaaaagaagacgagattttgcctaaatattggtacaatataatccctgatctacct
aaacccttgcctccaccaagggatccacaaggtgcctatttctcgagaatcgatttatta
agaagtatactacccaaggaggtattaagacaacaattcacaatagaaaggtatataaag
atccctgaggaagtaagagatagatatttatcgataggaagaccaactccattatttagg
gctaaaaggttagaagagtacttaaagacaccagcaagaatttactttaaatatgaaggt
gctacacctactggatctcataagataaatacagcaattcctcaagcgtattttgcaaaa
gaagagggaattgaacacgtagttactgaaactggagctggtcaatggggaactgcagtc
gcacttgcagctagtatgtataatatgaaaagtactatattcatggtaaaggtaagttat
gaacaaaaaccgatgagaaggagtataatgcaattatatggggctaatgtttacgcaagc
cccacaaacttaactgaatacggtaggaagatattagagacaaacccacagcatccagga
tcattaggtatagcaatgagcgaggcaatagagtatgctcttaagaacgaatttagatat
ttagtaggtagcgttttagatgtagtacttttgcatcagagtgttattggtcaagagact
attactcaattggatttgttaggagaagacgctgatatcctaattggatgtgtaggaggt
gggagcaattttggcggtttcacatacccctttatcggaaataagaaaggcaagcgttat
attgcagtaagttctgcagaaattccaaagtttagtaaaggtgaatataaatacgatttt
ccagactctgctggattattacctttagtgaaaatgataactttaggtaaagattacgtt
ccgccaccaatatacgcaggcgggttaagatatcatggtgtagcaccaacattaagtttg
ttaacaaaggagggtattgtggaatggagagaatacaatgaaagggagattttcgaagct
gctaagatatttatcgagaaccaaggtattgtaccagccccagaatcagctcatgcaata
agggcagtagttgatgaagctatagaggcaagaaagaataatgagcgaaaggtcatcgtc
tttaatctaagtggacatggattgttagatctgtcaaattacgaatccatgatgaaaagg
ttgaatggaaatggg
>SSO0889 (trpA) Tryptophan synthase alpha chain (EC: 4.2.1.20)
atggaaatgggtaagatgcttgtagtctatatgacgttaggttatccaaatgttcaaagt
tttaaggattttattattggggcagttgaaaatggagctgatatattagagcttggaatc
ccccctaagtatgctaagtatgatggtccagttataaggaagagttatgataaagtaaaa
gggctagatatttggcccttaatagaagatattaggaaagatgtgggtgttcccataatt
gcacttacttatttagaagattgggttgatcagctagagaattttctaaatatgataaaa
gacgtcaaactggacggaattctatttccagatttacttattgattatatagatgatttg
gataaaattgatgggataataaaaaataaaggattaaaaaacgttatttttacatctcct
tcagtaccagatcttctaatccacaaagtctctaagattagcgatttattcttatattat
ggtgtcagaccaactactggcgtacctataccagtatcagttaagcaattgattaataga
gttagaaatctagttgagaataagctaatagtaggatttggcttatcaagcgagtcagat
ttaagagatgctctaagtgctggtgctgacggaatagcaattggaactgtgttcatagag
gaaattgagaggaatggtgtaaaatctgcaataaatttagttaaaaaatttagggcgata
ttagatgaatataaa
>SSO0890 (trpD) Anthranilate phosphoribosyltransferase (EC: 2.4.2.18)
atgaatataaatgagattcttaaaaaactcataaataaatcagatttagaaattaatgag
gctgaagaattagctaaagctataattagaggagaagttccagagattttagtatcagca
attttagtagcattaagaatgaaaggtgaaagtaaaaatgaaatagtaggttttgctaga
gcaatgagagaattagcgatcaaaatagacgtgcccaacgcaatagacacagctggtaca
ggtggcgacggattagggacagtaaacgttagtaccgcatcagctatcttattgagttta
gttaatccagttgccaaacatggtaatagggcagtaagtggtaaaagcggtagcgctgat
gttcttgaggctttaggctataatattatagttcctccagaaagggcaaaagaactagtc
aataaaacgaatttcgttttcctctttgcacaatactatcatcctgcaatgaagaacgtt
gccaatgtaagaaaaactttggggatcaggactattttcaatattctaggtccattgact
aatccagctaatgcgaagtatcagttaatgggagtattttcgaaagatcacttagattta
ctgtcaaaaagtgcatatgaattagatttcaataaaataattttggtatatggagagccg
ggtatagatgaggtaagtccaataggaaatactttcatgaaaatagtaagtaagcgcggt
atagaggaagtcaagttaaatgtaactgatttcggcatatcaccgattccaatagaaaag
ttaatagtaaattctgcggaggattccgcaataaaaatagttagagcatttctgggtaaa
gatgaacacgtggctgaattcattaaaattaacacagcagttgcgctttttgcattagat
agagtaggcgattttagagaaggttatgagtatgctgatcatttgatagaaaaatccttg
gataaattaaatgagataatctcaatgaatggtgatgtaactaaactgaaaacgatagtg
gtgaaaagtagtggt
>SSO0892 (trpF) Phosphoribosyl anthranilate isomerase (EC: 5.3.1.24)
gtggttaaactaaaaatttgtggtaacgcaacgttatcagatattatagagttctcaaaa
cttgatgtagattatctaggaataataaccgatgtcgtaagtcaaagattcgtaaaaagc
gagttcctaacttttgttaaaagatatgttgaaaaaccaatagttaatgtgaaagtcaat
gtccaaattagtgaaatagagagagaattattagtatcagattattttcagatacataga
gtattagacgattcagaattagaattgcttaaatcatatgattttagaaaaagaattata
ttatatgtgccagcctccttcgagtataagaaatacctagaaagggccatagatactgta
gatatggtgttagtagactctgtaaagaaaggggtaggcgtcgattataatgttgtatcg
agtttccttaaggattacccttacctaggtgtaggtggaaaaataagtatagataatatt
tctaactttattgacttaaatcctgcatggcttgatatttccagtagtatagagatctat
cctggtaaaaaagatattaacatggtgaaaaaaatagtcgaggtggtaaaatatggaagt
tcatccaataag
>SSO0893 (trpE) Anthranilate synthase component I (EC: 4.1.3.27)
atggaagttcatccaataagtgaatttgcctcaccattcgaagtatttaagtgtatagag
agagactttaaagtagctggattactagagagcataggtggccctcaatataaggcgaga
tatagtgtgatagcttggtcaactaatgggtatctgaaaattcatgacgaccctgtaaat
attcttaatggttatttgaaagatttgaaattagcagatataccggggttattcaaagga
ggtatgataggatacataagttacgatgcagtaagattttgggagaaaataagagactta
aagccagcagctgaagattggccttatgcggaattctttactccagataacatcataatc
tatgatcataatgagggcaaagtatacgttaatgctgatttaagctctgtagggggatgt
ggtgatataggggagtttaaagtaagcttttacgatgagtctcttaataagaacagttat
gagaggattgtttccgaatcattagagtatataagatctggttacatatttcaagttgta
ttgtctagattttacagatatatatttagtggagatccattaagaatatattataatcta
aggagaataaatccatccccttacatgttttatctcaaatttgatgaaaaatacttaata
ggatctagtccggaattactgttcagagttcaagataatatagttgaaacctatcccata
gctggcactagacctaggggcgctgatcaagaggaagatcttaaattggaattggaatta
atgaactcagaaaaggataaagctgagcacttaatgctggttgatttggctagaaatgat
ctaggtaaagtatgcgttccagggactgtaaaagtaccagaattaatgtatgtcgagaag
tatagccatgtccaacacatagtatcaaaagtgattgggaccttaaagaagaagtataac
gcgttaaacgttttatcggctacattcccagcaggtacagtaagcggagcacctaaacca
atggcaatgaatataattgaaacgttagaggagtataaaaggggtccttatgcaggtgct
gtaggttttatctcagctgatggtaacgcagagttcgcaatagcgataagaactgcattt
ctaaacaaagagttattacgaatacatgccggtgctggtatagtatatgactctaatcca
gaatctgaatatttcgaaactgaacataaactaaaagcactaaaaacagcaataggggtg
agg
>SSO0894 (trpGD) Anthranilate synthase component II (EC: 4.1.3.27)
atggatctgaccttgataatagacaactacgatagttttgtttacaatatagcccaaata
gtaggagaactagggagttatccaatagttatcagaaatgacgaaataagcataaaggga
atagagagaatagacccagataggattataatctcaccaggaccagggacaccagaaaaa
cgagaagacataggagtatcattggatgtgattaaatacctaggcaaaaggactccaata
ttaggagtttgtctaggtcaccaagctataggttatgcatttggagctaagataagaaga
gctaggaaagtatttcatggaaaaataagtaacataattctagtaaacaactctccgctt
tcactatattacggcattgctaaggagtttaaagctaccagatatcatagtcttgttgta
gatgaggttcatagacctctaattgtcgacgcaatatccgctgaagataatgaaataatg
gctatacatcatgaagaatatccaatatatggtgtccaatttcatccagagagtgttgga
acctcattgggctataagatactttataatttcttgaatagagta
>SSO0895 (trpC) Indole-3-glycerol phosphate synthase (EC: 4.1.1.48)
atgccacgttatcttaaaggatggcttaaagacgtcgtacaattatctttaaggaggccc
tcatttagggcttcaagacaaaggccaattatttccttaaacgaaagaattttagaattt
aataagcgcaatatcacagctataatagccgaatataaacgcaaatctccctctggatta
gatgttgaaagggatccaatagaatattcaaaattcatggaaaggtatgcagtaggtctt
agcatattaactgaggagaagtactttaatggttcatatgaaactttgagaaagatagcc
agttcagtttcaattcccatactaatgaaggattttatcgttaaggaatcgcaaattgat
gatgcatataacctaggtgctgatactgtattgctaatagtcaaaatactaactgaaaga
gaattagagagtttattggaatatgccagaagttatggtatggaaccattgatagaaatt
aatgacgaaaatgatttagatatagccctaaggataggggctagatttataggaattaat
tcaagagatctagaaacccttgagataaataaggagaatcagagaaagcttatatccatg
ataccatccaatgtggtaaaggtggcagaaagtggaatttctgagaggaatgaaatagaa
gaattaaggaaattaggtgttaacgctttcctaatcggatcatcactgatgcgaaaccca
gaaaagattaaagaatttatacta
>SSO0897 (aspB-2) Aspartate aminotransferase (EC: 2.6.1.1)
gtggtctcgctactagactttaacggaaatatgtcacaagttactggagagactacctta
ttgtataaggaaattgctagaaacgtagaaaagactaagaagattaaaattatcgacttt
gggataggacaaccagatttacctacatttaaacgtataagagatgccgcaaaggaggcg
ctagatcaaggttttactttctacacttcggcattcggtattgatgaattaagggaaaaa
atagctcaatacctaaatactagatacggtactgacgtaaagaaggaggaagtgatagta
acacctggtgctaagcctgcgcttttcttagtctttatattatatattaatccaagtgac
gaggtaatactcccagatccctccttctattcttacgctgaggttgttaagttactagga
ggaaagccaatatatgccaatttaaagtggagcagagaagaagggttctcaatagatgta
gacgacctacaatctaaaatatcgaaaagaaccaaaatgatagtattcaataatcctcat
aatccgactggtactctattctctcctaatgatgttaagaaaattgtggatataagtagg
gataataaaattatcttactatctgacgagatttatgataattttgtatatgaaggtaag
atgagaagtactcttgaagactcagattggagagatttcttaatttacgttaatggattt
agtaaaactttctcgatgactggatggagattaggttatattgtagcgaagcgtgaaatt
atccagaaaatgggaattttggctgctaacgtatacactgctcctacaagttttgtacaa
aaagccgcagtaaaggcctttgatactttcgacgaagttaaccaaatggtcagcctattt
aagaagaggagagacgtaatgtatgatgaacttactaaggtcaaaggagttgaagtatct
aaaccaaatggagcattctatatgttcccaaatgttagtaagatacttaaaacaagtgga
tttgacgtcaagtcacttgccataaagctaattgaagaaaaaggcgtagttacaatacct
ggtgaagttttcccattaaatataggtaaggagtttttaagattaagttttgctgtgaac
gaagaagttattaaagagggcatacaaaaaattagagagttcgcggaacagatgatgaat
tcccga
>SSO0898 Conserved hypothetical protein
atgagaatagcaattctgggagggggagtcgcaggttctacgttagcgtacttactctca
aggattaactatgaagtcacaatctttgatattaatcaacattacgttaaaccgtgtgga
gatatagtcccaaacatctatactcctccctttaattggaaggaaacttttggtataagg
agattctccttttatatagatggcgaaaaaatttatgacgttgaatatagacatactaag
tggctagttattgataaatggaagtggataaacgatatgcgaaaaagttcaaaagtaata
gtaacccatgataataacgctaaagaatttgattacgtaatagatagtagagggccttat
ccaatggatagagaggtagtttatactactagagctataatagaaactgaggagtttgac
gatgaggctatattggaatttaatacccgttataccggtttttattggatatttcctagc
aaagaaaacgaatataatatcggagctggttttttggaatacaagaattcgaaagaattg
cttaattattatttaaggaagaggtttaagaatttcgaagttaaggatatcagaggagcc
cctattagtattgggagtgttaaaaataagaagttaaggataggggaggcaagaggactt
gtcttcccactgagcggtgagggaataaggccatcagctatctcagctgagtatgccttt
gaggctatacataaagaaaaagatctggatgggtttcttaacgagaagctcagtattata
gagaaaagaattaaaattcaaaaaatgctactagatttatacagatattctagtttaaat
ttaagaaagacttttatgagaatattctttaagaatgaagttctcatagatacatactta
gaggataagatggatttgaatggaataattgagtccttaaagagtgtgagagcgaatgga
ggtattattagaaaattcgaagagcaagaaagg
>SSO0899 (valS) Valyl-tRNA synthetase (EC: 6.1.1.9)
ttgctattctcattacgaaattttataagctattcgaatttatatttatataaaaacgtc
tgtataggtggtcaattattgttaaaccaagatgaaattttaaagaagatggaagagtgg
ccaaaacactataaccctaaggaaattgaggaaaaatggcaaaagatatggctaagtgag
gaatattggagagacgtatttagattcagagatgaggacgataaagcaccaagatttgtt
attgatactcctcccccttttactagcggagaacttcatatggggcacgcgtattgggtt
acaatagctgatactataggtaggtttaagagattagaaggatataatgtactattacct
caaggatgggacacacaaggtttacctactgaactaaaagtgcaatataagttaggaatc
ccgaaagataataggcaactatttctccagaaatgtatagaatggacagaagaaatgatt
aagaaaatgaaggaggcaatgattagactaggttataggccagaatgggaaagatttgaa
tataagacatatgagccaaaatatagaaaaattatccagaaaagtcttattgacatgtat
aaaatgaatttaattgagatgagagaaggcccagtaatttggtgccctaagtgtgagact
gcattagcacaaagtgaagtaggttacttagagaaggagggaattcttgcctatataaaa
tttccattaaaagaaggaggagaaatagtaatagcgactaccagacctgaattactagct
gctacacaagctatcgccgtaaatccaatggatgaaagatataagaatttagtaggaaaa
atagcattggtaccaatatttaatatcgaggtcaaaataatatctgacgcggatgtggaa
aaggaattcggaaccggagcagtaatgataagtacttatggcgatccccaagatataaag
tggcaattgaaatacaacttaccgattaaggttatagttgacgaaaaaggaaggataata
aatacaaatggaatacttgatggattgaaaattgaacaagctagaaataaaatgatagaa
ctcctaaagactaaaggataccttgttaaagtagagaagataaagcacaatgtactatca
cacgttgagagaagtgattgtctatctccagtagaattcttagttaaaaagcaaatatac
attaaagttttagataagaagcaaaaattattagaagaatataaaaagatgaaatttaaa
ccggctagaatgtcctattatctcgaggattggataaagagtatagagtgggattggaat
ataactaggcaaaggatttatggtacgccattaccgttttggtactgcgaaaatgggcat
ttagtaccagctaaagaagaggacttgccaatagatcctatcaaaactagcccgccatta
gagaaatgtccattatgcggatcagaacttaaaccagttaccgatgttgcagacgtgtgg
atagactctagcgtaacagtcctttacctaaccaagttctatgaagataaaaacgttttc
aataggactttcccagcatcacttagacttcaaggtactgatataattagaacttggtta
ttctataccttctttaggactttaatgttagctaataatgtaccttttactacagttctt
gttaatggtcaagtccttggaccagatggaactagaatgagtaaaagtaagggaaatgta
gtatcaccattagatagagttaatgattttggagcagatgcgattagaatggctcttcta
gacgcaagtattggtgacgattttccatttaaatgggatatagtgaaaggaaagaagatg
ttattgcaaaaattatggaatgcaagtagactagtctaccctttcatagcaaaacaaaga
cttgataaacctaaaagcctacatatagtagacaaatggatcttacaagaacataagaaa
ttcgtaactaaagcaataaatgcatatgagaattacgacttttatttagtacttcaagag
ctatataactatttctgggagatcgtagctgacgagtatttggaaatgataaagcatagg
ttatttgatgacgataactctgcaaaatatactatacagagaataataagagatataatc
atattgcttcatcctatcgcacctcatataacagaggaaatttactcaaggctatttggc
cacaagaagagtgttctcctagaagaattaccaaaagtagatgatattgaggagaataaa
agaatagatgaacttggagaagtaataaagaaaacgaactcgctcataagatcagagaag
ataaagaatagattatcaatgaatactccagttagtgtaaaattgtacgcttctaagcaa
gttattgaattaattaatgaagtgaaagatgacgtaatgaagacattaaaggtaactaat
cttgaactaatagaatcgaatgaagaaaaagtggaaattaaaactgctaatcagtccatg
ggagtt
>SSO0900 Hypothetical protein
atggaggtattattagaaaattcgaagagcaagaaaggtaagcacgtagtaagaaccttt
ttattcaaggtagactcaaatggatcaatacaacagatagaattgccagggaaaccagta
agacccacatataaggtaggtgaggcaaagattgtaaacatcccaaataaaggtgtctac
gtttatctttttcttttaaggaatatatatggacgtgtaatgggtaggataattgtaatt
aatgatgggaaaacggtactagtaatgaagtatagaaagttaaagttaaagctaatagat
ggtgatgataaacacgtagtaattgtaaaaagaattttcgaacaacttaaaattccggtt
aagaaaataaatattaacaagaagaag
>SSO0901 Hypothetical protein
gtgagaaaaatgtttgaagtaggatttaaggttttagctgaagatccttttagaataaaa
tacttgtcacaatctattaatgacgtatttaaggatttgtgtgagccggtaaaaatagga
gcgtcatacatttgcgctcccaatcaagatactctactcttgatctacttcagttctcag
ctttcaaaagatatgaatgcgtcacttaagataatgtcgaacaatgcaacatatgttgtt
gagattatgagagaagttaatagtagattaaggtcacaaggtttttatataaccatctcg
gaaacctctagtacttcatta
>SSO0902 Hypothetical protein
atgatagtaacaaattacaacataaatggtctaaatttttctgtaatttatgagaatgaa
agagtaattatatatatggatgtaaataaggagataaaggtaaataaacgtgcaaaagat
gaagaaagagtaatatatatggatgtaaataaggagataaagaatggaatattgagaaaa
ttaataatatgtaacactaaaatttcatcctatatttgtaatgcgatagttgaaattact
actaagaatatatatgaggatttgcttctaaacctttataatgaagtactagaggtttcc
gagatggttata
>SSO0903 Hypothetical protein
atgaacttagcatcgtattataagctagaacctttaaaaataaacgatatagttgtactt
tatactttacggaagaccaaggaagctgagattatagacggtattcgtgatttagaatca
ataattcccgatgagtctaacgacgttgtaataattgagggtgataatgagaaatatatc
aatggtaaattcaagttagactttcaattctctcgccccttaaatgtaatttctataggc
gttcctcaagttgtaaatggagatcagattcagattacttcaatagacgtaaatatgggc
aatatcattggtggagttctggttaaaagagatttagcgttcctgatgttctatacctat
gatggtactaagataatatcgatgtcagatattaatccacctattcctgaaaagaaggaa
agtgtaaagagggttaaaaagaagagaaagaggagtaaaaagcgtgctaagaagtctagt
tcaaaatccaaaagtaagagcaagagttctggaaagagt
>SSO0904 (ogG) 8-oxoguanine DNA glycosylase (EC: 3.2.2.-)
gtgctaagaagtctagttcaaaatccaaaagtaagagcaagagttctggaaagagttgat
gaatttaggttaaataatctatcaaatgaggaagtatggtttagagaactcacgctatgc
ttgttaactgccaactcgtctttcatttcggcctatcaagccctaaactgtttggggcaa
aaaatctattatgccaatgaggaggaaatcagaaacattcttaaatcgtgtaagtataga
ttttataatttaaaagcaaaatatattattatggctagagagaaggtttatggaaggtta
aaagaggagataaagcctttagcggatgaagaccaacaattggctagggaaaggctgcta
aatataaaaggaataggaatgaaagaagccagtcattttcttagaaatgttggatatttc
gatcttgcaattattgatagacatataatagattttatgaggagaataggcgcaatagga
gaaactaacgttaaacaattatcaaaaagcctctatatatcttttgagaatattttgaaa
agtatcgcttctaatttaaatatgagcgtcggtatattggatttgtttatatggtacaag
gagaccaatactatagttaag
>SSO0905 (serA-1) D-3-phosphoglycerate dehydrogenase (EC: 1.1.1.95)
gtgataagtatggagactatacaaggtgtaaactctataggcaaattagatttcaaagta
ttaataactgatccagtagatcaatatatgataagaactttacaaaataatggactaatt
gtcgattataagcccgaaatcacaagagaggaattactaaagataatagaccagtaccaa
gttttaatagtaagaagcagaactaaggtagacaaggagataatccgttatggtgttaat
cttaagattatagccagagctgggataggactagacaatatagatacagaggaggcgtct
aagagaaatataaaaattgtgtatgcgcccggggcttctacagattctgcagcagaactt
actataggattacttatcgccgcagctagaaaactatatgattccatgaatatggcaaag
ggtggcatattcaagaagatagagggaattgaattagcagggaagacaataggtattgtt
ggattcggtagaataggtaccaaagtagctaaggtatgtaaggcattagatatgaacgta
attgcatatgacgttattaatataaaggaaaaggcgaatatagttggagtcagagtagct
gaaagtttagaagaattactaaagaactcagatgtgataacctttcatgttacagtaggt
aaagatgctaagccaatccttaacaaagatacatttaattacattaaagataatgcaatc
ataatcaacaccagtagagctgtagtgatagatgggaaagcattactagaatatattgat
aaaaaacacttaacttacgctacagatgttttgtggaatgaaccacctaaagaagattgg
gagattaaattattaagacacgagagagtgatagtaactactcacattggtgcccaaact
aaagaagcacagcatagagttgcggtagttacaacagataatctcattactgctttaaag
gaaatcggtgttctcaaa
>SSO0906 Soluble hydrogenase, small subunit (EC: 1.12.-.-)
atgatgttaattcccggtccagttaatgtgccgtatagtgttttacaagcctctcttaat
ttagtgaatcatagatcggagaaatttagagaaacagtaaaaacattggagtttttaatg
aataaacactttggatctactcgtgtagcgctactaagcggctccggcactttagcagta
gagtctatggtctattcgttagtgaaaagagaggagaaagtaataacatttccttatggt
gaatttggacatagattagaagaatcgctaattagacgtggagcaaaagtaattagttat
cagaaaaaattgggagaatccttcactgttgaggaaataaaaaaggctattgaggaaaat
aaagatgctaccacagtagcgttagttcacaatgaaactagtactggtatagcatttaga
gaccttaaaaagatagctgatgttgtaaaaggcgtagggttaaagcttcttgtcgattca
gtatcagggtttgcagcttatccgctttatgttaatcaatggaaaattgattgtgtagta
actggcagccagaaggctttagcaagtatacccggggtcggatttgctgcgttgtctgag
gagggtgtgaatgaactggtagagtcagatttacctagttatctcgatttatcatttcac
ttgaagtttcaggataagggagaaacgccatttactcctactgtgggtgcgttttttgct
tctcgaagggctgctgaattgctggataaggaaggaatagaaaatagatggaagagacat
gaagcttgtgcaaggtatttaagggaagtgatgttggagatgggatttaaactgttagga
aatgatactaacttttctaatacggtagttgcggcgtttcctcctatccctctagataca
tttatgtcagagttaaaaaagagaaacatagagatttctaagggtatgggggagttaagg
gataaaatagtaagaataggaattttaggtgtagttgacgatagggcaattagaagatta
gttggtagtatgggtgaaatacttaaaaagaatgttgaatttgaggttccaagagaatgt
aagttgccggaagagttaaaagttgaagttttatgggat
>SSO0907 (topA) DNA topoisomerase I family A (EC: 5.99.1.2)
atgaatttatgtaatgtaaacaactattaccttataattgcagaaaaatcaaaagctgct
aaaaaaatcgcagaagctctttcagagaagcctattttgtgtagaaaatataacgttagt
tattggataataaaagatcacaatagcagcaaatatgttatagttcctgcagcaggacat
ctttttgggttaaaaggcgagagcggttttccggtatatgatgcggactggaaacctcta
tgggaaattgataagaatagttactatacaaaaaggtactatcaacttatctcatctctt
agcaagtatgctttaggttttatcaatgcttgtgattacgatatagaaggttctgtaatc
ggctatttaataatcaaaaatctaggcgatattaagaaggctaaacgaatgaaattttca
gcactgactaaaagtgatatattatctgcatttagaaacatttctgcattagattacgat
atgataaacgctggaatagccagacataaaattgactggctatggggaattaacgttagt
agggctcttatgatctctctacaagatttcgcaaagaaaagagtgatattaagtgcgggt
agggttcaaagtccaactctagttcaagttgtcaactcggaaattgaaagaaacctattt
attcccctacctaaatttaccgtttcaattatcgtgaaaattaaagattattcattaaac
attaaggtaaataaggaattcgaaaaaattaccgaagcaaaggaattcttaaacaaacta
ataaataaaacagtaaaagttgttgaagttgaaaatagggttaggttattagaaagaccc
tctccatttaatcttactgatctccaaatagaagctggcagaatatatggtatatcccca
tataacgtagaacgtatagcagaagatctttatttggacggtctaataagttacccaaga
actaacagtcaaaaaattccatcaactatcagcatttataatataatcaaaggcttagag
aacagttcgtataggaaactagttgatttagtaaggaaaatcactggggggaaatatgta
gttaagcagggcattaaggatgatcctgcacaccccgcaatccaccctactggtgaagct
cccaaaaacttacctaatagcaaattcaagatatatgacttaatagcaagaagatttttg
gggtcagtatctgctgatgctaaattatctaatactatttacaccttgaaagttagtgat
ttcccattagagtttacggtctcatatacaaaaatactagaaagaaattggctagatata
tatcactttcataatgtaaaagaagataaaccaatatttctctcaaaaggtgatgagggt
aaaatagtagatggaaaagtaaatattagtttaagcaagcccacttctaggtatacaaag
gtttcattactcaaatggatggagtcttctaatttgggtacagaagccactagaggaaga
ataatcgagatcttagtaaagagaaaatatttaactaacaatgggcgatacataattcct
acaaaattgggattctatattgctgaaatattaaacaaatttttcccagatatagttgat
gttaggatgactgcagatatggaaagtaaattagaaatgataaagactggcaaagttttg
gaaagcaaagtgattaaagaaaacatagaaaaattaaataaattcatagaggaatacaag
gtaaataaggataaagtaggagagtcattagctaaagcgttaggtcttataaaaattgtt
aagtgtaagtattgtgatctggagcagtataaggatggattatgtaaatatcactatgaa
gccaaagtaaggcttttagatgctgtggaaatttggaaagaaaggacaaaatatgatcat
aaaaagattttaaagagaattagtagtagtaaatcaacgggtaaatacgtaaaagatata
gtaacttatatgctaagcagtgaa
>SSO0909 AAA family ATPase, p60 katanin
atgagtgcacaagtaatgttagaagatatggctagaaaatatgctattcttgcagtaaag
gctgataaggagggtaaggtagaggatgcaataacgtattataagaaggctatagaagtt
ttaagtcaaatcatagtcctctatccagaatcagtggcaagaactgcgtatgagcagatg
attaatgaatataagaaaagaataagttacttggaaaaggtcttgccagcatctagtgat
ggtagtggagacaatacaagtccgccagaggaagtagtaattacagagaagccaaaggtc
tcatttaaggacatagtgggtttagatgatgtaaaagaggcattaagagaagcaataata
tatccaactaagagaccagacctattcccattaggctggccaagaggaatcttattgtat
ggtcctcccggttgtggtaaaactatgatagctgcagctgtagcaaacgagatagactca
attttcatgcaattagatgctgcctcagtgatgtcaaagtggttaggagaagcagagaag
aatgtagcaaacgtattcaaaatggctagggaagaatctaaaaagcaaaacaagcccgca
ataatatttatagatgagttagacgcattgctaggagtttactctacggaggtaggagga
gaagcaagagtaagaaaccaatttctaaaggaaatggatggacttttggacaaatctgaa
aactataaagtatatgttataggtgccacgaataagccttggaggttagacgaagccttc
ttaagaagattccagaagagaatatatgtaccattaccagattacgaacaaagactatca
ttattcaaatattatacctcgaagattaaattagatactgaagtaagccttgaagagttg
gctaaattaactgaaggatataccgccagtgatattagggatatagttcaggctgcacat
ataaaagtcgttaaagaaatgtttaagaataatttaggtgaaccaagaacaattacgctc
caagactttaaggatatattaaaagtaagaatgccaagcgttaatccagaattaataaaa
gcttatgaggcttggacagagaaatttaaggcatta
>SSO0910 Conserved hypothetical protein
atgtttgataagttaccatttatttttaacaacgagaagaggcgaaaggctcaactaggt
aagatactcactgaaatatcattaaaattaaaagatcaacagactagattagaagaggcc
ataagaagattaaaggatagagataaggaattgttcgagaaagtagtaagagcccaagta
gaaggagatgatgcaaaagcgaaaatatatgcacaagaaatagctgacatcagaagaata
ataaaagtaatttacacagcattcctcgctatcgagaaagttagactaaaactagatacc
gtgcaagaactgcaaggtgtttctttggtattatatcccgttgctaaaatattaggcgat
ttgaaggatcaaataaaagggatcgctccagaagtggcaatagccttagactctattata
agtagcgtaaacggaatagcagtagaaacgggtgcaataaacgatagaggagtagttcct
gcagtagtagatgaacaagctaggcaaattttagacgaagcacaaaaaatggctgaagtt
aaagttagggaattattaccagatctaccacatccaccagtagagcaatcgtcaagggcg
tcacaagctaaacccacaataaggaagatcactgaaagagaactattggattacatagta
aataatggtggcttcctagatatagaacactttagcaaagtatatggtgttgaaaaacaa
gaagtagtaaagcttcttgaagcattaaagaataagggactaatagcggtggagagt
>SSO0911 Conserved hypothetical protein
atgacgaatctccgctatctgaagagccccaatctttataagtattacttaaaagaccaa
atatttttgaggagtattaccatgcccgtatcgtacgaagtactaacgaaatttattgga
caaaaggttaaagacatttatggaagggagttcggatatctcatccatgtatacagtgag
atagatggaagtataactgggattgaggtagcacaaggttcttctatcatgaccatggga
ccagaaaggataaaggtagatggggatagtatactaattcttccagattggaaagcagaa
gcgctaagaatattaagtttaatggaaaagattagaaaaaggcagagggcattagaggaa
ttatacaataagcaagagattcctaaaagtgattatgatgagatgaaaaggaaactggat
acagagatgttaaagctaaaggatgatcagaataagctaaaaggaaaattaaaatctaga
cttaacgacatagaagatcaattagctcatatagataaagcagtaatctcattaaaaatg
agttatatctcatctgagattccggaaaatgcgtacaaaggttcaatagaagttctaaga
caatcaaaggatagttacactctggaaagagacgatattaggaaaactttagatagatta
gactcgttggataaggaatctatagaacttaagcctttaggctcattgtctacatcacaa
caaggtgaggtaaagagtgatcaatccaaatcggaaataccattgccaataccggtaaag
gtaataaatactctt
>SSO0913 Enolase (EC: 4.2.1.11)
atgattaaccgtttttccatagagaaggttaagggattagaaatcgtagattctagaggt
aatcccactataagagttttcataagaactagtgatggtgtcgaatcctttggagacgca
ccagcaggggcttctaaagggacaagagaggcggtagaagttagggatgaaaatgggctt
acagtaaagagggcagtagacattgtaaattacataatagatcctgcattacatggaatt
gatgtaagagaacaagggataatcgacaaattactaaaagatatagactccactgagaat
aagtctaaattaggaggaaacacaataattgcaacatcaatagctgcattaaagactgct
tctaaggccttaggtctagaggtttttaaatacatatctgggcctagattacctaaaatc
ccaatacctttacttaatataataaatggcggtttacatgctggaaataagctaaaaata
caagaattcattatagtgccaattaagttcaatacttttaaagaagctcttttcgctgcg
atagacgtttatagaaccctaaaagggttaataacggagaggtatggtaaaatttacaca
gcagttggagatgaagggggattctctccacctttagaagatactagagaggccttggat
ctaatatatacttccataaataatgcaggttatgaaggaaaaatatatatgggaatggat
gctgcagggagcgatttctacgatagtaaaaaagagaaatatataattgatggtagagaa
ttggatcctaatcaattacttgaattttatcttgacttagttaaacaatatcccatagtg
tacttggaagatccgtttgaagagaactcttttgatatgtttagccaactacaaaataag
ctgagttcaacaataattactggagatgacctatatactacaaatataaaatatctaaaa
ataggtatagaaaagagatcgactaagggtgttatagttaagcctaatcaagtcggtaca
atatctgagacgtttgaatttactaatttggctaggagaaactcaatgaagttaataaca
agtcatagaagtggagagactgaggacaatttcatagcagactttgcggtgggaattgag
tcagatttcataaaggttggtgcaccggcgagaggagagagaactagcaaatataataag
ctattagaaatagaaaataaatttggattagaatacgaaggaaaatatttttatctt
>SSO0914 Hypothetical protein
atgttagcccctagtatggcctcaatagtatttttagcatatggtttactttctcctatt
tactctagatttttcaaagataagataagtaatgaaaggctatttctagttgcatggtct
ttggctcctcatctggtgggtttaatatactcaccttctttttttattgcactattagtc
ttgatatctttatgcgttactttatttattgtttataaagggaagtttagaattatatac
tcaggaattatattcttatttatggcagtaattatacagatatttattaatcctttaacg
agatta
>SSO0915 Conserved hypothetical protein
atgccaaaaaagaaacaaattgatccatacgtttgtccaaattgtgggacaaaggcagag
aaagcacagaaaacatggcagctagtttcacctcttccagattcttacggcagaattaca
ataacagttatgggttcttttgtttgtccgaattgcggtcataaatggaaatctgtggta
tctaagataaaggcgggaggttcctcggtagagattgaaggtaagaagggcgttaagaaa
atagaatctaaggactctgaggaaaaagctaatgaaggggaggttatagaattagactta
agtgatttagatgaagatgaagaagag
>SSO0916 Signal peptidase, putative
atgaagatgaagaagagtgatataatcattatcttatttattgcattaatttacattcta
atgttttctaacattgtgcaaagtgcgagtgtagaaggagtttcaatgtatccaatattt
caaaacggtgcgctgactttttacgttaagccaatatccattaatgaaggtaacgtgata
atatataaatctccgtatttcaacaattacgtaattcatagagttatagctacagataac
ggttattacattactcaaggagtagataaaataactaacccaataccagataataggatc
ggactagagccagctagtgggatcccaaaaaatttagttgtggggaagatagtagagttt
ggtaactttacattttcaataccttatcttggttacatatctatacttttctcatctatt
att
>SSO0917 Glycine dehydrogenase subunit 2 (EC: 1.4.4.2)
gtgtggagacaagctaaatggaatgagcctttaatattcgagctaaacaaaagtggtgca
gctagacaaggtttcttgataaataaggacgaggagataagaagtcagattaaggaaatg
aaaatacctaaaaatctcctaagggaaaatgagccagatctaccaagtttaagtgagcta
gaagtagtaagacatttcgtaagactatctcagatgaattttggagtagatattggaatt
atgccactaggctcatgtacaatgaaatataatccaaagattgaggagaaagctacagca
attacggaatttcatcaccccttagaggatgaagactatattcaaggaatactagagatg
atttacgaacttcagaactggtttagcgaaataaccggcatggacgaatgtagtttacaa
gtgccggctggatctgctggtgagttcgcaggagtcctaatgattaaaaagtaccatgag
gagcacaatagaaattataaagatacaatactggtcgcagatactgctcatggaactaat
cctgcaagtgcagcaatggctggatacaaagttatgtatgtaaaatcaaatgcagaagga
ctagtagacatggatatcttaagggagatcgtaaacgataaaactgccggcttcatgcta
actaatccaaatacgttgggattatttgaggagaatatcctagaaatctccaagataata
cattctacaaatgctgtattgtactatgatggagccaatttaaatggagtgttaggtatt
gcgaggccaggagatatgggatttgatattgtacatttaaacctccataagacattcgct
gttccacatggaggaggtggacctggggcaggcgcaatttgtgcaaagggtgaactcgtt
aattacctcccatatccgatggtagagaaggtaaatggaaagtataagttaagcaagatt
ccgaagaatagtattggtaaaatagctacattttacggcaacgttggtaatttagcgcgt
agttttgcatacatattaggattaggacctcaaggtattcaaatgataggaaaaatgagt
actttagcgactaattatctcatagctaagttaagagacgttaaagaactggagttaatt
gcgccaaataggcataggaagcacgaggtagtatttagcgtgaaacagttgatggaaaat
tatggagtaagtgctaacgatgttgctaaagccttactcgataatggattttacgctcca
accatatacttcccaccaattgtcgaagaagcactaatgatagagcctacggaaactgag
actaaagaaactttagatatgtttgccgaaactcttaagaagattgtgaatgatgctaaa
ataaacccagaacaagttatgaaaagccctaataatacaagtattgcaagattagatcaa
gcttatgctaatcatccttcaactataacgccaacatatagagtgttaaggctgaggagg
ttaggtaaaatagattaccttaaa
>SSO0918 Glycine dehydrogenase subunit 1 (EC: 1.4.4.2)
atgtataagcatccttggcttccaaacctagacctaacagatgagatgttgaaagagata
ggagtaaactcccttgacgacttattcaatgatataccggctgaaatcaaaataaataga
ttattaaaagtagcaaaagacaaaccactatcagaatatgaaattgaaaaagaaatttat
gaaaaagtgaagaagaacgtagaacttgaagcaccacctttcattggggctggtatttgc
ccccattacatccctaatgccgtaaaatttatcataggcagatcagaattttatacatcc
tatactccgtatcagccagaaatttctcaaggcatattacaagcattgtttgaatatcaa
agtttaatggctgaactactagagatggatgtagtcaacgcttcaatgtatgattggggt
tctgcactagctgaggccgtattaatggctaatagaataaatggaaaaaagactgtccta
gtacctgaaaatgctaacccatttcataaagaagtaatgagaacatggatacaaggaaag
ggaataaaaatagaggaagttaagtatgataagaattccggcgaagttgatatagaggat
ctggagaagaaatctagtagtaatgatgtatctgcaatatatgtacaacaaccaaatttc
tttgggatttttgaaagtaacattgaacatattattgacgttgctaagcataaaaaagct
ttaagtattattggagttaatccgctttcacttggtctaataaaaccaccgggaagctat
gaagctgacatagttgtaggtgatggtcaagaactaggacttccgttaaattttggagga
cctttaatggggatatttgcagtaagatgggatatgggattggtaaggcaaatgccaggt
aggatagtgggaattacaagagacgtaaataacaatatgggatttacgctgattcttcaa
actagagaacaattcatcaagagggaaaaggcaacctctaatataactacaaatgaagcc
ttgttagcgttagctaatgctgtctatttaagcttattaggaaaagagggaataagagaa
cttgcagaggagatttacttcagaagtcactatgctgctaaaaggctaactgaaatagat
aacgtaattatgccatttacttcagactttttcgaagaatttgtaattaaattccctata
gaatataatataataaatgacaaattgaaagaaagaaaactacaaggtggattaaaattg
tctattcatacatctctcttttgtgtaacagaggttcatgataaaaagtcaatagatcta
ttagtatcaacgatacaagaggcgataaaaagtgtggagacaagc
>SSO0919 Aminomethyltransferase (EC: 2.1.2.10)
atgtttgtttcaccttttcatgacgttgaggaaaagttgggagcaaattttggagagttt
gctggttgggaaatgccaatgagcttcaccagttatgcagaagagcatatgtgtgtgaga
aattcagtagcgttttttaacttatctcatatgggcagactaagggttaaaggcaatcca
agggagtttgagatgttagtagctaaggaagttaataaggcgaattctggaattatgata
ggacctactgcatttttgaatgataaagctggttttaaagatgatgtcatggtttataaa
gtatctgagaatgaatggttaattgtaacaaatgcaataaatagagaaaaaattgtaaat
tggataaaatcaaattcaaatttggatgtggaagatctaacattcaaatatggtatgatt
gccatacaaggtaggaaattagaggagattttgggtaaaaatgaattaaagcaattagaa
tttaagcttaatactagatttatgggatatgacgtttttttaataagtagatctggctgg
acaggcgaaaatgggttagaagtttgggttacattagatgttggtagacaactaatgatg
gatttagtgaaaatcggaataaagcctgccggtttgattgcaagagatagtttaaggcaa
gagatgggctttgtcctttacggggaggatattgatgagaccattactccagttgaggcc
agatattgggttttctcgttagaaaaggattttataggaaaggatagtttagttgaacgt
ataaggagtggtattgataaagttaggataggctttaagatgagaaaaggtgagagaact
atacctaggcatcaatctaaaatatactcaattggaaatgaagtaggttatgtgacgagt
agtactttttccccttacttaaatagagttataggtatgggttatgtaaaccccaagtac
ttctacctcggctatagtttaactggcgaaattaggggtaaacagtatgatataaaaatc
gatgagtttccatttatc
>SSO0920 Glycine cleavage system protein H
atgaatgaaatgaaagtaggtagatacgtagttctgacagatagattatacacagagact
gacgaatgggtggtgctttctaatgataacgtggcagtaattggaataactgattacgca
caaaagaagttaagagatatagtaggaattgaattacctcaactgcagaaggaagtgaaa
gctggagaatctgtaggagttatagaatctgttaaagctgctgcagatattttctctcca
ttaagtgggataatagttgaggtaaacaataaattacttgagcatccagagataataaat
aaggatccgtatggtgaaggctggattttcaagttaaaggcgtctaagttatctgaagaa
aaagaaaaactacttagcccggaaaagtatattgaaaaaataaagggtggg
>SSO0921 Conserved hypothetical protein
gtgggtagattgagcgaggtatttgaagttagggaaagatatgttccccagataggtaga
ccctcatatttattagtgagcttaccagatgccggattagtaggtagtatatctggagaa
tttctgattaattacttaaatttgagagagtatggagaaatttattcaaataaacatttg
cctcccatttctcatgtagttaacggagtagctaagtcacctatacgtttatatcactat
gataatttccttttacttcactcttggatcgcaattccagcaaatagtataaaccattta
gcaaatttagttgttagttatgccgaaaaatatggcatacagacaataatatctataact
ggagttccagtgcctaatagattagatctggaaaaaccaactccctattgggtggcaagt
tctgaggattttgctaaagaattagatagtttgaatttaatgaagaaatttgtagagggt
tacgtaagcggaccatatgctcctattttgttccaatccgctaaaaaactaattagaaac
ttgcttatagtagttgaatcattcctagacttacctgatccggaagccgctgcagtagcc
ttagacatattatctaagatgttaggatttaaagtggacacttcctccttacttaaagaa
gccgaggaaattagggagagaataaaaggtttaatgcaacagacaaggcaagaactacca
aactattctggattgcgtccatctacatatgcg
>SSO0922 Hypothetical protein
atgccagcatacaaagacttatatgacatggtaaagtcgatgatagaaaaggaaataaat
agaatggagaaagagtttcggaggatagagagtgaaattaaagaggaaattgaaaaatat
aatgttcccttgtatactttttatgaatctgaggatttctattactacttgatcgatgtt
cctaatgtagatacatctacattatatgtgaaagtgaaaaacgacagtctgagaatcagt
tgtaaagataagagtaataaggaatatgttctaaatataaaggtaccagaagacgctgat
attgatagtttatctgttacaagagtaaaatggttagttaaaataactgtaaaacgaaga
aaagat
>SSO0923 Conserved hypothetical protein
ttgagtgaggaaaaaatagcaagggatatagagactagaaaagtccagaaactaggttct
tcatcattatttatcacactcccgaaaaaatggataaataaatggagcataaagccaggc
gataaggtaattcttgaggccttagatgacggtagcttaaggttaatagcagaaaaggct
aagactaatgcggggaggaagacaatattagtcgatgtagactcactaaaacaaccacta
attaatataatcccttgtctatatattttgggattcgatgaaatagttttcgaaactaag
aaagatttcaataaaaaagatttcgaagaagttctctacatctctaaacatctagttgga
gcggaggttgttgagagttcagagaaaaaaatcaaattggagtgcttactagatacagag
aaagtcggagttgaatccttactgagacgtatattaaatatcatttcaaagagaattgat
gaattatctaagtttttaactaattctcatacaattcatcaaagtggtatatctaatagt
gatgatttaaggaaaatatatctgatgttacttaggagaataataggaaataagtatcag
tccagtagtacggaatattatagaaattcgcttattttacttaatatatctattttgata
aatatagattatatagtatcaaaaatttatcagattaaagacaactttgaggttagtccg
agccagacggatatgttaaaatcgatcttcactagcataaatgatgtattggatgaaatc
gtgatgagcgctctattccctagtgtaaaaagaatatcaaatggattcaatctaatattg
caaataaagcaaaatttattgaaaattaaggattctttgcctaactcatttaatttgtat
ttagaagatttagtaaatctattagaaaatgctctaaataattccatgtgtggaattttc
ttagaggacttaccttggatagaaaaagatttaacagca
>SSO0925 ABC transporter
atggtaacattaaaaatagaagatttacatgtagaagttgaaggcaaagaaatacttagg
ggtataaatctcgaagttaggagcggagaaatacatgcattaatgggtccgaatgggagc
ggtaagacttcattgtccttagcaataatggggcatcccaaatataagattacaaaggga
aggatagtattggatggcgaggatataactaatttagaacctcatgagaaagcaaaaaag
ggtattttcttagcctttcaaaaccctatagaaatagcgggggttagattatcaacactc
ttggttgcggaatataataaggtaagcgatagtagcgcttcagtaatggaggtaatatca
aaagttaaaaatattagcaaagaagttggaatagcagattctctgttaaatagaggagta
tttgaaggctttagttggaggcgaaaagaagagagtagagatcttacaaatgcttctatt
aaagcc
>SSO0927 Conserved hypothetical protein
atgcaagaagataaaatatcattagatctacatgagataataaacgctaccatagatgcc
aagtacaataagcttaatcagctagaatttcacagaagaatagtagaatccggactaagt
agatctacaattgaggaaatttctagaataaaaaaagaaccagaatggatgttaaaatta
agattaaagggcttagaattatttgaaaaattacccacaccaaattggttaccagatgtt
ttatcgagtttagacatttcagcgttagaactttacgttaaacctggtgttgataaagcc
caaagctgggaagaactaccaccagaaataagaaaatattacgatgagttaggtatacct
gaaagtgagaaaaagttcctaggaggtctcgtggcagtattagagtcagaaccaatctat
tctaatgttaaaattgagctaatgaaaaaaggagtagtaatgcttccaatagatgaggct
gtgagcaaatatccagatcttatgaaggagtactttatgaaaatatttccagcctctgat
cacaaatttgcggctttacatggtgcattatggagtggaggcgtatttgtctacgttccg
aagaatgtaaagataacaacaccagttgaaggattcttcgtaataggatcagagcttgaa
ggacaatttgagcacactctattaatagccgatgagggatcatatattcactttattgag
ggctgtacagcgccacaactcaaaaagtactcattccatgatggtatggtagaattatac
gccaaaaagaacgcttacataaagttcactacaatacagaactggagcaaaaacgtgatt
aatttcaataataagagagcatgggctgatgaaaattcaaccgtggaatgggttgaagga
tcattaggttctaagtacagctttgtgtacccatcaactatccttagaggaaagaacgct
tcatcaacaagcttagtggtcacaatgactagtggagaaggggagtggaaagatagtggt
tcaaaaatgattcacgcagcaccttatactaagagcaaagtagtaaacaaaaacataggt
tttaacggcggtgtgaatgtttatagaggattagttaaagtgaataaaggagcagtaggt
tctaaggcatttgtgaaatgtgattccctaatgctcgatgacaaaactaaggcctataca
tatccacacaatcaagtattggaagaagatgcagatgtagggcatgaagcccacacattc
agaatgaacgaggatcagctcttctatctaatgacaaggggtatagacgagaaagaggcc
acctcaatgctagtattagggttcatagacgaaatcatgaaagagctaccatttgagtac
gctaccatgctaaataaggttataaagttggaattagataagctaggtgcagtggct
>SSO0928 Conserved hypothetical protein
gtgcagtggcttaagttgggagtagtcgatatacagttagcaaaaaaagtaattaatgaa
aattttacacaagataaaggagagagggaaaaagcattttccttgtacctttctaagcca
taccaactaatacatgattcgccaactatcaaacattatactgaatgggacttgtacgac
tccctaaatcttactaatatttctagacaagaagtaaaatataacgataccgcaaatgta
attgaaattatagacgatactataaaaattcctaaaaatgatatacaaatagatgactta
ttaaacgatagtattattagtagtgatgagcataaattagtctcacttgcctattcttta
tctagaaggataacaataaacaatgagggagagtattatgttaagcatgtccttaataaa
gacaagtatttttctccttcgcatctaataattaacgtacctaacgataagcaaattaag
gtggtttatgaagtcctaaaccttagcgaaagttccttaataacacctattatatctgtt
aatatagaagataactctagtttagatttccaatttgtgaacttctctagcgataacagt
ctccttttctcgtacattaaggctaacataaagggtacgatgcactcatctatatttgta
aacggtaataagatgggtcatgttcaatttagtactagattagaggagagtagcgtaagt
gaattttcgtcaagagcttttggaacgcatagcaataagatagatgtagttaataatgta
attcatctaggccagaagagtgtaagtaatggctttatgaaggcaatctctaacgatcaa
gcgtttactgtggtgaggggtgttgcaactatagatgagactgcgatcaattcttccacg
tctattattggtagatcattagtcttaggaaaagacgctaaagcagtagtttctcccatg
cttgaagtaaagactggtagggtagttatggctaaacattcagctgcagtaagtaaaata
gatgaaaatcaaatcttctatctacaaactagaggactaagtagaagagaagcagaaggg
attataataaggggttttataattgaagagcaggatccagaaacacttaaggataggata
gaggaaatactaaagtctttaggatat
>SSO0929 (nrd) Ribonucleotide reductase (EC: 1.17.4.1)
ttgaaggaaatggagcagctattatactctacatctttaagaaagattaaagtaatcaaa
cgagacggtaaggttgatgagttcaaattagaaaagatactatctaaactttcttccgtc
ccagatgaggtaacagatggcatagtcaatgatgtacaagctaatgtaaaagataatgct
atagatactagggtaattgcggatatagttgaaagaaacctcatagagaactcactaaag
tatcctttcttaatggaattagcaaaacgatatgtcttagctagaatttacaatcatgtt
ttcggtaaagggaaatggaaagatttcgatgagaaggatttgcttctctcttacaacgca
ttaaaagtattggaagctagatacttattgaaagatcctaatactttgcgttatattgag
acaccacagatgttattcagaagagtagctagatttctcgcatcagttgagagaaaatat
ggtaaatctgaggctgaagttaaacagctagaagataagttttacgaaatgataagtgac
ttgaagtttgtacccaattcgccaacactgatgaatagtgaaactagactaggcatctta
tcagcatgttttgtaattccagttaaagacgctatgactacgccagagggagatggaata
tatgacgcgttaagagctactgcccttgttcaccaacaaggtggagggactggtttcgat
ttctcagaattaagacctaagggagacgtagtagcttcaactgcgggtgtggcgtctggt
ccggtttcatttatgaaagtatttgatgcctctactgatgttataaagcaaggtggaaag
agaagaggagctaacatgggagtgatgcacgcatggcacgctgatattgaagatttcatt
cgtgctaagactggtcagctaaaagatgttcagttacagaatttcaatatttctgtaggt
gcttatgactactttatggatgctgttgtgaaaggcgagagtgtacctttaattaaccct
agaaagaccaagatagcagggagagatcatgaatattatattacaaaggctaggggttat
atgagtgaggagtggattcaagaggtcatactatcagagttagaggaaaaaggtggagta
gtttctctagatgagagtaagattattacggttgacgaagcactagtaatagcctcaaag
gagggggctgttgtcaagtatgttaatgcaaaatcattattcgatgaaatagtgaagggg
gcatgggatagtggtgaccctggccttctctttatcgatactattaataggagacatcct
gtttggtatttaggtaagattaatgctacaaatccatgtggtgaagagccactattacct
tgggagagttgtaatttaggctctataaatctagagaaatttgttatagaaagagatggc
aaagcggcgatagattgggatggattagccgaaattattaggtacggggtaaggtttctg
gataacgtgattgatgctaatcgttatccgttaaagcaaattgaagatgcaaccaagaga
actaggaaagtaggtttaggtgttatgggactagctagaatgtttattaaattaggtatt
gcttatgatagtgtagacgcaatatacttgtcataccaattagccaagttcatattttac
catgcgtataaggcatctattgagatagctaaggagaagggtacatttcctacatatgat
gcgaggctgtatagggatatttgggagagtgcattggacttcgattcattgctacaaact
gctgaaattagtgataaaccctcagattacgttaaaaagttaactagtgtggtggataag
ttagattttgatttgctaaaaggtgagagattaaaatatggtttaaggaattccactgta
gtttctatagccccaacgggtactatctcaataatagctgggacatcatcttcaatagaa
ccactatttgcattagcgtttgttagaaatgtcgcagttgggaagttcatcgaaattgat
ccgcttttcctagaatatctaagaaaatatgagttagatgacccagaggttattcagaaa
atagctgaaagcgggataattggggataacgtatttatgccaagatcattaaggaaattg
tttagaactgctcatgaggttccaccaatttatcacgtcatgcatcaagcagcttggcaa
cagtggaatgattccgggacttccaagactattaacttaagatcagaggagccaccggag
actgtagagaaggtctatttattagcgtggaaacttggaataaaaggtataactgtctat
agggataagagtaagcaacagcaagtgatctatttcggcgttaagaaagaaagggaggaa
tatgagaagaaaaaggaagaggtggaaaagaaaacgcaattacttccttctagtttaagg
atggagaagaaatttgttgaagtttcagagacatatgcaggtggatgtaagacgtgtgaa
cta
>SSO0931 Conserved hypothetical protein
atgtcattacaattaccatgtgaattttcagtaagggagattttaccagcagttagaagt
atagtagctcaaaaattaataaaagagaggaatttatctgaatataaagcagctaattta
atgggcttaacaccggctgctgtttcaaattatcttaagtctagaagaggtagtaattta
agatctcttctagagaaagatgaaaaatttatggatcttgtaaatgaggttacggaaagg
attctaaactcaaattctaatctttctgtgtattattgtattttgtgttctgagggtaaa
aaagttcttacaaagcatgggtatgccctaagcccatgtttatatgagactatagttgaa
cctaaa
>SSO0934 Hypothetical protein
atgaagctagatgatataataaaggtagccgctgagtatccatttaaaactcttagtgaa
aatatagagctacaagatgacatgcttagtatagaacaactaccacaattattaactatt
ggcggagttaagagagtaaaatggaaatataaggcaaaaattcttggtccagatctatct
acaatattaactgaagggacagaaaatgaagaggagttgataattagaacacccttacac
aaggtttcaattccttggatctttacccgattggacactgactcattaaaaaagctggta
gaatatttaataccttgtaaagaaggaatttccctttttaacatatctccttggccaaga
tattactttatgcaaaatagaattatagaattaaaagagggtgagattgggaatggcaga
aatgttagtttagaaaatataaaactaacggaaaaccaaataagcataaatacaagattc
gtaaatcccaaattcttctatatgaatccttattacatagaaagcagttacaatccaata
cgtaacacatttgctgcaagtttagaactcacagaggcgtattcctttgtaagcaattct
cttatggacttagaattcgagctaggaaagattagtgtagaagctaatggaaaaatttta
gtttcgaagacgaggacttttactgaatctaaactccatagattattatgggatatgact
aacgatgtaatagagatagagtgtaatccgcaattccctctctcattatatcgaatagag
ccttcctctataattccattatacatgaagtttgacgagaaaaccaacatactgcaaatt
gtgttagaaaatttcagcgataaaccggttatagccacagtatatatctcggcaagaata
actaaaatattaaaaccgaataatacattgacaacggaatatgatagagttaaaattcca
attagaagatgggggattattaatttggaattagaaataaaaaaattaccagatctatta
cttaaaagaaaggctatt
>SSO0936 (gatB-2) Glutamyl-tRNA -Gln amidotransferase, subunit B (EC: 6.3.5.-)
atgagtgagttgaattatgaagaattggggttaaaagtaggattagagattcatcaacag
cttaacactcctcataaattattctgcaactgcagtactaatttggaagaagaatataag
ctaaccttagagagatatttaagacctgcgttaagtgaattaggagaagtcgatgtcgca
gcattgtttgagtggaaaaaaggtaaaaaatacgtatatagaatacctattaccacaagt
tgtcttgtagaagctgatgaagaacctccacatgcaataaatgaagaagcattaaaaata
gccttagccattgcaatggcactaaacagtaacatagtagatgaaatctatgttatgaga
aaaattgtaatagatggttcaaacaccactggattccaaagaaccgcaataatagcactt
ggtggaatgctaaaggatgaggaagtttcaatacaaagtattgcagttgaggaggacgct
gctaggaagatagatgaagggactgatcaagtaacttattcactcgatagattagggata
ccgttaatagaaatttcaactggaccagatataaggagcccagaacaagctgaaagagtt
gccttaaagattggtcagttacttagaatgactggtaaggtaaagagaggtataggtaca
ataagacaagatctaaatatctctataaaaggcggtacaaagatagaaattaagggggtg
caaaaactagaattaatacctgatatagttagatatgaagcaataagacagtttaactta
ctgaagataaaggaagaactttatagaagaggattgaccaaagagctagttttgtccaat
tttgttgtaaaagatgtcacagaactttttaaaaatactaatagtaaaatcatcaaaaat
ggaatagaaaagggaggattagtatatggaataagagcatataagttgaagggagtattg
ggttgggaattaataccaaaaaagagaagatttggaacagaaattgcggactacgttaga
gcacttgcaggattaggtggactatttcactctgatgaattacctaattatggaataacc
gaagaggagataaacaaagttagagaagcccttaatgcgacaactgaagatgctctaatt
ctaattgttggcgaaagagagaggctagataaagctgtagaagtaataaaggacagaata
ttactggcatttgatggcattcctaaggaaactagaggagcactagatgatggaactacg
aaattcctaagaccacagccaggatcagctagaatgtatccagaaaccgatattccgccg
agaagaatagatgaaaaactacttgaggatgctaaaaaactggttccagaatcgccagag
tctaaaatgaaaagatatatcgtgctaggtttaagcgaagaacttgccaaggagataatt
agagatcccagacttgacttatttgaagagttagttaacaaatattcaccaagggttcct
ccggttgtaatagccagtacgatcacaaacacactaaagtatgttaaatcaaaaggcggt
gatatatcaaagattaatgaggaggacatagaagagttaataaaaagcatttatgagagc
agaataagtaaggattctatttcagaaatactggtagaatatactactagtaaaaacgtg
gaattaaaggatataatacgtaaatacgaggtattaccaattgaagagttagaaaagata
atagatgatataattaattctaacctagatgagataaggaaaagaaaagataaagcagtt
aacctaataatgtcaaaagtaatgagtaaagttaaaggaagagccgatgggaaaattgta
ttagaattaataaggtcaagactcaaaaatgttatagag
>SSO0938 (ansA) Asparinase (EC: 3.5.1.1)
gtgcaagaaaattataaaggaaaggcctatgatattttgaaaaatctaaatatagaggaa
ggagatcttatagaaattaagaaaggagacttaagaataagaggtatattgttaccaagt
tactctaaagatgatagaatattcgtaataaaattagataatggttataatataggaata
tctatagataatataactgagataaaaccaatcgaaaaaaaatcaagtaaagatcgggag
agtgaaagaagagaagttcataatggtgctaagagcgaaataaagataattagcacaggg
ggcacaatagtaagtagggttgaatatgaaactggtgcagtcaggcctgcattaaccact
gaagaaataatacaatttttaccagaaataaacgaaatagcaaaagtggatgctgaggta
cttttctctatattaagtgaaaacatgaaacccgaattctgggttaagatagctgaatca
gtaaagaaggcctttgatgaaggaaacactggtatagttattgcccatggtacggacact
atggcatatacagcctcagccttagccttctctctaagatcgttacaaggacctgtagta
ctagtggggtcacagagaagtagtgatagacctagtagcgattcagcaataaacctctta
tctgcagttatcacggctaaatatgcaccgtttggagaagtagtagtaaatatgcatgcc
gaatcctcagatacttacgcattagtacatagaggagtaaaggttagaaaaatgcacagc
agtagaagagatgcttttcagtcagtgaacgataaacctttagctaaagttctttggaag
gaaaggaaactagtaatgcttaacgagaagtatataagcaaaaaagacgaaacgttgctt
gacgctaaattcgataatagagtatttttgttatactattatccaggattagatagagac
ttcttagaacaaatgttaactaatactaaaataagaggtataatcatagctggtactgga
ttaggacatacttcttcagatcacatagaattattcagaaaggctactaaagatggtata
tttataggaatgacaacacagtgtctatttggaagagttaatatgaatgtatatactact
ggaagacagttactcgatgctggtgtcaccccattggaagatatgctaccagaggtagca
ttagtaaaactcatgtgggtacttgcacatgagcaagatttagaaaaaatacaaaattta
atgataacaaatctcgtgggagaaataaatcctcgtcacactttagatctcttcccaagg
tggtcatatgag
>SSO0939 Pre mRNA splicing protein
atgatgaaaatatacctaattgagcatgttattggagcagttgcttacgatgaaaatgga
aatattgtagactatattacaaatccaagagatttgggaaaaataactgaggaactatta
aataatgaaaagggtatcccattcagcgcaacagttgagttattaaagaaagttaatcca
caagaggtagtagttgagaacgaagctgaagttcctaaattacaagcattaggttatagg
gtttcatatgagccatatagcaaggtttcgagaatatttagggaatcattacctaaagtg
gcaatagatataaaatttgcaagcaatgaagaggattattataatttccttcatgaactt
tcactagaatataccagaagaaagctgaggtctgcggcacaaaagagagaccttttagct
attcaagcggttagagcaatggatgatatagataagaccataaatcttttctcagaaaga
ttaagagaatggtatagtattcacttcccagaattagataagcttattgaggatcacgag
gaatatgcaactatagtatctaggtttggtgatagggggtttttaactattgatagttta
aaggaattgggtttcaacgagcaaaggataaataggatccttgatgcagcaaagaaaagt
ataggtgcagatatttcagaagacgacttatctgcaatgaggatgattgcgaacactatt
ttagacttgtataatattaggagaaatcttaataattatctagaaggtgtaatgaaagaa
gttgctccaaatgtaacagccttagtgggtccagcattaggtgctagattattgagtata
gcagggagtttagatgaattagctaaaatgccagctagtactatccaagtattgggagcg
gaaaaggccttatttagggcgttaagaagtggcggaaggccacccaaacatggtataata
ttccagtaccctgctattcatacatcacctagatggcaaaggggtaagattgccagagct
ttagcagctaaattagcaatagctgccagagtagatgcttttagtggtagatttataggc
gatcaactaaatgaacagttaaagaagaggatagatgaaattaaagagaaatttgcgcaa
ccaccacctaaaaagccgcaacaacaaaagccacagcaaccacaaaaacagcaagcaaaa
ggtaaaaaaggtggaaagagaagaggtaaaagaaag
>SSO0940 Fibrillarin-like pre-rRNA processing protein
atgtctgaagtaattaccgtaaaacaaaccaatatggaaaatatttatgaatgtgagttt
aacgatggtagttttcgattatgtacaagaaacctagtaccgaattttaacgtttacggc
gaaaggctgatcaagtatgagggtgttgaatacagggagtggaacgcatttagaagtaaa
ttagcgggcgcaatacttaaaggtcttaagactaatccgattagaaaaggtactaaggtc
ttatatttaggtgctgcttctggaactacaataagccatgtatctgatattatagagcta
aacggcaaggcttatggagtggaattttctcctagagttgtaagagaattattactagta
gctcaaaggaggcctaatatctttccactattggctgatgcaagatttcctcagagttat
aagtcagtagtggagaacgttgacgtactttatgttgatattgcccaaccggatcagacg
gatattgcaatatacaatgccaaattcttcctcaaagtaaatggagatatgcttctagta
attaaagcgaggagtattgacgtcaccaaagaccctaaggaaatatataagaccgaagta
gagaaattagagaattctaacttcgagacgattcaaattattaatctagacccatatgat
aaagatcatgcaatagttcttagcaaatataaaggg
>SSO0941 Hypothetical protein
ttgatagataagatttttgagattggacttaaagatatattctcttcttctcccgctgag
tatgtaactattaaagatgcattagatggtaaattaaaaattagattaaataacaatttt
tatcatgaaatcaaaaaggacgaagtagaaaaactctccagtaggattccgctttacttg
tggtcactagtaaaaattccctttatatttattaagtcgtctgaaattggtgaatatttc
gtcagtggagagcaatggaacaaaaaggcaatttcaattttacttgggagagaaatatct
aatgtaatattaaatgtggatgtcgagaagctattgagggaatatacatcattaatattt
ataattcttagtcctactagaagttatacagaagaaacagaattaagtgagatg
>SSO0942 Conserved hypothetical protein
atgagcaaaaaaatcatcgatgaagttatagacatattagaggataaaaaatatacttat
acgatgattgaatatccagaacataatagaaaatctgttgacatcgttcttaactccaag
gaacccactctaattagagtttctgaagataagatcaccaaagaggaaatttctgacttg
aagaaaatagcggtatcaacgttaactgcgtcattagttgttactaatgaagaagaagag
gatatcgtttcagttaaggctgataacgtttttgcaatttcaccagaaggattcaagaaa
gtgattaacggcgagaaaattttcctttatagaactaggggaggtatattcataaagatt
aggaattacatattaaaacataagagagaggaaatgggatatagtataggagatgtggca
aaatttcttggtgtttctagaaaggctatttacgattacgagaagggggattccgacgta
tcgcttgaagttgccgagaagttaatagatttgtttggagatgatataataggcgatgta
atatgggattctataaaaagcaaaaaagaaatccttgaagagggcgtagcagagttttct
ccagagaatttcaaagcaaagttgatatataaattgaaagaaagtgggttaaacgcctta
tcattaaaattaactgcagcagatttgatagttaaggatagcgataataacagatattta
gttacaatagagaacaaggattataataagtcaatgaagaaattttatgaagctaaaaaa
ctggcgtcatacacgaaatctgaattagtaataatcataaggacttcaaagatgttaaaa
gaatgtgaagatctaggatataaaacttatgaagaaaatgatatacattctttaatagat
gaaattaaaggaagtaacggaaggcaaggt
>SSO0943 N2,N2 dimethylguanosine tRNA methyltransferase (EC: 2.1.1.32)
atgaaattaaaggaagtaacggaaggcaaggttagaatattcgtaccagatcctacagga
tatatggtagaaggaaaatttgatccatcatgggctccagtattctataatcctaaaatg
actttcaatagagatctcagcgtaattgtggttagcatattaaaacctaagataatagta
gacgcgttaagcgcaacgggcataagaggaattagatactacgttgaatcgtggaaaagc
gaacaactaattctaaatgataaaaatccaaatgccacttctttaattcaaataaatgcg
aaaaataatgggattgaaaatgctaaaatttataataaagacgcgaacgctttactctac
gaagtaaaaagtgactacatcgatatagatccttttggttctcctgcaccttttattctt
tcatccttaaacgccgcaacaagaaatggaatcgtagcatttacagcaactgacctatct
ccgcttgagggatcctcaccaacatcatgtagacgaaaatatgacgcaattaatcacaaa
ctttcctcatccaaggaacttggattaagagtacttattggcaagataattagagaagcc
gcgatattagaaaagacagtatatccgctattctctttttatgcagattattattataga
ctatttgtaagagtggagaatggtgctagaaaggcagacgataatattaataagcatctt
aaatattttggagaatgcccccgctgtggatttcagacattcgtagaggagaattgtaag
actaagtgccccgtatgtggcgagatttttagtattattggtcctttgtatattggtcct
ctttatagtatggagtttttaaaaagaataatggatttatatagtaattttaactacttg
acctcttttaatagaatacaaaagttacttaatgtaatagaaaaggaggcaagatttaaa
aatgtattctataatatcagtaagctcgcatccaaattaaaaatttcagctattcctcct
attgaatctattttagaatgtctaggtgatgcttccagaactcattttgctcctactggg
ataaggaccgataaggaatatgaagaaataacaaagtgtattaagagcttaaga
>SSO0944 Hypothetical protein
atggaatcagattcaacaagtaattatgaagcaatagtacataaaaagataaaagaaatg
ggagaaaaggggatttcacaacaggaacttgctagatccgttggtttgcctataagagaa
attagtagtattataaaaagattagtcgagaagaaactaattattaaaaaagcagtgaaa
gaaaatgggaaaaatatagtaaaactatttgctgttgataataattataatataaacatt
tatataaatcttaatggtttagatgaaattccttgcttaagttgtaaaagcttaaccaaa
tgtggaaatggaatacatgtaagtccacaaacttgcagtaaattatctggctggatcata
gaaaaagctttatct
>SSO0946 (TFB-2) Transcription initiation factor IIB (TFIIB) homolog
atgaaatgcccatattgtaaaacagataatgcaataacttatgatgtggaaaaaggaatg
tacgtttgtacaaattgtgccagcgtaatagaggatagtgcagtagatcctggtccagat
tggagagcctataacgcaaaagacagaaatgaaaaagaaagagtaggtagtccaagcact
ccaaaagtacatgactggggatttcatactataatagggtacggtagggctaaagataga
ctaaaaacattgaaaatgcaaagaatgcaaaataaaatacgtgtatcgcctaaggataaa
aagctagtcaccttactttcaattttaaatgatgagagctcaaagttagaattgccagaa
catgtcaaagagactgcatccttaataataaggaaaatggtagaaactggactaactaaa
aggattgatcagtatacgttaatagtagccgccttatactattcttgccaagtaaacaac
ataccgagacatctccaagaatttaaagttagatattccatatcttctagtgaattttgg
agcgcgttgaaaagagtccaatatgttgcaaattcaataccaggctttcgtcctaaaata
aaaccagcagaatatataccgaagatattatataaactaaatttacctccaattatagga
acaaaggcatctgaattagtagaccttatgcataagcaagggttaacaagtggtaaagga
tacttatctttgagcgcagcttccgtttacttaatatcagcattaatggatataaaaaag
acgcagaaagaagttgcagattcattagatattaccgaagtaactataaggaatagatat
aaagatatcgtggataattttgacattgtagttacatta
>SSO0947 Hypothetical protein
atgtcatccatatcagcggacacagacgaattatataagaagatatctgagctcaaagag
aatatagttagactaaagcaactcaagttagaacttattgaaaaggtcaaaaaaatgaga
gagaaaaggagggaaaaaatagccaaagtaaaagagttgacgcagcaaattaacgtagta
aggcaagagtataaaatgaaattagaggaatttaaccagcttaaagagaggagaaaaaat
ctgattgaaataattcagcaaattagaaaagatttcgaagaagttaaaaaactttcttct
aataacctaggtaatccagattcgatagagaggaaaataagggagctagaatggaaatta
caaaccagttctcttacattagaggaagagaaaaaagttatacagagaattgctgaacta
gagaagaaattacaagatgctaaaaagattatgaaaataaaggagaagagaactgaagaa
aaagccgaattactagctaaaaaggttgagctgaatacaattagggaaaggattaagaca
cttataaatgagataacagaaaagaagaatattataaagaaactagttgaagagagaaat
aaattaagagatgagataaatggtttaaacaatgaaatagaaaatatttccaagcagata
gaagagttaaatgtagaaattaaaaacaagagtaatgagctaaatgaggcccagagggca
ttaaaaagccttcaagaaaatccagtacaagtcaatactactgagttcattgagaaaaag
aagaagagtatagaggagaagcttaagcagaataagaggttatcttttgaagaattttta
atactttatggggaagtagataataaggatggtaaagacaatagtaatatacgt
>SSO0949 Conserved hypothetical protein
atggtaaagacaatagtaatatacgttgatattgatgatgatataggagatttagggttt
tctacaccaattataggagaggagaaatgtaagctaacacttgataaagcagcgtatttt
atgccgacagattctgattttaattcgatggtagtagcattcaatatttatactgatcta
aaaagaaaaggggaagacactgagatagttttcatatcggggtcaaaaaagggtggtact
gagtcacagttagaattttcaaaaaaattagacaaagtaattgaggagttatcgccagaa
tatgcggtagtagtctatgatagtccagatgatgctcgcgcgatacctataattcaatcc
agattaaagatttctgcggttcagcaagtaatcgtagagcagtataggggagtagaggag
acatatatgctccttgcaaaatatataagaaaagccgtaacggaaaagagatatgcaaga
gttttcttaggtgtacctggcataatattagcattagctggaatattagctgctctgaat
ttgtcagtttacatagaaccgacaatattaattatactaggagtcgcaatggttataaaa
ggtctcaaaatagacgatcttatagagagttggtgggagaattccacaataatggtgata
acggctacagtatctattatctctcttttaataggtgtgattaacctttatatacaactt
cagatagttaggggactaagtagtatacaagaatttgcttttataattcttcaaatttta
ccatatgcttcattttccgccataatcttgtttggtggtaaggctatctcgaagggatta
aatagagatattagggtatggcatgatataattaaaatcataaatatcgttataatttat
ttcatattatttactgttgtgaaagacattatagataatacttatattctaacttttcaa
tcattatatactctaatattggcttctatagttatcatttcaatatatattaccttaacg
gcattagaaaaatatggaattctggagaaactcataaaaagaatc
>SSO0950 Hypothetical protein
gtgtttatatcgtttgtggaatatctattaatagatgctggtggtacatctactaaagtt
ttcgtccatgacggtgaaaaaatagtaaggcagtacaaatacgaaccagcaagtgtagat
aaagtgggtccctataagtcggttctaaggctaagtaatatagtctcaatattcaataag
aaatttgatagaattgcaatatctttagccgggatcgacagcgaggttatggcaaaagag
gtaaaaggtcaattatatccgcgcttaagtaaatatgcagataaggtaattatagaacac
gacgctcatgttgtacttatgtctaatgcagataagggatgtataactattgcagggact
ggtagtatagtatatggttttgatggaagtcaaaggataataaagggcgatagaggatgg
ctagttggcgatatatgttccggattctggctaggtagagagtttttacatgagttatta
agagagtttcaagggctctccaatgatagaagtttaactcaattctctactttcaaaact
gaagaggacttagtgagattcctttataaaaactcttgtaatccagctaaaatagcccaa
ttttcagttaatttgttaaacgctataaggcaaaataacataaaggcaattagaattttg
aacaactgcatgtcagaattctctactttagtgcaaatggtatgtaaagctgtaaactct
aatgtggtatactattttggtggaatgtatgaatcgccagtttatgtatcctttttcaag
agagaactagagaagaagggaataaaaagcgttaaaagtagaagtgtaataaacggtttg
cttaggcttttagagctc
>SSO0951 (tfIID) TATA box binding protein, hypothetical
gtggcaacagttacgttagagcagagtttagatttatacgctatggaaagaagtatcccc
aacatagaatacgatccagatcaattcccgggactaatatttagattagaacagcctaag
gtaacagctttgatattcaaatctggtaaaatggtagtaacaggtgcaaaaagtacagag
gagctaataaaggctgtaaaaaggataataaaaacgcttaaaaaatatggcataaaaata
gtgggcaagcctaaaatccaaatccaaaatatagttgcatcagctaacttacatgtgaac
gttaatctagataaagctgcattcctattggaaaataacatgtacgaaccagaacaattc
ccaggactaattttcagaatggatgatcctagagttgtcctgctaattttcagcagtggt
aaaatggtaataactggagcgaagagagaagatgaagtgtctaaagcagtaaagaggata
tttgataagttagcagaattagattgcgtaaaacctatagaggaagaggaagagttagag
ctc
>SSO0952 Conserved hypothetical protein
atgcttgaactcgctaaaggaatcttaattgctgaggacttaccagcactttacgtaaaa
caagctaatagtgtagtcctatctgacgtacatataggttatgaagaagagatgtctaga
aaaggtatatatattcctagaatacagaaaaaaagattttttactataacaaatagagta
ctctcagtatttaatactaaaaaactaatagtaaacggagatttcaaacatacctttgaa
aaacttactcgacaagaaaaagaggaattaaatgaaatattgaaatatttaaaggataac
ggagtggaagttacgatagtgagaggaaatcatgataactacatatctttagttacggaa
agatttgataatgtaaaattagttgatgagttagatcttggagaaatcctcataactcat
ggacataaagtagtggaaccgagaaataatacgacttacattataggtcatgaacatccg
agaatatccataagagataagttgggtttctctaggaaattgcaatgctttctatcaatt
ccaataaaagaaagggaaaactctcaagttatagtattgcctgcaattggaatatatcaa
gcagggaatgacatatcattaatacattcaaactacatgagtaatttgataaaagaacat
accatattagaaaaagcgaaaccttatattataattgagggagaaggcatcatggagttc
ccagaattaggcttaattaaaaacgtacttatt
>SSO0953 Diphthine synthase, hypothetical (EC: 2.1.1.98)
gtgagcatcttaagtctagtaggtcttggaatctctaagaaattcataactgatagtgct
atagagacactaagtaattctgatattataatttttgatagatatacatctagatcttgt
gatataaatgtggacgtattaaggagattggtaaagggagagagagaattcattgaagcg
gataggagtttattagaaaataactcaaaggctatcatagactatttagacaagggttat
aatgtaagtatagccagtattggagatgcattaatagccacaacccatgtttcgctactt
atagaggctaaacatcgaggacatgaggtaaaagtgattccagggatttcagtacattgc
tatcttatatcaaagtctctattatcttcctataaatttggtaagtcagttacagttaca
tttccttataacgatttcatagatcctactccctataatgtgattaaggataacaaagaa
agaggtcttcataccatattatatctggatttgaaaaacgagaaagcaatgactgctaac
gaagcacttcagatcttattacgacttgaagagaggcataagaaaagtgttctttcaaaa
tctgatattataatagttggtgctagattagggtgtgatgacgagagaattattgcactt
aaagtagaagaagctacttcattcgacttcggaaatacaccacatattattataattcct
ggtaaccttcattatatggaggctgatgctataaaatggatattgaggagt
>SSO0954 Conserved hypothetical protein
atggatattgaggagttaaagaaaaggatagaaaagtacattaaaggaatggatgaacga
ttaaaggacactagtagtgccaacaataaggtagtagaattggctagattatatactgag
gacgctaaatactatttagagaaaggcgattacataaccgcattagttgatgttgtttac
gctgaaggtttattggatgcaaaggagatttatgagaacagtgaccctaaatctaatgta
tcaaaaaaggtatttgttgcaggtacctttgatatattgcatccagggcatatagaattc
ttgaaagaggcgtcaaagtatggaagagtttacgtaactgtcgcgagggactctaattca
gagagaattaaggggagaaagccgattaacgatgagcaaactaggctagaaattattaag
agtataagatatgtttttgatgcaatattaggtgatcaagaggattttctaaaaagtgtg
gaaagaataaatccggatatcattttcctagggccagatcagaaagttgacgaggccaag
cttcttgaggaattgaaaaaacgaggcttaagtcctcaaataatcagattaaatgagaga
ataaggaaatggtctcactcaagcacaacagatataataaatgaaattaaaaagaggtat
tgtaacttagaacaacgt
>SSO0955 Hypothetical protein
ttggaagatgataagttaatagttagaataatatctaaagaaggagagattataagattg
acagaagaaggagaaagatttttgagttcatgtttaagtagcttaaaagatgccatattg
tcgcttcatagtattgaaataaaggggaatattgtatctggacttggagaaggtaaaata
tttctatcaatggagtactacaaaagccaaataaataaaataatggggtttgatccgttt
ccaggtactctaaatattgtaatatacgataaagcatccctagaaaacagattactctta
gattcatcaccttctctaatggtccctgaatataaacaaaaggatagagtattaggtgca
gttaaattatatccagccgcaattaataaattaacaccagccgcagtagttattccttta
agaactacacatccaaagagcgtaatagagataatctctccattccatctgagagaaaaa
ttgaatttaaaagacggcgatgaggtaacaatagaagtttatgtt
>SSO0956 Conserved hypothetical protein
atgtgcgatagaatgtacaatatgcaaagtaatttaaggatcgatacagtaagtgagata
ttcaaggagttacaaaaagaaaagtaccatatcattggaactcatagtgcatataagaag
tgtcattggactcattctgcccttgtagccaacagatcttgttataagggaaaattctat
ggaattgagagccatagatgtgtacagatgactccaactgcggcttggtgctggtttaga
tgcgtacattgttggagattagaaccagaggatgttggactagagtgggacgatacgaaa
atgcccgcatatgatgatccagaatatattgtcgaaaggagtatagaagaacataggaag
gccgtttctggatatttaggaagaaatgatgttagtattcaaaaagtaaaagatgcgatg
aaacccgcacatgtcgcaataagtttaactggagaacccacactttatgaaaaactgggt
gatctcatcaaggagtatcacaaaagaggtatgacaacctttcttgtaacaagtggcgta
aggccagacatattggcaagcttagaagaagagcctactcagttatttgtatctctacaa
gctccgaatgagataaaacataagatgattaacagaccagtagtagctaattcttggcaa
ctagttatgaagaccctagagatcttacctagttttagttctccaacggtaataagattt
acaatgataaaggggtacaatatgagtgaacaagatgcaaaagaatttgcgaagttaatg
gaaattgccatgcctacatatatagagattaaagcttacatgcacgtgggaccatcgacc
tatagattaagtagagacgctatgccaaaacataaagagattagagaatttgctaaaatc
ttaggacaatatactggatataaaatcttatcagaacacgtgcccagtagaatagttcta
ttaagtaaattggataagccgattaagattgggaatgcgtggaatgaaaaatggaattgg
tctaccattgatatggaggacgatatgagtggagaatataaggaagcagaacaaggttgt
acagagggatcaact
>SSO0957 (gatA-2) Glutamyl-tRNA amidotransferase, subunit A (EC: 6.3.5.-)
gtgaatagaattatgatagtagacttagtcaacgatttgagaaataagaacttagaagct
gaagagtacatcgagagaacgtatgagaaaataggcaaatatgacaaatatattaatgcg
tttataactatcagaagtaaggaagaggtattaaaggaagtaaaagaaagcattaacaaa
gggggtaaattagcaggagtcctaattgcaattaaggataacatctcgactgagggaatt
agaactacttgtgcgtcaaagatgttagaagattacatacctccatacgatgctacagtg
atagaaaaattaaagaaggaaggggcagtaatcattggaaaaaccaacatggacgaattc
gctatgggttcaactacagaaactagttatttcggtcctactagaaatccttgggactta
gaaagaactcctgggggatcatctggaggcagcggagcagctctagcggctggttatgtc
gaattggcgttaggtagtgacactggaggttccataagagcacctgcagcatataatgcc
atttttggtttaaagccgtcttatggtacagtgagtagatttggtctagtagcttacgca
aatagtttagaacaaataggaccaatggctagaaatgccgaagacttaggattgcttttc
tcaataattgctggaccagatgagagggacgctactacaattaacttaaatctaaatttt
gagttaaaggaacgaagcgtaaaaaacgttaggataggtgttcttagtgacattttagaa
atgtcggaaaaaccagtatccggtgtgataaaagatgttgtaaataaactatctagcgaa
ggggctttaattgaagatactaaactaggtaatgcggaatacgcactaccagcatattac
ataattgcaatgtctgaagcaagctctaatttggcaagatatgatggagttaggtatgga
tacagtaagtatatggaagggaattggcgtgaagtttatgctaaaaatagaggagaagcg
tttggtatggaggtaaagaggaggattcttcttggcagttttatcttaagtgctggatat
tatgaggaattttacctcaaggcattaaaggttagaaatttaatcaagaagaacttggac
gaattattcaaaaagtatgatattttgctctctcctacaatgcctatactaccgcctaag
ataggtgaggtaattaatgatccggttagaatgtacgcaatggatctaaataccgtgata
gctaacttagctgcaataccagcactatcaatgccggtaggattttacagtgaccttcca
ataggattacagttaatgggtaaatatttgtcagatatttatttaattaacatatcatcc
tttatagagagaaatataacaaaattgtacaatttaaccgcatcagttaagatc
>SSO0959 DNA repair protein rad25
atgtcctcgaggactttctatatcaaacaatggttagatgaggatgacttcaagaggtta
ctattattctcgagatatttaggaagagatagtagtggatctcagtttatgatagatttg
gaaagagctaaaagaaatggagtaaaaccgaatgagatagtagaaatcttagaggattat
gacgtgcgtctttctcaagaagatattgcaacattaagggagaaactccttgattgttcc
tttgatatagaggctggtaaaataatcatgaaaccatatacttatcttgctgacgttcta
gagaaaattaatggtaaaaatgagaattcagagcacagattcaaaatcagatatgataaa
caaaatagaagatttatagtgcgtccaatggattattttaatctattgcaaaaattgaga
gaaaatggattagaggtcaaggaattaaacctttcattcaaggagtttgaattcgaattt
aatgggcaattaagggaatatcaaagagaagctatagaaaattggattaagaatggaaac
aagggggttatagcactaccgacaggcgctggaaagacagtagttggaataaaaggtata
gatataatcagaaagcccactctcattgtaacctttaccaaagagcagatgttacaatgg
aaagaagctatactaaagtttacctcaaaaagacctgacattggtttatattactcagaa
gaaaagagaataagaccaataaccataactacctatcatacagcatatagacatcttcca
caactatttgataaattttacctgctaatagttgatgaagttcatcacctacctgcagat
aagtttaaattaatagcagaaggtttaatagctccttataggatgggtctttcagcgact
cctcatagagaagataataaacacaatgagttatttagcctaatagggggaataatatat
tataagtcagttaccgaactagccaagttaggttatctcgcctcctatgagataattcag
aaaaaagtaaggctaaccttagaagagaggaagcgatacaatgagctattgaataggttt
aaggcattatctaagggcaggaaggtaagtgaattgatagagttagtaaaaaaaggtgat
gaaagtgctattgaagccatgagagtttataatgaaatgagaaaaatagtgaacttcgct
tcagagaaaatgaaggctttagacgaaatacttaagtctgaaaagggaaagattctcata
tttacacagtatattgatcaagctgaagaaattgctaagagatacaattctttactttta
accggcaagatgtctaaagaggaaaggaagagagttttagtgacgtttaaaactatgaat
gcaggggttcttgttttaaccactgttggagatgagggaatagacattccggatgctaat
gtagggattattgtgactgggaccagttctagaaggcaatttattcaaagattaggtagg
attatgagaccctataatggcaagcaagcaaaactttatgaaatagttgttagtggtact
ccagaggaatatcaagcaaaaaagagaaaagaaactgatattctctcatttgagggtatg
tcttattcatcctccgaaaatatcgacagagat
>SSO0960 Hypothetical protein
ttgcttaatatgccttacgtagacgttagcagtaaaatatgcagacctaatgaagcaagg
gaaataaaagaaggagacataatattagtatatccagctactttgaacgtaaatggaaaa
atagttactttccctccactctcattagttagcgaccagtgcacacacgagattaaaaag
ttgagctggatagaaggtataatactaactcgagaagtttttcataacactgctttcctt
aagtgtgaaaactatattgaaggagagatagaaatattagaacctacccttcttacagcg
ttcacttttaaacaagctgttggacgcaaaataaagggatatataagtaaaggtattaaa
ggtgtaccgctattgaaagtaaatgaccaaccaatagtaagcatagataaaggcagagta
aatgttggactctgctttttagataatagagatgttctagtaagattattcggatattcc
atattttactatattacctcaacattatcgatc
>SSO0961 Conserved hypothetical protein
atgagtcagcctacagttaaagttgaatttgaggggaaagcgaaaataggggaaatgatg
ggcaattttaaagctatacaattaaagccagaagatttctccagtccattagcgttacaa
atggctctctccagaatatactctgagttgatgaacatgatgaatcaaagacaagaactc
cactatgttgctgatgtaaaatttacagattctatgggaaatccaataagcgtgggagta
gattttggagacaaaataccaccattaagcaagaaagaggttaaagtaaagataactatt
gaattctacgacgaagag
>SSO0962 DNA binding protein SSO10b
gtggaaaagatgagcagcggaaccccaactccaagtaatgtagtcttaataggaaagaaa
ccagtaatgaactatgttttagcagcattaactctattaaaccaaggagtaagcgaaata
gtaatcaaagctagaggaagagctattagcaaagccgtagatactgtagaaatagtaagg
aacagattcttaccagacaagatagagattaaagaaattagagtagggagccaagtagta
acgagccaagacggaaggcaatcgagagtttcaacaatagagattgccataaggaaaaag
>SSO0963 (topR-2) Reverse gyrase (EC: 5.99.1.3)
atgattaatgtaatgtataaaaattcctgccctaactgtggtggggacatttctggtgac
agattgctgaatggtctgccatgtgaggcttgtttaccttatattaacggaatagatgat
gtagaccatatttcaaaggtaaaaacgttatacaatattttacttaataacgataaaatt
aaaaattattggaatttatattataacatcactacatttgaaactgtctttaaatatttt
agagataaaactggatatgaaccttggtctctccagaaactatggttaagaaggcttgcg
agtaatcagagtttcactatgtcagctccaactggattggggaagacaaccacattgatg
acctattctgtctttattggccaagatgtagtatatatcgttcccacaaagtccttaatg
gaacaagtatgtaaaagattagagaaattaggtgctcaagtatcttgtggtaaaattgat
caaaagaaagtaagcgtaataacaataagttacctaaataagaacgcggactcgatagta
agccttaagccaaactttgtcgtaatagatgatgcagatgccgtaataaagagcggtaaa
acaactgatagacttgttagcttattggggattccgaaggacgtttatgagagtgcgatt
caactaattaggctaaggaataaatactatttctctaacgaatacacggaagaagttaaa
gaaaaaattagagaattggagcttaagatagcagaatttaaggataaaatttcacagcta
gttatagctagtgctacaatacgacctaaaggcattaagcaaaaagctttaaggttatta
acaggttttgaaccttcttctattcagttatatgctaggaatataattgatgcttatact
gaaaatctagatctttcaatagtcaaggaattaggaagtggtgggttaattctagtttcg
aaagaatatggtaggtccaaattaaatgaaataaagaaatacgttgaggacttaggtttt
aacgctaaattagcaataagtggaaggaaattcctcgacgatttctctcaaggtaaagta
gatattctagtaggttctgcgtcttattatggtgttgccgttagaggaattgatgaacct
aaaagattaaaatacgtcatatattatggagtacctaaaataagagctaagctttttgac
gctttatctaatccatttacattactcagagtaggtaaattaattggaatcgatttttca
aagttacagaataagattttaattctgaatccttctgaagttcaattattgaagttttcc
ataataaaaggagaaagtataaactaccataagttagaacaattgaggcaagaattgcta
tattatatgtcattagttaaagataagttgaaggagaaagtcgaggatactttaatttca
gatagttttgtaattaccaagcaaaatggaaattattatatcgtctatcccgatatgata
acatatttgcaaggctctgggagggcaagcagactttacaatggtggattgactcttgga
ttttcaataattctagtagatgatagacacatctttgaaatattggagaagaaaatgcaa
aaattgtttcctaacactacctttacttcattatctaatacaaatttatctgaaataaaa
attaaactggaagactctagaaaagaagaagggaatagggtccattttaacatatcaact
ggtttacttatagtagagtctccaacaaaagcaaagactatagctaaaatgtttagcaga
ccctcggttaggataagaaataaagtaccagtatacgaaaccattatagtagatggtaat
caaatatacgtgttagatatagtagcttcaaaaggccatatcgtggatctaaccttagaa
gatataggatattatgggataaaagtagaagatgatggaactataaagccatattacgac
ttaataaagaaatgcctcgactgtaataagatattttctagtgcttcagataaatgtcca
tactgtggttctgcaaatcttcaatcagctcaaactaccattaacttactcagggagtta
gcgttatcagtagataaagtgtttatagcttctgacccagatactgaaggggagaagata
gcatatgatctggcttcattcttgtctccatataattccaacgtgtatagagtagtatat
cacgaaattactaagaaggcaatattagaggcattgaggaatcccaaaaagattaataca
aatctagtaatgagtcagatagttagaaggatagaagatagatggattggcttcacgtta
agtaacttactaaaaacgaagtttaatggacataatcatggtgcgggtagggtacaaact
ccagttttaggttggatagtgaataaaacgataaagtataagagtgcaatgggtcacgtg
gtttatattgacatcgcgggatactccattaaaaaatattttagtgaaaaaaggaaggtg
gaagagtatataaataacttacaagtagctagaattgaaaaaatctctgaagagaaaata
ctattatctccattacctccctttactacagacaccttacttattgaggctaacatgaaa
tataaactaccagctaatcttgtaatgaagattgctcaagatctatttgaggctggccta
ataacatatcatagaactgatagtactcatatttcctctgtaggtatagaaatagcaaag
gagtatcttcaaaagcaagcgctcattaaagagtttgttcctagatcatgggaatcatcg
gaggaaggtgctcatgaggcaataagaccaactagagctatagacgttaacgagttaatt
caagaaatagaggagaatccttataagtattcgataaggtttagtaaattacacttatta
atttacgacttaatattcaagcgatttatagctagtcagatgtcccatgcagttggtaca
aaaagtaggtatttgataaagttaggcaaggacgataatgtcgatgtagaattgttaagt
aatgctgaaggcggatttattaaggtatatccagttaaggtgtataatttacctgtaggt
gagattcaacctaaagttaatattactaaggggtcaagtgaacaattgctaagttactct
gatgtgatatcattaatgaaatctaagggaattggaaggcctagtacatatgcaaaaact
atagaaaatctaatgaagcatggatatatagttagcagtaaaagaaagtcatatctaata
gcaacaaacagaggtatctcagtatatcaatttctaagctccaaattctacgatctagtt
tccgaaagtaccacatctagattaatgacaaaattggacgacattgcactaagcaagttg
aatgcttctacagtgttattagaaatattcagcgagatatctaccttagtaaaccctctt
aagtctgagcaaaatgta
>SSO0965 ATP-dependent helicase
atgctagatcatcttgaccagcgattaagaaagctgatagaggaaaaaaattggatgaag
ttaactagagtacaagaaatgtcgtttgaaccaataagtaatggttacaatacgctagtc
attgcacctactggttatggaaagactgaagctgcgttgcttccgatcttaaatagaatg
ttgaaagaagacgttaaacctgtcactgtaatttatattacgcccttgaaagcactaatt
aatgaccttctttataggatagactggtgggcctccagactaggttttttagtaaataga
aaacacggagaagttcctcaaaaggaaaagaacttaagattaaagagaataccccatata
attgtcactacgccagagggattagaaatagatctagactgggcaagtagatttagggaa
cattataaaaatgtcaaatgggtcgtagttgacgagattcacgaattaataaactcgaag
cgaggaactcagttatcaatattacttgaaagattaaaatactttattggttacgatttt
caacgaattggattatcagctacagtgagtgatgaggacaaagtagctcaattcctcttc
ggatcttccgaaagaaagatgaaaataataagattaaatgatacgaggaattttgaaata
aaaataaataaacttggtaatgataatagttttgctttatggaagagtgcagcagaaaaa
ataaatcaactaatagaaaaaccaacactagtctttacaaattctaggttttccacagaa
agacttcatgaagagttagaaaaattagggaataaagaaatctacgtgcatcattcgtca
gtttctagagatcttaagaacttagctgaaggagaattaagaaatggtaatgcgaaggca
gtagtatgcactaagacactagaactaggaattcacgtaggagatataaagaaagtaata
atgctaagaccgccaacttcagtatcctcatttttacagagattaggtagaagtggacat
atagttcatggagttcctaagggagaaataatctgcttctatgatttcgacgtattagag
tctttagcgctgtatctctcagcgaaagatggtaaaatggaaaaacctttcatagatgat
ggattagatgttgttgctagagaaatagtaggcatgatactgcaaaatcagaagatgagt
atagaagagatttttaatataattcggggtacctatatttataggaatctagaattatca
aaactattagatttagttaattacttggtcaagaataatataataaaaatagaggaaaac
tacttgaaactaggtcaagggttctttaagatatggagatttaatagagatgctaaaaac
agctggggaaaggacttctcagaattcttctcattgatcaacaacgacgaaaccttttcc
ttaaaacataatggtataaccgtaggtgagatagatgcagtttacgtatataagcatgtg
agagcaaatgatataataagaataagcggaaagttctggaaagtattacgtataaatatg
cataaaaatacgatagatgttactccagcaaatgaaggtgaaggtgagatacctatatgg
aaaggagaaaatatgtccaaatctccactaatagtgaattatattagaaagattatggaa
aatttcaatgaatattatcttacaatgaatgagattatggacaaaaactcaaaggaaagc
ataatcaagatattcgagaactatagaaagttaggactgaaaataccctctagagatgtt
atactggtagaaaacaaggaagatgaatggctttacactgtagttattgatgagaggatt
tcaaatactttatctcatatattactttatttagttactaaaaagtatacgttaaacgct
tctagtagaagttcaatatatggtttttcgataaagggcactccagtagatttattcaaa
gacattatcaatatgaatgatagaaaaatcataaaaattatattaagatctatattaaga
tcacctctatacatagcgacacttaaggagatccaaccaagttttggtaaaatatcaaaa
attaacacaaaagaggataaattcttgataaaagaagcgctaagacagaccataaaaaga
tactttaccataaagaaaactctagaatttatcagaagagttagggaaggtaaaataaaa
atagtgtatactgagaacgcagggtcgttgagagaagcgatattcgctcatgcacagata
aggccttggctctctgatctaaatttaacaatatatcaagcgctaaaaggtggtgcgtat
acagttaatgagctatcggagattttaggaatctcagctaaaagtcttgaaaataagtta
aaacagcttagaagaaataataataaatataaagtaacatcatttatagatgttgatagt
agggaaactagatggtgcttgtacgaagattttattgacattgttaaatctgaagaatac
tattcctccttctcgccattaaataataatgagatctttgcagtcgaccttaagtcagga
gataatcaagtagaaatcttgttgaaaccatacgatttaattaataacccagaagagatc
ttaaggaagattccattcaataatatagaggaggctaaggttagggaagctatagatact
tcctatcaatttctacaaaagtattatcatgtaggtaaagacattatagtatacttattg
ctcaatgctattgcttatctacaaagtttaaaatactct
>SSO0966 Conserved hypothetical protein
atgcagattaacattactagagttagcacatacgagtggcgtattgataaaggcgctcaa
gagtgtatgaaagttcccgttacaatatttgcagatgacgttctaattgaaaaaatgaaa
caagatatgacattaagacaagcaactaacgtagcttgtttacccggtgtccaagagtca
atttacgttttaccagatggtcatcaaggttacggttttcctataggcggtatagcagct
actgcgatcgaggaaggaggagtggtaagtcctggaggtataggatatgacataaattgt
ggtgtcagattactcagaactaatttagactataaagatgtaaagccaaaattagctcag
ttggttgaggagctgcatagaaacgtgccgagcggtgtaggaagtgagggtaaagtaaaa
ttgacatatcagcaattagatcaagtattagcggaaggagttgcgtgggcggttgataag
ggctttggatggaaagaagacatgaatcacatggaacaacgtggtagctgggagctagcc
gatccttcaaaagtaagtccgatagcaaaacaaagaggtgcctctcagttaggaacttta
ggagctggtaatcatttcttggaaattcaagttgttgataagatatttgatccccaaatt
gctaaagcaataggggtagatcacgaaggtcaagtaatggttatggttcatacgggttca
agaggtttaggtcatcaagtagctagtgattatttacagataatggaaagagcaatgaag
aagtataacattcaattgccagatagagaactagctgcagttccctttgagagtagagag
ggtcaggattactttcatgcaatggcatctggagctaattttgcgtggacgaatagacaa
ttgattacgcattggacgagagagagtttcggtagagtatttggtgtcgacccagaaaaa
ttagatcttagcatagtttatgatgtagctcataatatagctaaaattgaggagtatgta
attggtggagaaaggaagaaggtattagtacataggaaaggtgctactagggctttcccg
cctggtagtccggagattcccgctgatcatagaaatattggccagattgttttaatccca
ggtagtatgggcactgctagttatgttatggctggaataccagaaggtagaaggacatgg
tttactgcgcctcatggtgctggtaggtggatgtctagggaagctgcagtgagaaattac
cctgctaacgtagtagttgaaactttagctgaaaagggtatagtagtaagggctgctact
agaagggtagtagctgaagaagcaccgggagcctacaaagatgttgatagggtagctaaa
gttgctcatgaagttaaaattgctaaattagttatgcgattaagacccataggggttacc
aaagga
>SSO0967 Deoxyhypusine synthase (EC: 1.1.1.249)
atgataaatagagaggacttgttaaaaaacccagttgaagatataacattgagtgaccta
aagaagtataacgatatagttagtgtattcgataagatatacggttttagcagtgagggt
atagtgaatggttctaaaatactaaaagaaatgataaaaaacgcagatttaaggtttcta
tcgttcactgcaaatttagtttctacgggattaaggggtttgtttgcagatcttatcaaa
aagggatattttaacatagtagtaaccactgggggcacaatagaccatgatttggctaga
agctttggtggggtctattacaaaggttctttcgatattgatgatacaatgttaaaagat
ttggagattcacagattaggaaatgttttagttccctttgaatcctacggtaaagtaata
gaagatgttgtaaggaaatttttgccagaaataactaaggacagaaaggaaatatcagca
tatgaattgttatgggaatttggaaagagaataactgattctaattcgattctcagagca
gcttatgacaaaaatgttccaataatagtacctggaatattagatggcagttttgggaca
aatctttttatacaatctcagtttttgaactttaggattaatctatttgaggatatgcga
ctaattaaagacttgatcttttcttctaaaaagagtggtgcattaataataggagggggt
ataagtaaacaccatacaatatggtggaatcaattcaaagacggtttaaattacgctata
tatattactactgcccaagaatatgacggtagtttaagtggagcaaagcctagggaagca
atctcatggaacaagattagaccagatgctaaacatgtaaccatctatggagatgcgaca
ataatagttcctattttggccgcgtctttattaagc
>SSO0968 (top6B) DNA topoisomerase VI subunit B (EC: 5.99.1.3)
atgtctgctaaagaaaagtttgcaagcttatccccagcagaattctttaaaaggaatccg
gagcttgccggattccctaatccagctagggctctttatcaaactgttagagaattaata
gaaaactcgttggacgcaactgatgttcatgggatactgcctaatattaagattacgatt
gacttaattgatgaatctaggcaaatatataaagttaatgtagttgataatggaataggc
atccccccacaagaggttcccaatgcgtttggtagagtattatacagttcaaaatacgtg
aataggcaaactaggggtatgtatggtctgggtgtaaaagctgctgttctctatagtcaa
atgcatcaagataagcctatagaaatagagacttcaccagtaaattctaaaagattatat
acttttaaattgaaaattgatataaataagaacgagccaataattgtagaaaggggatct
gttgaaaacaatacaggttttcatgggacgtcagtagcaatatctataccgggggactgg
cccaaagctaaatcaagaatttatgaatatatcaaaaggacttacattattaccccatat
gcagaatttatctttaaggaccctgaaggaaatgtaacatattatccgagactaacaaat
aagattcctaagccaccacaagaggttaagcctcatccttatggagtagatagagaagaa
atcaaaataatgataaataatctaaagagagattatactataaaggaatttttaatgagt
gaattccaaagtataggagatactactgcagataagattttagaattagttggattaagg
cccaataagaaggttaagaatttaacagaagaggaaatcactaggctagttgagactttt
aagaaatatgaggattttagatctccttcagcagactcactttctgtaataggggaagat
ttgattgaattaggtttaaaaaagatctttaatccggattttacagcatccataaccagg
aaacctaaggcttatcaaggacacccatttatagtggaagccggtatcgcattcggtggt
agcatacccgttggggaagagcccatagttttaagatacgctaataagattccgttaatt
tatgacgagaaatcggatgtcatatggaaggttgttgaagagttagattggaaaaggtat
ggtattgagtcagatcagtatcaaatggtagtgatggttcatctgtgcagtactaagata
ccttataagagtgctggtaaggaaagcatcgctgaagtagaagatatagagaaggaaata
aagaacgcgctgatggaggttgcaagaaaactgaaattgtatttaagtgagaagagaaag
gagcaagaggctaagaagaaattactcgcatatttaaaatatgtaccagaagtcagtagg
tctttggcaatctttttagcatcgggtaataaagagttagtgccaaaatatcaaggtgag
attgtggaaggtttatttaaacttatttctaagaaattagatttgattaatattgaagag
tatagaaaggtatataaggtggatagtgaa
>SSO0969 (top6A) DNA topoisomerase VI subunit A (EC: 5.99.1.3)
atgagttctgaatttatatcaaaggttgataaagaagcgagaaggaaagctgctagtata
ttgcgcgataagttccttaatttagttgaacaacttaagaaaggcgaaccattagtaatg
gaaatcccaatgagaactttatctaatgcgatctatgatgaaaagagaaagctactactc
ttgggagaaaagaaacttaaaaggaattttctagatatgaacgaagcaaaacgatttatg
cagaccgtattgatggcatcaataatttatgacgcgctagttagcgatgagtacccaact
atacgtgatctttactacagaggaaagcactcacttttgttaaagtcaattgatggcaat
aagatagtgtctgaagagaatacatgggatgaacaaaaggagtcagatagtgttatagtt
gatatcgaagtatttacgtctctccttagagaagaaatgctgattctcagtaaggaaaag
ggtaaagtagtaggtaatttaaggataaggagcggaaatgatacaatagatctgagtaaa
actggtcatggagcctacgcgattgaacctactcccgatttgatagatttcattgatgtt
gatgcagaatttgtactagtagtggagaaagatgcagtattccaacagttgcatagagct
ggtttttggaaacagtataagtccattttaataactagtgcgggtcaaccagatagggca
actaggagatttgtcagaagacttaatgaggagctaaaattgccagtttatatcttaact
gatgctgatccctatggatggtatatattcagcgtattcagaataggctcaatatcttta
tcttacgagagtgagaggctagctactccagacgccaaatttttgggcgtatcaatgagt
gatatcttcggtaattccagaaagaaaccctatttaagtgaagccgagagaaagaattat
ataattaaggccaaagaggcagatataaagagagctgaggaaattaaaaactatgagtgg
tttaagactaaagcatgggaagaagagataaacactttcctacataggaaagctaaattg
gaaatagaagctatggcaagcaagggtcttaagtttctcgctttccagtacattccagag
aagataactaataaggattacattgcc
>SSO0970 (eiF5A) Initiation factor 5A, hypothetical
atgagcataacgtacacgaccgtcggtgagctcaaggtaggtagttatgtagtaatagat
ggagagccttgtagggttgtagaagtaactaaggctaaaacaggtaagcatggaagtgca
aaagctaacgtggtagctattggggtttttagtggagcaaaaaagacactaatggctcca
gtagatcagcaagttgaagttcctattatagaaaagcatatcggtcaaataattgcagat
atgggtaataaaatacaagtaatggatttagaaagttatgagaccttcgagatcgagaaa
ccaacagaagatgagctagcctccaagataaaacctaatgcggaattagagtactgggaa
ataatgggaaggagaaaaatagttagggttaag
>SSO0971 (srp54) Signal recognition particle protein subunit SRP54
atgttagaaaatataagagatgcagtaaggaagtttcttacaggatctacaccctacgag
aaagcagtagatgagtttataaaagatcttcagaagtctcttatttcatccgatgtgaat
gtaaagctggttttttccttaacagcaaagattaaagaaaggctaaataaggaaaaaccc
ccatctgtgctagaaaggaaagaatggttcatttctatagtttatgatgagctttctaaa
ttatttggtggagataaggagcctaatgttaatcccaccaagctaccttttataataatg
ctagttggtgttcagggaagcggtaaaacgaccactgccggaaaattagcgtatttctac
aaaaaaagaggttataaggtaggtttagttgcagccgacgtttataggcctgcagcttac
gatcaattgttacagctaggtaatcaaattggtgtacaagtatatggagaaccaaataat
cagaaccctattgagatagctaaaaaaggagttgatatatttgtaaagaacaaaatggat
ataatcatagttgatactgcaggaaggcatggatatggagaggagactaagcttctagag
gaaatgaaagaaatgtatgatgtattaaagcctgatgatgtaatcttggtcatagatgcg
tccattggacaaaaagcttatgatttagcatctagattccatcaagcaagtccaattggc
tctgtaataataacaaagatggatggtacagcaaagggaggtggggcattatcagcagta
gttgctactggagctacgataaagtttataggtactggagaaaaaatagacgaactagaa
acatttaatgctaagagatttgtttctagaatattaggaatgggagatatagaatcaatc
ttggagaaagttaagggattagaagagtatgacaaaattcaaaagaaaatggaagacgtt
atggaaggtaaagggaagctaacacttagagacgtttatgcgcaaatcatagccttgagg
aaaatgggtcccctttctaaagtactgcaacatattcctggtttaggaattatgcttcct
actcctagtgaagatcaattgaaaataggagaggaaaaaattaggagatggttagcagcc
ttaaattctatgacatataaggaactggaaaatcctaatataattgataagtcgagaatg
agaagaatagctgaaggatcagggttagaggttgaagaagtaagagaacttttagagtgg
tataataacatgaataggcttttgaaaatggtaaaaagaaggaggggcaatattgataaa
ctcttcggagggaaaatcgga
>SSO0972 Conserved hypothetical protein
ttgataaactcttcggagggaaaatcggataataaaataattgagaaagcgacacaaata
ttatcaaaatatcccttgtgtgatagctgtctaggaagatgttttgcaagattaggatat
ggattagagaataaagaaaggggtagggctatcaagatttcgttaatgttaatcctggat
gaaaagataaaaaatcatgaaataggtgaccttagctcaattaaaagaataatggagaat
ctcggaccgatagctgaaaagtggtataaactctatttctcttcagaatttcatagccac
ccttgctatttatgccaaaataaaattgaagatataaaggaagatttctccgataaggcg
ttcaagttgttatctggattaggtgttaaaagttatgtacttggtgttgaactagatgag
gaaactaagaagaaggagagtaaaattattgaagaatttactctaatgtactacgagagt
ataaaacacgaaataaaaagggaagtaggtaaaacattgtcgaaaagaggatatccccca
aatatggacaaccctgaagtagagatagtttataggctttctgatctgcaagtgtttatt
atatctaaaaatataagaaccttttacgtttataatcgtctaaatagaaacctacctata
tcctcttggttctctaaacaaggaaatgaaggactgaatactttactccagagaaagatc
gttttcgcgttttctgaacccacaacagtaaggatcctcgcagattaccctattgttata
gaaaatgagggaagggataagatagatgtaggaggatattacattttcaaagtgatgact
gtaggaaaaaaggagttacaagcgatatcggctgctaaaccaactatgaggaaatataga
gttacagtttattctacaagtagtcttagtgacgctataagggtatacggaaatatatat
gatctctacatagacgctaaatcatttagtgagcttaatgagaaattaagtaaattaaag
tctcaatacgaaattatagtactatctgttgatctaattgacgttaaggggagaatcaaa
gatataattgaaaattatctaaaatctttt
>SSO0974 3-hydroxyisobutyrate dehydrogenase (EC: 1.1.1.31)
atgaagataggtcttataggcctaggtataatgggatatagaatagcagccaatctagct
aaggctaataaacttaatttagtgtatgataggactcaggaaaaaattgaaagtttcgtt
aaggaatataaggttaacggtgtacaaaatactaaagatcttgtagaatcatcagatgtc
ataataactatgttggctgatgactacgcagtgaagtctgtggttgaaccattaatacca
ttgatgaaaggcaaaattttaattgatatgagcactataagtccgacattaagtattagc
ttagccaagaggatagaaagcaatggcggtacaatgtttgatgctcctgtaataggaact
tcagtatttgttgagcaaaagaaattggttgtattagtaggcggacctaaggataagttt
gacatagttaatgatatagctaaggaaacagcatcgttagtagtatatatgggccctaat
ggtatgggactttattccaagctagtaaataacttgcttttagcctcttatgtcgcagct
atagctgaagcctataatttcggaataagagctggattagagcctcaacaagttgttaat
atattaactacattaagtagtgctaggtctccaactactgaattaaaagcacctaaatta
ttgaaagaggactattcaactcagtttgcaacaaaacacatgaggaaagatttagaaatt
attatgagggaagctcagaatttaaagataattacaccggtttcatcattagtattagaa
ctgtataaaatggcagaagcattaggatattctgaggccgatttcatctcagttgtagaa
gtcttcaagaaactctcacctaaaacc
>SSO0975 (fabG-1) 3-oxoacyl-(acyl carrier protein) reductase (EC: 1.1.1.100)
atgaacatcaatatttctggtaaaagagtcctcgttacagcatccacagaaggcattggt
agggggattgcagaggcttttttaagagaaggatgcaacgttgtaatatcttctaggaat
aaagataaaatagaaaaagctattttagaaatgagaaaaataggaccatcagtatggggc
tttccagcagatctaactgattttaagtctctagaggagttagttggctacgctttaaag
atcatgaacggaatcgacattttggttgtaaactctggaaatcctcctaaagagccttcc
tatttttttgagaacactatggaggattgggaatatgctactaaactgtatctattaagt
gcaataaaacttacaaatctagtatatcaatacatgaaggctcaaagatggggtagaata
ttcttcttatcctcatggacaatcaaagagcctcaacgaatattctcgttagcagatatt
acaagagcaccattaattcagatggcaaaactacttagcaaagaattgggggaatacaac
gtaaacgttaacgtaatcttaatgggtagttttgaaactgaaggagctaagagatcctta
aaaaaatatgcagaaaaagttggtcaaccattagatgttatttggaagagggaggtaatt
tctcaaattcctattggaaggactggggacataaagaatgagttaggttctcttttggta
tttttatcatcagactacgcaggatatattaatgggacatcaattctaatagatggtgga
atgtcaagagcgatt
>SSO0976 (pyrH) Uridylate kinase (EC: 2.7.4.-)
gtgatgaacattattttaaagataagtggtaagttttttgatgaagataatgtagataat
ttaatagtgttaagacagagtatcaaagagctcgctgataacggtttcagagtaggtatt
gtaacaggtggaggttctactgctagaaggtatataaagctagcaagagaaatcggaata
ggtgaagcctatttagatcttttaggtatatgggcgtcaagacttaacgcctatttagtg
atgttttctttgcaagatttagcatatatgcacgttcctcaaagtttagaagaatttata
caagattggtctcatggaaaggtagtagttactggtggatttcagcctggccaatcaact
gctgctgtagctgcgttagttgctgaggcatcctcttcaaaaaccttagttgttgcgact
aatgtggatggtgtctacgagaaagatccacggatatatgcagatgtaaaactcatacct
catttaaccactcaagacttacggaaaattttagagggttcccaatctgtccaagctggt
acatatgaattattagatcctctagcaataaagatagttgaacgttcaaagataagggtt
atagtaatgaattatagaaaacttaataggataattgacatattaaaaggagaggaggtt
tcatcaataatagagccagtg
>SSO0977 (leuA-2) 2-isopropylmalate synthase (EC: 4.1.3.-)
atgataaaagtaggtattttagattcgacgttaagagaaggagaacaaactcctggagta
atatttactgtagaccaaagagtagagatagctaaggctctatccgatttaggagtatct
atgatagaagccggtcatccggctgtatctccagatatttacgaagggataaaaagaata
gtcaaattgaaaaaagagggtattataacatcagaaattgtaggacacagtagagccgta
aaaagagatatagaaattgcagcagaattagaggtagataggatagcaatattttacggc
gtaagtgatatacatctaaaggcgaaacataaagcaacaagagaagaggctttaagggta
atagctgagacaattagttacgctaggagtcacggcgtaaaagtcagatttaccgcagaa
gatggttcaaggacagactttgacttcttagttacagtatcgagaacggctagagatgca
ggtgcggatagggttagtatagctgatactgtaggcatattatatccatcaaaaaccaag
gaattatttagcgcgttaataagggaagttccaaacttggagtatgatattcacgctcac
aatgacttaggtctagcagtagcaaatgcattggctgcagtagaaggtggagctacgatt
gttcatgcaacggttaatgggcttggagagagggttggtatagtacctttgcaacaaatc
gtagcagctattaagtatcattttggtatagaagtagttaaactagataaattacagtac
gtttccagtttaattgaaaagtacagtggaattccgatgccacctaattatcccataact
ggggattacgcttttttgcataaggcaggagttcatgttgcgggtgtgttgagtgatcct
agaacatatgaatttatgcctccagagacgtttggtagaacaagagattacactattgat
aaatatacaggaaagcatgcgttaagagataaatatgaaaaactaggtgtgaaaatcagt
gaggctgaaatggatcagattttagctaaaattaagtcaaatacgactataagattttac
agagatgtggatttactagagttagctgaagaagttaccggaagagttttgaagccaaga
ccacctgagcaaatagaagcgttaatttcagttaagtgtgattctaacgtttataccaca
tcagtaactcgtcgtttatcagttattaatggcgttaaagaggttatggaaatttcagga
gattatgacatactggtcaaggttcaagctaaggactctaatgaattaaaccagataatc
gaaagtataagagcaactaaaggtgtgagatcaacattaacatcattagtccttaagaaa
atg
>SSO0978 (rpiA) Ribose 5-phosphate isomerase (EC: 5.3.1.6)
gtggatccaaaggaattactagcaacgtatactttgaactatctaagaggaaaaaagata
ataggcgttggtactggaaaaactgttaagaaattgatagaagttttaagtagtgaagaa
aatcttaaagaaagctcattatttgttgcgagctctatcgatactgaaatcgaattaagt
aagcgcggttttaaagtactttcccttttctccgctattcaaccagaaatttacgtcgat
agcttcgatatagttaccaaagacggtattatgataaagggtggaggaggtgccttgctt
agggaaaaacttttggcatacttttctaaatacagaatttttataggagaatctactaaa
ctaaaagacactaaagtgattgatattccaattgaggtcataagcgttggagtaagttat
gtcaaatacaaattagagaaaatgggatttaccgtgaaaataagggagggaagcggtaaa
atggggccaattatttcagataatggaaatgtgattttggacgtttctgttaaaactgaa
aatctatgcgagtttgacagaatgataaagaatataccatcaatagtagaaactggaatt
ttctgcaaggaattatataataagatcatattggctaatgaacaaggtagaattgaagaa
atggatgcgggggacgggatt
>SSO0980 Transposase ISC1217
atgaccaaagaattgacgagggaggagtactataaggcattggaaaaggcagttaacgag
gtcatactatccatgactggaacgaggaaggacgttgccaagaggctcgtcctgggggcg
gtcgtgggaagaaatgctaccgaaatagctcaagaggccgagatggactacgagaccgtg
ttgaataacttagacaaagcagctcaggccaaactaatcgaggtcgtgaagaagttagtc
ggggatcatcctgtccttctcatagtggacgacacccacgaccacaagctctacgctagg
gccatgccggtctccagaaacggggcgcagatcttctactgtagatcacacaagaggttc
gaacccgcgattcaactccttgtgattggcgtcaaggatctggtgaacaaccagatctac
gtgatccacataattgcctacataccccgaaaggtggaagaggagctcaagcgtaggggt
gaggaggtgaagttcaagaccaagatagatgccctcttggagtttctctcctccctctca
ggtttgaatgtaaaagctaaggtcttcgactcatggtacgtgaactcgaggactctccaa
gggaatactgtgggggaactcaagtccagcgcgcgggtcgtcgagggtggcagatccgta
cccgttagcgagttcccccaaggggagtacctggtagagtacttgggtactcccataaag
ttacttgttatagatgattataagggttacgggaggaggtatttcttctccaccgacctt
aacgacacggctgaagatattataacaacctgggagaaccgttgggacatcgaggtcttg
attagagagctcaaggccttgggactcgagggtgggtccttcttgacctgggttaggaac
tcaggcttcgtggccttgaaggctctctccctcctcgttgtccaatacttcaagtactcc
acgggtctggtgctcggggccaaaaggttggccagattgataaaaagtatttatcacgag
gtgggtgggatcaaaaaactgttcaagaggaggagaaaaccg
>SSO0981 (pyK) Pyruvate kinase (EC: 2.7.1.40)
atgagaaagactaaaatagttgctactttaggtccttcctcagaggaaaaagtaaaagaa
ctggcagaatacgttgatgtttttagaataaattttgcacatggagacgaaacatctcat
aggaagtattttgatcttattagaacatatgcaccggaatctagtattatagtagatttg
ccagggcctaagttgagactaggagaactcaaagaaccaatagaggtgaagaaaggagat
aagatagttttctctcaaaaagatggaattccagttgatgatgagttattttattcggct
gtaaaagaaaactcggatatcttaattgcagacggaacaatacgtgtgagggttaagtca
aaagctaaggatagagtagagggaaccgtaatagagggtggaattttattatcgagaaaa
ggaataaatattcctaatgtcaatctaaaatctgggataacggacaacgatttaaaactt
ttaaaaagagctttagatctgggagcagattatataggactctcttttgtaataagtgag
aatgatgtaaagaaggtaaaggaatttgtaggtgatgaagcttgggttatcgcgaagata
gaaaaaagtgaggcattaaagaacttaaccaatatcgttaatgaatcggatggaataatg
gtagccagaggcgatttgggggttgagactggcttagaaaatctgcctttaattcaaagg
agaatagtaaggacttcaagagtatttggcaaacccgtcattttagcaactcaagtatta
acttcgatgataaacagccctatacctaccagagctgagattatagatatttctaactcg
attatgcagggagtggactctataatgttaagcgatgaaacagccataggcaattatcca
gttgaaagcgtaagaactcttcataatatcataagtaatgtagaaaagagtgtaaaacat
agaccaatcggaccactaaatagtgagagtgatgcgatagctctagctgctgtaaatgca
agtaaagtatctaaggcagatgtaatagtagtgtatagtagatcaggtaattcaatattg
cgcgtatcgagactgagacctgaacgtaacataataggagtctctcctgatcctagacta
gctaaaaagtttaagctttgttatggtgtaatacccattagtataaacaaaaagatgcag
tccatagacgagataatagacgtctcagccaagctaatgcaggaaaaaataaaggactta
aaatttaaaaaaatcgttatagtaggaggggatcctaaacaagaagcggggaagactaac
ttcgttatagttaagacactagaacaacaaaagaaa
>SSO0983 Hypothetical protein
ttgatgagcgagagccaagaactaagaagaaaattaattgaagccaaaaggctaatatta
gatggtttcgtcgaacaaggaattgaattactctctaagactatatcaccagaaaacatc
aaagagtcgaattggattatatgcaatataatagatacagcaaattgcgatgcagtcgta
aagaccctagattccataggaaaaatatttgatatatccccttgtgccaatataaagaga
gtagtttactgttatgcgttaatgaataagatgagtgaatacgttgatctggcgctagac
gtcatagttaaggcaaataaaaaggattcattagacaagctatacaatgatttgaaaaat
gaaaaaattaatccagaattcttattaaagataggaacggcatataagaaactaaatgca
gttagagaaagtaatgaagtcctaaggaaggcatgcgaaaatggagtaaaagaggcatgc
gaaaacattaaagaaatagctagtaagattatg
>SSO0985 Oxidoreductase, putative
ttgaaagttgggattgtaggaggagggatagtaggtttatttactgcttactacctagct
aaggaagggataaaagacattataatatatgaaaaaggcttcctaggagctggttccata
cacgctgcaggcttaatagagccttataggtttgataaaataaatacccttagcatgatt
aaaaagatgttaaaatataaaatgaatggaagtacggatataaaggaagttgataaactc
tggttagtagagcttattaagaatctggaaaaggaccctccgggagaagcttgggataca
atgagggagatggctaagttttccttatcagaatataagagaattgctgaggaaaagaat
gatttcgattatcacgaagacggtcttcttgaactatattacaattctaaagagtttgaa
agtggaatagaggatgagaagaaaagcccatttaatcctaagtttgaaattgaggagatc
aagggttttgcgggtggattattctttccagagctaagtagaatctctaccgaaaaattt
attgatagaatttcaagagaaattgtcagcaatataaaggttaaaaatgaagaggttatc
aaagtatctgatgagggatatatagatggggaaaaatacgatttagtagtagtagcagct
gggatttggtctagaatcctaaaaatcccactaactgcgttcaagggttatggatataga
gtcaaaggtgttagtaagttaaatcgtgcagcggttattgttgattatggtctagctatc
tcaccgttaagtgaccatataaagataaccggagggttcgatgcagacttttccattgac
tctaaaagagcagaagattttctaaaaaaagcagaagagctagttgatatccaatacata
atcgatttaaacatgggttttagaccatgctcaccagacggttttccagtaatagggaag
agaaataatttagtattagttacaggagcatgcagattaggatggagttatggaccagct
atggggagatatgctactgatttagccctaggtaaagcgaaagatcttggttatatttca
cggtactatcacgaa
>SSO0986 Hypothetical protein
atgaatataaagaacgcattggaaagaaaggacgtcaaatatctgataaggaatataaga
agtttactcaacttgctaaaaagtaaagatggattagaaagagaagttggatggaaagct
atagatttcttaattgagactgggaatgttaatgaactagaacagtataggaattattta
agatcactattgtggcatagattgcaaggagttagagacgatgcttggaaacacttacat
gtgtataagatcttacagacaaaggggattgagagagcattgacagcacaatcagacaag
ataaaatggtctgcttggagtaatgtgctaaagttaatccaactagagatagttccaaaa
gaacatatcagaagcacgagatacgcctactggagattattaagaagtatttatcccact
attaggaaaaaagcttggagactgtttgttaaattagtacatgaagggatatttgactcc
tcagataaggataggttttcagaatttctaaaaagtaaaaaagccaacgttagaatactg
gcttggaggatagcttttatgctagttaaggaaaatttcatcagtttagacgagttaaag
gcgaatattagatatttagaagaactaactatgcaacaaagtaaagttaaaaaagttgct
gagaaattaattaaagagttaact
>SSO0987 Glycogen synthase (EC: 2.4.1.21)
atgaaaaggattgaatcattgtggttacctgaggacattaaaaaagtgtggatgataaca
tttgaattgcaaaagatagcaagtgttggaggattaggaaatgctgtatataacatagct
aaacatctagctgaaaagggagtagatattacggttttcttgccatctcatggaaggcat
ctaaatgaatattataggtctctcttaagtttaagacatattgacatgatcgttgaggga
agaagaaagggtatagataataactattataattataaaataggatttgaagaaggaaaa
atagataatttcaaggtaattttggtaaaaggattagattataacactggtagggtatta
gattcatggaatatctatgataacacaatggagaaaatttcgctattaacaagaggatta
gaggggttcactttaggcaatctatctaaccttccagatataatccatgcacaagattgg
cacgccgtaattcccgcagttaggataaaacaactcttggaagagagacgaataatcgtc
ccatttatttacactattcacttactgaattacattggtgtaccttggcactacgcttct
caagactggtctggaattgaggattgttggcattatatttggatggtagctaagcatgaa
ttatataaatattcatatgtatgggatgtgttgtcaggtggaaaaattgagaaatttggt
tgttacgaggctgatatggtgagtagtgtaagttacagttatttaagttttgacgtattt
aattttgtaggaaattgggtagccaataaatcatgtgtaacgtataatggtacggattgg
gatgtggaagagatccaaaataaggctgttacaatgtatggaactaaggacagaagggag
ttaaggagaaggctactttcatctctgcactccctaagggttattccagaggattacact
accggcaatatgctatggaataatagaaatagactaggattaagagatgattggacttac
gacgatttaggggaaggaccccttgttctattcactgggagattagtatatcaaaaaggt
gtagatttacttttaagggctatgaaaacagttgtgaatgagataaataatgctaggctc
ttaatttttgggctaccgtctggggattacaacttactttgggatattatagagagggct
tcagaaattaaggataatattaggttaatagtgggtagaatggatttagatttatataaa
ttgtttcactacgtatcttcagtcttcgtcattccatctagatgggaaccatttggcata
aattcaattgaggctatggctatggggttgccagtaattgcctatagcgtagggggttta
agagaaacagtcgttgacattagggaggataagaataatgccacaggtctcttaattaag
cctgaaagtatagacgaattagctagagccataaggattgcattatatttgtcagaggct
tctgagctaaataaaagcgatttgttatataaggcgagtgaggttaaagtagatgatacg
agatactgggataaggtacgtgaaaatgcaataactagggttaagagtagatttagatgg
gatgcagtgataaactccttaactgagtgttatagaaagactctcgatatggctaaatat
agggctttagcctctttt
>SSO0988 Alpha amylase (EC: 3.2.1.1)
atgaaaagagtaatagtaggatttgaagttcaccaaccattcaggattagaagagatttc
ttctggaacccgcgatttagacaaaagctagaggatagatttttcgatactgagagaaat
aaagagatatttgagagaataaagaagaactgctacatccctgcaacaaacataatacta
agctctattgaaagagccgaagaagaaggaaataacgttaaatacttcttttcaatttca
gggactttcttagagcaagcggagagatggggaagagaggtaatagaattatttcaacaa
ttggcatatacacataaagttgaatttctagcgcaaacctattatcattctgtaaccagc
ctttgggaggataaaagtgaatggaaagagcaagttaagatgcataaggatacgataaag
tcttattttggacaatatcctaccacttttgaaaatactgaattaattactaaaaaggat
attgtagaagaagttgaaaaaatgggctttaagatgatgttaagtgagggaactaataga
aatttaaatggacgaagtccaaattacgtctataaattgaagggacatgagattagaatg
ttgtttaggaattatacgttaagtgatgatatagccttcagattttctaatccaaattgg
gatcaatatccgttaacagcttccaagtatgctgattggataagtagaagtgagggaaat
gtaggattaatattcgtagattacgagacttttggagaacaccacagagaacaaactgga
attttagaatttcttaaatggttaccaatagagcttaacagtaaaggagttgaaatgatg
atgccaaaggaagtttacaatgacgtctatgatgaaatagaaattgctcatactacctcg
tgggctgatatagaaaaagatgagaaaagttggttgggaaatataatgcaatgggcttac
gatgatgcggttagaagggctgagatgccctcaagggaattgggtaatgagtatttaagg
gtctggagatattttactacaagcgataattactattatctttatttagggcatgggagt
ccagctgaagtacattcctattttaacgcctttggatcccctatagatgcgtttataaat
gaattttatgcaatatcgacatttatacatgaagaaataagtaaattaaatattaagaat
gagccttatatattcatattaggagataagagagcgtcgatagcttggaatgaaaaagag
ttcatggaaattgtaatgagagatgaaaggtttaaaactcatttgaaaaacttaaggctg
tggttaggaaatgaaaaggat
>SSO0989 Sugar phosphate nucleotydyl transferase (EC: 2.7.7.-)
ttgatgacaaagtgggatatatcagatgtaaaagttataattcccatagggggtgaggct
actagactaagacccttaacaatagaaacatctaaagcagctgttagattacttaataga
ccgcttattgaatatacaattttagagttagctaaacaaggtattaaggaatttatcttt
ggtgtaaaagggtatgtaaattataggtctttgtttgacttattcaaggagggtattggt
ttttcggcaagatacaagattaagccaagagttcactttaagtatcaaccgagagtagat
agtataggtaacgctgactctgtaagaataaatattgaatattatgacattaatgaacca
attgtagtagtgcaaggcgataatatattcaaattagatataacgaaagcattggaattt
catgaatccaaaagttcgcttatgaccatagtgctaaagaagtatgaaggagacttaagc
gaatttggcgtagctgataccactggagatttagcaataagaaaatttgttgagaagcca
aaaagaagagaggacgcaccatcagatttaataaatactgggatttacatcttgtcccct
gaaataagaaagatattcaagagtaatgacgtgaaggaaatgtacaaaatgggcaaaatg
gattttggaaaggatataattccatacttgataaataaaggttatccagtttacggatat
cccatgaaggaaatatggtttgatataggtactccagagcgttatttggacgcaatggtt
acgctactgcacacattgtcagattctgaaataggtggaataagaatagatcctaataga
cgtatatttgtacaaggaacaagcccagactcaaggaagagaagaagagagatacagaga
aaattcaagaaaggactcataaagattgagggcgatgcacttatcggtaggcattgtcaa
ataggtgacgatacatatatagaggagtctaatatagacaattttacaatgattgggaag
ggtgtaaagatagtaagaagtgcaattatggatagaggctatattggagataatgtgcat
attgaaaattcgataatagctaggcacgtcgagataaggtcaaataatgagaagccagtt
agaataataaatagtgtaattgctgacgatgtaatagtaggagaaggtaccgagattata
aattccagaatttacccacacaagtttataaatgccgggagtagaattcatgatacaata
ttgaca
>SSO0990 Glucan 1,4 alpha glucosidase (Glucoamylase) (EC: 3.2.1.3)
atgagagtttcctccataggaaatggcagaatgctgataaactttgatgagaaaggaaga
atagtcgatatttattatccttatataggaatggagaaccagacttctggaaacccaatt
aggttagctatttgggacaaagataagaaagtggcatctctagatgaggattgggaaact
actgtattatatatagatgaagctaatatggttgagattaggagtgatgttaaggagtta
ggactttctcttctctcttataactttctagattctgatgatccgatatatatgtctatt
gtaaaaatagcaaataacgaaaataatagcagaaatataaaagtattttttatacatgat
ataaatttatattcaaacccttttggggacactgcattctatgatcccctatccctttca
attatacattataagtctaaacgatatttagcctttaaagtgtttaccacggtatcgaca
ctttctgagtataacataggcaaaggtgacttaattggagatatttatgatggcaattta
ggacttaatggtatagaaaatggtgatgtaaattcaagtatgggtatagagataaatata
gatcctaattcctatttgaaattatactacgtaatagtcgcagatagaaacttggaaggc
ttaaggcaaaaaataaggaaaataaactttgcaaacgtagagacatcgtttacgttaacc
tatatgttttggcggaattggttaaagaaaaataaactcttcagaaataatttaatgcag
gatattaagagagtctatgatgtgagtctttttgtgataagaaatcacatggacgttaac
gggtcaataatagcttcctcagacttctccttcgtcaagatttatggggactcatatcag
tattgttggcctagagatgcggcaattgcagcttatgctctagatctagctggctataag
gaactagcattaaaacacttccagttcatttctaatattgcaaattctgaaggcttccta
tatcataaatataatccaaatacaactctagctagttcttggcatccttggtattataaa
ggtaaaaggatatacccaattcaagaggatgagacggcattagaagtatgggcaatagct
agtcattacgaaaaatatgaagatattgacgaaatacttccattatataagaagttcgtg
aagccagccttaaaatttatgatgtcttttatggaagaaggattgccaaaaccttctttt
gacctatgggaagaaaggtatggtatacatatttacacagtatctacggtttacggcgca
ttaacaaagggagcaaagttagcttatgatgtaggtgatgaaatattaagtgaagattta
agtgatacatcgggtttattaaaaggaatggttttgaaaagaatgacttataatggaaga
tttgttagaagaatagacgaggaaaataaccaagatctaactgtggactcaagtctctat
gctccattcttctttggtcttgttaatgcaaatgacaaaatcatgataaataccattaac
gagattgaaagcagattaactgtgaatggtgggataataaggtatgagaatgatatgtat
cagaggaggaaaaaacaaccaaacccttggataattacgacattatggctatctgaatat
tatgcaacaattaacgataaaaataaggcaaacgagtacataaaatgggtaattaatagg
gcattaccaaccggctttttaccagaacaagttgatccagaaacttttgagccaacttca
gttacacctttggtatggtctcatgctgaattcataatagcaattaataagctcttaaac
catata
>SSO0991 (treX-like) Glycogen debranching enzyme, hypothetical (EC: 3.2.1.33)
atgatccccttagaccagtgtgaggaggagtggcttttaccaactaggactggaggatat
gcatcatctacaatatgcggaataaacgctagaacttatcatggatatctaatagtacca
ctaaaccaaccacatcatagatttctaatactttccaagtttgaggatttcttacttatt
aacggcgatacatactcgatgtctactaattattatcccggctcctactatccagatggt
tataaatatttaattaaagttgaaaaaaacagtaatagcaaaataacttggcattatgac
tttggttattcgcaagtggaaaaaactctaagagttcataaaggctataatgcaataaca
atcacctatattgcaactaggggtaaattcaaattatgtcccttcattacctttagaagc
catcatctagctaagaaattacagaatgagttctttacatacgagatttatcctccaaat
acaatttacatattatatgaggggaagaggattttgaactttgagattcatgataagtat
gagctttttaattctggttattggtactataactttatttataaattagatcaagaatta
ggaaacaactacatagaagatttatataatcctttctgcattgtctcaacctcaaataag
atctcggttacggtatattatgatcaacgtccaaaggatctaagcgttgaagaaaatgaa
cattatgacattttaaaacttctttcggctgcagggaaagactttgtagttaaagggaaa
gatggttgggcaatcatagcaggatatcattggtttgacgaatggggtagagatactttc
atatctttggagggacttttgcttgttgacaagcagtatgatattgctaaagagataatt
ctcaagtatttaaatctagaaaaaaggggtatgctaccgaacaatttcataagctataat
ggagaaccagtatacagaggtgtcgatatttcgctctgggctataaatgcaatttacaaa
acttatatttactcacgagataagaacttcatcagaaaggtagtagataaggttctagac
ataatagactggtattccaagggaaatggggtaatctataacgttgataacctaattttc
cataaaggagcccctagaacctggatggacgcttcatatgatagtaggatagtaaccccc
agagaaggtgctgcagttgagataaacgcattatggtataacgcactaagagtaactgaa
ttcttacttaacgaacttggagaaaaagcagaatatttatctgaaaaagcagaaagtgta
aagaagtcgtttgcagaaaaattcatttcacaggatggtctttacgattatataaactgg
gataacattcccgataagagcataagacctaatcaaatattttccatttctctacctttc
ccaataatagacgataagagcatagcttctaagattttaacacttattgaaagtaagttg
cttagacaatatggattaagtagtttaagtagagaagatccaaactataaaccagtatat
aagggggataggagaagtagagaaagcttaccacaatggacccatatggccttggttact
aggcgcctatgt
>SSO0992 Transport conserved hypothetical protein
atgaaaatcagaatactaaccttaacttcattatcccactttataaacgacggaaatagc
tgggtccttccagtgacgttcatattcctaataacgtatcttggtatatcaaaattccta
atcggaatactatctggcgcatttttcttcggaatatcagcattagcttcgcctttagtc
tccaagatagcagacaagtttaccaattattccagcataatgggaataggaatattacta
tggggaattggattaatatcattcggttactcaatacaactccactttttgccattagta
ttcatttcagtggcaatagctggttttgcatcagcattctatcacccaataggtgcggct
gttctatcaataacatacaagggaaatgctggtattgcattaggcataaacgggtcaatg
ggtagccttggcagggcaatttacccaacattaaccctttcactatttgcaatattgaat
aaggatatgaccttagatatgttaataataggtataatatcaataatagctgcattgcca
tcaatattcctaaagatttctatcacgaaagaggaggatcataaaacaccttcctcttcc
aataccactagtaccagaggcacattatttgtagtaatcttattgactatcattgcatta
ctacgaagtatatttggtcaaggaatttcacaattccttccaacattattagtagaaaat
tatggttattcttacaacgttaacttaggtgaagcaattacaatcgctctagcagcagct
atagtagggcaaccaatactaggattcctatcagatagagtagggagaaggctaatttac
gctatatcgacctttggtgctgccttaacattacttttgtttctaaaaataccaaacata
gccttgctatcattatttggattttttaacttcagcgcattcccactaatgctatcaata
gtaggagattttgtacctagaaattcagcgagttttgccaattcactagtttggggatta
ggagttactggtggtggagttattggtccaatagtagtgggagcagtatcccaagtttca
aacttagtgttcgcaagtgaaatagtaaccataatggctttcgtcgcaggagcgttaaca
gcattaattcctaaaccaccaaagagaaccaaagtaccattatttgga
>SSO0994 Conserved hypothetical protein
ttggataaattttttatccataaattttatatagttctcgtggttaaaaagacggaaaaa
attctcggcggcattataacattacttattttaaagacgcttttagaagaaccgaaacat
ggatatgaacttgaaaagataataagagagaagttggattataaactaccagaagggtca
atatatgttatattaaagaacttagaaagaagaggattaataaagccgcaagttatgaaa
aacgagagaggacatgatataaagaagtacataataactgaagaaggaaaaaaaattctt
cctatcaca
>SSO0995 Conserved hypothetical protein
atgtttaacgttaaggaatgtaagcttgggtttaacgaatgtgttaagacgctaatcgaa
aggataaaatcatctggagctgaagtttttgcaattattgatcattccgagaatgcaagg
aaggttgggcttagtttagagccaactatcgtaatttattttggaaaccctagtgttggc
acattattgatgcttcacaacagacatgtagcttacgaattgccgttaaggttcctagtc
tggagcgagaacaatgttgttaagattggttataggaagccaagtgaggttggggaggag
tatgatataagaaataaggagttgttagacaagatggataagttcgtggagggtttacta
tctaatctt
>SSO0996 Nicotinate-nucleotide pyrophosphorylase (EC: 2.4.2.19)
ttgattgattggatttacgttaaaaggctcttagattatttggaagaagacgttatgccg
gaggacattactactaaatttttagagggtataagggcgaggggtatcgttaggtgtaag
gattctggaattttggcgggtaataggtttattgttccttttttaaagtacttagggttt
tccaacataaatggggagaaagacggtagagaggttaaaaagggtgatatcgttttgaat
tttgagggtgatgccgatattttgactgttgaaaggcttattttgaatttcttaggtaaa
ctttctggtattgcgactattactaatttgatggttaagaaggcaaaggaggttaatcct
tatgtgagaattgctggtactagaaagactaccccgggctttaggttatttgagaaatac
gctattgaggttggtggtggtgatccccataggtataatttatccgatgctgttttgatc
aaggataaccacattactttgtatggaaatcttgaggagttgattaagagagttaagttt
tcggtgagtttcactaaaattattgaagttgaggtttcttcttatgaagatgcaataagg
gcgtttaaggctggtgctgatgtaatattactagataatatgaagccttatgagatttta
ccaatagttaatgagcttaagagtaaggtccttttagaggcttccggtgggataactccg
gataatgttattgattacgctaagactggtgttgacgttatttccagtggttatatcaca
catagttacagatctttggatttctctcttgacgtagaaaaaatc
>SSO0997 (nadB) Aspartate oxidase (EC: 1.4.3.16)
ttggctaataaaaaactttttatttggtcgaacatatgttcgagtatgatctacattttt
ggcagtggtttagcgggtctaagcgccgccatatccttgcataaatctggatacaaggta
actattatttcaaagaaaattaatgggggctcaagttattgggcgaagggtggtattgca
gccgctgttggtaatgatgattcaccagagcttcacaagatcgatactttggaagtgggt
gatgggttatgtgatagtaaaactgtcgattacgttacaagagagattcggtacgttgtt
agcacagttgaaaaatggggtttcaaatttgatgatgatttaaggttagaaggtgggcat
tctaagagaaggatattgcataagactgacgatactggaagggagataaccaatttcctt
ttgaacttagctaagaaaaagggaattaatctcattgaagataagttgctagccttaaag
gttaaagatggtaaggttgcaggattcataacggaaaagggtggaagttttgacgctgaa
aaggttgttttagctacaggtggttatggctatttgttcaaatttacttcgaatcctagt
acaaacataggagatggtatagccatagcctttaaagctggtgctttggtttcagatacg
gagtttgttcaatttcaccctactgttacaacgtttgatggtcaagcctatctgttgact
gaaaccctaaggggtgagggtgctattttagttaatgagaggaatgagaggtttgttttt
aaatatgatagtaggggtgaattggctccaagggacgttttaagtagggctatttatgac
cagtacaagaaggggcatacagtttatatcgatctttcacctattgaagattttgatagg
aagttccccatattgagcaattatgtaaagaggtacggtaagaggcttcaagttttccct
ggtgttcattatactataggcggtattagagttaatactcgtggtgaaagtaatatcaag
ggtttatatgcaataggtgaggttacagatactggtttacacggagcaaataggttggcc
agtaattctctcgctgaggatttggtttatggtgtaaatcttgtaagatatattgataat
tgggagggattaagtattgatgacgttaaggaggttattgaagtgaggctaaggaatagt
agtaataggttaagcttagaggagattagggagtataattggaattatttagggattgtc
agaaatggcgagggactagataagctagttaagatttacgagtctaatgacacatttaat
gacaacgcttcgcttgtaagcttattaagtgctaaaggagcgttgttaagaacggaaagt
agaggtgcacattatagggaggattaccctaataagagttgggaagacggtaagaggata
tatttcatggtgagtagaaat
>SSO0998 (nadA) Quinolinate synthetase
atgacaagagttgaagagttactcagtcaaataaagaacctaaaaactgaaaagaatgca
ataattttaggacataattacatggaatactctgttcagttagtttcagacttcactgga
gattcttacgacttggcagttaaggcaatgaagacaaacgctaagataatattatttgca
ggagtgtacttcatggcagaacaagcctcagcattaaatccaaacaagaaagtactctcc
ccagatcctaatgcgggttgtacgttatctgattcacttgacgttaaaacattgcaagaa
tataaagagaagtaccctaatgccccagtagtgctttacataaataccagcatttatgct
aaggctttagcagattacatagtaacatcttcaactgcagtgaaagtcgtgcagaaacta
aacgcagatacaatactatttggaccagatgctaatctagctaactacgttcaacaaaaa
gttcccaataagaagattattaaagtaccgccaaatggtagatgtatagtacatgccaac
tatactaaacaactagtagaactagcaaggaagaagtaccctaatgctctattaatggct
catccagaggcaccattagaaattttagaaagcgcagatttcgtgggatccactaatcaa
atgatacaattctcaaaagagaacaaaaatgaggagttcatagttgcaacggaaataggt
atgataaatgctctgaagattaagaatccgagtaagaaattctatccactcgttacgacg
gaagcttgtgcttgtgctaggtgcccatatatgaatatgataaatttggaaaaggtaaag
aggtctttagaggaagaggtttacgaggttaaggtaccagaggatattgcagaaagggtt
aaaagggcatttgaaaatactatgaagttgcta
>SSO0999 ABC Transporter
atgtctcgctcagataaattctccaataaagagaaaatgagacgtggtttatccacaacc
acaataataggaatagtagtggcaatagtaataatcgtaataggagccgttgctgcggta
actctacttagtcataagccgtcacaagtagtatctaccacttctccgtctacttcgcaa
tcagcaacgtcaacatctccatcacaagttattaccataacctattttgacgatctatcg
ccatctgaagccaacataacacagaaaataataattccacaattcgaggcaacacatcct
aatattaaaattaattatgttgatgaaagtgctgacgatatagtaaaaagtgttgtagag
ttagtaaagagtggtaacgttggcccagttatcattggtgaagataatcttgttatagga
gaattgctcaatggtaactatttaatgaacctaactccatatgtaaatcaaatcttacag
aatgttagtctaattccatcgatgcaatcattagtccagtatgaacaaaaagtatatcat
ggtacttacttcattcctcttagagccaacattcctctagtctggtataacgcaagtctc
tttaggcaattaggtttggcttctccaccagaaaactggtcacaattgctacagtacgca
aagataatttatgataaaactggcgtaaaacccataatgttccaaggtcatggtggagca
agtacttatactgagctttaccagtggatggtccaggctggtggaaatccattcttattt
aatgattctggcgatgtacttgcatttgaatatttgtacaatctctcacaatattttaac
ctagagtatattcatggatattggggaagctataaaggattaattgatggtagttactat
ttgatcgattatcaatggccctatatctatagtgttatggccagtgaaggtgttaatatg
agcaatataggattctaccctggccctaccggccctgttaacggtgatcacttagtaggt
ggtgatgtattagcaatacctaagggagcaacacacattgatgcgctaatagaattcgct
aagttcttactatctccgcaagttcaaagagaatttatcatttacctctcatggccagca
gtaaatcaacaagcttatcagaatctcccaagtaatataagttcactatacaaagctgaa
gaagaagctttacagaacgcattcttcagagaaccagtaccttggataactgtttgggga
cagatagcagataacgtgtttaatcaaataatcgtaaatcatgcaccatattcacaaata
cctcaaatattaagtcaagcaaataaggaaatgtaccagtatctcttacaaaactataat
gtaacggtagcacaagagtatgaggaaggagtgtttggaccactatacggg
>SSO1000 Maltose transport inner membrane protein
gtgaataaagtgaagttaaccttttttttattggtacttcctgcattggcatacgtaatt
agttttgccttttttcccactattgaggccgtttatttgagttttcaagatccccatggg
ggtttctctttatataattataaagaactgtcctattttaatttgtctagtgcaataatt
aatacaattgtagttacaattggcgcattagcaatacagctagctctaggttttctagtt
gcatcagttctaagtagagaattctttgggaaaagagctttatctactataacaataata
ccaatgggtattgcaacagttgtcgcagcagtaacgttcagcttcgtctttcaaacctct
ggaggatacgcaaatacaattcttcattccctctttggacttaacgtaaattggtatcaa
tcttccatctcgtcattattggtagtaatgattgcggacagctggaaaaacacacccatt
gtagccttaatattgttggctggaatgtcctcaataccaaaggagttatattatgcgtct
gcaatagatggagctgggccgattaggagatttttctacataacattaccaaaccttagg
agcttcattgggatatcacttattctaagaggagtgcaggaattcaacatattcgcttta
cctttaatactaatcggtgagcatccccctctcctcaccactttaatatatgatttatat
actacaacttttccagaagttggattagcattagcttctgcaacgatacttcttggattt
atcctcgtattttctggcatagtaatcaaactctctggagggaga
>SSO1001 Sugar ABC transporter
atgaggttgtgggtatatttaggtgcaatagtagtaggaatttactttctatttccactt
tacattttagtattactagcatttaattccccaaaatataccgtcttagcgaaattcccc
tcactattaccggtgtcactaacactaaataatctactaacagcattacaaggcacggca
tttattgatccattcataaaaagtctggagacagcaacattagtggggatcattaccata
gcattggctattccagcgggatatggtttaagtagattaccaagagccatagcatattcc
ataattatccttctattagttactaatatgatgccagcaatagtaataggtattccaata
gcagtagattttcttaaacttcatctttttgaatccgtagtaggtctagccttagcccaa
acactaataacactaccattagctacgttcatcttacaaggcacgttctcgtcaataccc
attgacctcgaacatcaagctagagttgatggtgcaaatttatttaataggttattttca
gtactcttaccactagcagcacctggtatagcagcagcattcctaatatcatggatgttc
tcatgggatgagtttacttatgcaatcctattaattccctatcactccacacttccagta
acaatataccaagacgttaccagaggaaacttattggcaggaatagcattttcactaata
ttcacacttcccgtaataattttaacttttgcattacaaaaatatctaagaggagaatat
ctagcaggggggataaaagga
>SSO1003 Sugar ABC transporter
atgacggtagaactaatagatattgtaaagaaatatggcaaaaacattgtaattaatggc
ataacagagaagatagagactggagagttctttgtaatactaggaccgagtggagaaggg
aaatcaacattattgaaaatcttggcaggaattgaaaaattagataagggaaaaattata
gcggatggagcagacattacagacaaacccccagagaagagaaatgttgctatggtattt
caaaactacgcactttacccaaacatgtcagtgagagataatatagcatttccactcaag
atgaggggaatgaaaaaagaggaaataatagaaagagtggaaaaagctgcaaagctttta
ggtatatcagaaatattagataaaaaagtaacacaaatcagtggagggcaacaacaaagg
gtcgcactggctagggcaattgtaagaaatccaagctatttcttgttggatgaaccatta
agtaatctagatgctagagtaaggacaacagctagaggagaattgaagagaatacaaaag
gaattgaaaggtacgttcatttatgtaacccacgatcaaaaggaagccttaagtctagca
gataggattgctatacttcataaaggcaaattcgaacaagtcagtgatccaaaaacactg
tatgaatatccaaaaacaaaatgggtggcgcaattcgtaggtgaattcccaatgaatttt
ctacctggtgaactaatgaaagaaaaggcgcaggaaatagggtttaggccagaatgggta
gaagtaggaaaaggcaatttatcttgtatggtagaatcagtagaagcttcaggggagtca
agatacttaatatgtaattttaaaaataataatataactatcctttctcaggaattttat
gatgtaggtcaagaagttaggtttgaaataattaaatatagaaaatataatgatggacga
ctggtacaagaa
>SSO1004 Conserved hypothetical protein
atgtttatgatgaaattagacgaacttgagaaagaacttggttcaaagcttattatggac
aataacgtcatagatcactactccaaatctccctatttagtctctccagtcctatcgaag
atgggtaagagagtgctaggagtagtaattgctgaagataggtatgacattgaattcgtt
gttaaattttgcgatattcatagaatccccttattagctaggggtgcaggaacatctaca
atagggcaagtactaccaatacatccctctattgtattggatattcagaaattaaataaa
actatggaatatgacgagaagtatttgaaaatttcccccggagtaaaggttctagatgcc
ctgaattaccttaggaagaggggaaaagaattacaagtatatcctagtagcttttacatt
tccactttaggaggatatattgcaggaggagatgtagggattggatcataccaatatggc
tatcattttcataacggtggaattagacgtgtaaaagtagtgggatctactggaactttt
gaattaaccggagaaaataccttagcagtagcccaagctgctggaacaactggcattata
gttgaggctgatatagctactgtagactatgaagactggaaagaccaactagtaagattt
gatgaactaggtaagttggtaaaattcctaaaagacgtagagaacgaaagagataagata
aggagaatcactatagaggatcaagaagccttatcattagttgccaaaaatagagcaatt
ccgggaaaatggaatgtaatacttgcaagtacaaaaagctttggagaagaagtggagatg
aaattcttagacgaattggcttttgcggctatttacgttaccatgagcagactaaccaat
ttctccgaatatttttacgaggttagactactctctctcgatagttttctcaaagtagta
agccaagttaaaaatgctctaggttctaatgtactaatacatggcgatgtcatgacatta
agaggagaaaccgtaatttacacagtgttcatctctgatagacaaaacttcaacataata
gattcaataatgacaaaggagggaataccatttgaaatacattccttagttgtaaatgac
agggtagatgaggaatacagattagaactaatgaaaaaatacaagcgaatagtagatcct
cacaatatccttaatccggggaagttgagaata
>SSO1005 Conserved hypothetical protein
atgatattaaaaacactattagaagttatagacatcctagaatctaaagatccattacaa
aagataagggaaaggctagaaagtaaagtcaaatatgaagaaataaaagctggagaagta
acctttataaaagcactttatgaaggtgtaggaaataacaaagtagagatccttggaaga
ttaggagcaatacagatggtcggagtaaataaaggtttagtctctgacgctgacggggcg
attataagtctagcggttctcctagagcttcttaatctaagagataaagggatagagctc
aatctcgatgtattattcgtaactaatctatccattaaggctaaactaattccccataaa
ccattcgactttatggttccactggtaggattagacgaagcacttaaagttgaagttgaa
ccctcagcatcactcgtcatatcaatcgattcaactaaaggaaatagaatagttaaattc
gacgacttcgcaataactcatgtagttaaagacggctatattttaaaactccatgataac
gtaatcgacatttataataaaataactgggcacgaaatttacatggttcccttgacaact
ggcgatctaactcctctagattataatgtatctcacatcagtactcttatctcaccgtgg
ttatatacagattctccagtgattggaatagctacagtctccaaacaagttataccagga
tatgaaactggtgtattaaacattgaaatgttagaacatgcatcaagattttgcattgaa
ctccttaaatatatagaaaatggagggaaagtgtatgaagagaaagaattagaagaatta
gagaatagattaggaaaatcaagcttgttaaaagctaaaagaagg
>SSO10051 Conserved hypothetical protein
atgtactctcaggaaataaaagatctgataaagaaaacgagagctgaaagagcagatata
agaataggaaaatatggtgtaacagaaggtatgataaacgaaataaaaagaagattaaat
gaacataaggttgtaaaggtaaaaatagggattaaagaaattgatgaccgaaaagaattc
gcaaaaagagttgcagaaatggttggggctaaacttatagaggttagaggatatactttt
atattagctaaaattgatagcgataga
>SSO1007 (argE-2) Acetylornithine deacetylase (EC: 3.5.1.16)
atgttatatccagtaaaactactgaaagacctagtacaaatcaaaacagcaaatccacct
gggtcagaatacgagagcatttcgttttatctgaaagacctatttaacgatttaggtttt
caaatacaactaatcgaaataccagaggaatatatggataaatactacatttactctcca
tcacacaaaggaaacaaaagaataatagtaattgccaagaatagtcccaaccctatactc
cacttcaacttccattatgacgtcgttccaccaggagatggttggttaacaaaccctttc
gaactcaaggtagtcgataataaggcgtacggaagaggaacttcagatatgaaaggttca
attgtgagtttatatttagccctatctagatttaatgatttaccaatcgagatagtgttt
gtcccagacgaggaaagtggaggtatagggactaaatacttgacagaggaaattcgtatc
gctcctagtactgctatatttggtgaacctagttttcctaacgtgtatatagggcatttg
ggtatagtgaggggtataataaaaatatttggtaaacaagctcacgcaagcaacccaaaa
gatggcattaatgcctttctgctagcttctaaactagcactaaaactacaagaaaaatta
ggaaatgaaatagttaaccttgggggatatacgcttaatcccactaataatgatggaata
gtaccgggtttctttgcctttagctattatagagctattcctccccatgataatagaacc
ccagaatttgacaagaatgtaattgacactacagctagagaagtaggaatagagtataat
tttgagattaaatctttcatttcaggctcagtttctaatccagattccagtgtagctaaa
gcgtttaagttttgtatcacttcaactcttaacgtagtacctaaagaactaataagtaat
ataagatatgacgcagtcttctataaaaatctcgattcgataaactttggcccaggaagt
ttagatcaagctcatgtacctaatgagtatgttgaattagataacatagagaaaactatt
gtgatttatgaatgcgtgatgaaaaggatttattttaataattatcga
>SSO10075 Second ORF in transposon ISC774
ttgcacgatggtttatcagtttacaatgcctttgattggtttaatgttgggcacaagagg
gttacgttaggcgattacactgaagaagggtctaggaaattaaagcatagagtctcttca
atggacttcgcttgtaattccaataagttaatgagttggttctcgaccttcttcttaatc
tacaacctcctttacattcaagtgtatttagtggataagggagtgatgataaatgcaaac
atttcaactaca
>SSO1008 Conserved hypothetical protein
gtgagaaaacaactctctattggaatgaagaatctttataaaattaacttttcaatatca
caccaaggttgctggaccagcaaaataaaagatagtgttgttaccttaaatgtatcaaaa
tataataataagaaagtcagagtcacaatagcttctccaaaattaatagtaactgaccta
aaaaggtcagaaaacgtttacgaaattctaaagtatagaaaggtaaaagggggttatata
attgacttccttgaagatctgagtactacaatttcaggatatatactctcgagcagtaat
atattagaatatagaaatgtcgtaagggaaggaatagaaaagtgggaagtaacaacttta
gccaaatctttagtaggcaaattatcagaaagatttcccatagatagcattgtagttaaa
gaaataaagttttcagatatgttctataatggtttgacagaaaaggagatactagtccta
aaaaccgcaataactatgggatatttcaattatccaaggcaaataaaagctaaggaaatt
gctgaaaaattaggtatctccaagcaagatttcctttatcatctgcgaaaatcaatagag
aaaataattttctcatcagttatagaa
>SSO1009 Amino acid specific permease
atggatgaagaaaaaaagaatgtaagtgaattgagaaaaggtgtccttggtacttggctt
gttgcaagttatggaattgcagctaatgccccaatagctgttgccacactctattttgtg
ggccttgctggattggtaggaggagctatgccactcactgtgatactttcgtacttgatc
tatgctactacacttattgttatttatgagtggagcaaggagattgcagcttcatatggc
tatgttgctatgataaagaagggattaggcagtagtttggcttcctttactgtaggatat
ggttatatttatcaatatcttgttgctggaacagctggatttggaatattaggaattgcg
tctttcatctacttgatctctcccagtattgcttcttcaatgccttggttatgggcagca
atagtgattatagttacaattgagattacaacaataatgtggcttggagtgaagcctgga
ggtctgttaaatctcgtaataggattgatttcaataggttttctaattataacttcgatc
gttttaattgctggagcaaagaatagtattttaccgtttacggctgttccggttaacaac
aattgggcgctggtacttacggcaatgatttttggtgttactacttttggtggtgccaca
actccaataggagtagcggaagaagctaaggttccaaaaagtactttgccaaaggcactt
ctcttaacgtttggaatacttggagttggattgatattgaattcttatgcgcagacgata
gtttatggaataaataatatgtttaattatgctaatcttccagacccaatgatagtgatt
tatagtaagtatttcaatcccgctattgtatatatgttaataatacttgtagcgtttatg
tttaactcttctgcattagcgtttgctactagtgggagtagaatgatattcggtatggct
agggatggtgtattatatcctaaagtcttttcaaaagttaataaatacggtgtgccgggt
aatgcaataatacttactggtattgttacaggtgctcttagccttataagtggttacatt
ctaggtccgttagaggctagtatatttttaataacatttggctcattctacgtcgcctta
ggtcatttatttgctgccttagggttaattgtacgtaaggttaaaatgcgtacggctaac
atagcgaaacacgtagtgataccgataatttcaatactattatatattgctgtaatatat
tttggtacttaccctgcgccagctttcccattaaatatagcagtttatgcagcttgggct
attcttttgattcacataattacatattatgtgataaagagcagatttccagacagaatt
aagaagttcggtgattatagtctt
>SSO1010 NADH dehydrogenase (EC: 1.6.99.3)
atgatacttatcttaggtggaggattcgcaggagtttcagcttataatcaaaataaagaa
aattccttagtagtcgacagaaaggactattttcttttaacgccatggataattgatttt
atatgcggaatgaagaaattggaagatattatagtaaaatataagaaagttatacttgga
aatgtgcaaaaaattgattttaaaaataagaaagttatacttgataatagtaaggaatta
acttatgataaacttatagtaagcttaggtcatcatcaaaatcttccacgattaaaagga
gctaaagagtatgcgcacaaaatagaaacattagaagatgctatagagttaaagagaaga
ttaaatgaagttaaggatataactatcatagggggaggtgcaactggtgtagagttagct
gggaatataaaggggaagaagatcactttagttcaaagaagaaatagattactaccaact
atgtccactgcctcgtcaaaaaaggctgaagatctattaagagagttaggagtcaatcta
atgttaggagtagaagctatagaaatcaaaaaagattctgtagtcacaagttatggtgag
attaaaactgaattaactattttcgcaggaggcttaaaaggaccacaaatagtaggcaat
ttacatgctaataaaaaccatagactactcgtagacaaaaatcttaagtcaattgaatat
aatgacgtttatggcgcaggtgattgtgtaacatttgaagataaggaaattccaatgact
gcagatattgcagttgctgctggaagagtagtcatgaagaacatattaggtaatgaaata
gaatttaagcctaaaagattagctacgacaatccgaattagaaatgaattctttggggac
tttggggaaaattatgtagaaggcaaatttgctaaaatacttaaagacatttcttacctg
gaatcattacttttacctagacgtttgagagaa
>SSO1012 (ilvB-3) Acetolactate synthase large subunit homolog (EC: 4.1.3.18)
atgccatcagttgcagaagtaataataagagtattagaagataatggaattcaaagaata
tatggaattcctggagattccattgaccctttagttgacgcgataagaaaatctaaagta
aaatacgtacaagtaagacatgaagaaggtgcagctttagctgcctcggtcgaagcgaaa
ataactggtaagccttcagcatgtatgggtacttctggtcctggatcaatccatttatta
aatggattatacgatgcaaaaatggatcatgctccagtaatagcgctaactggacaagta
gagtcagatatgataggtcacgattattttcaagaagttaacctaactaagttatttgat
gatgtggcagtatataatcaaattttaattaacccagaaaacgcggaatatataataagg
agggctataagagaggctatttccaaaaggggagtagctcacataaatttaccagtagat
attctcagaaagtcctcagaatataagggtagcaagaatactgaagtaggtaaagttaaa
tattcgatagatttttctagagctaaggaattaatcaaagaaagtgagaaaccagtttta
ctaattggaggagggactagaggcctaggtaaagagataaataggtttgctgaaaaaata
ggagcaccaataatatatacattaaatggtaaggggattttaccagatttagatcctaaa
gttatgggcggaataggtcttttaggaactaagccttccatagaggcgatggataaggct
gatttattaataatgttaggcgcatcatttccttacgttaattttctaaataagagtgcc
aaagtgatacaggttgatatagataattctaatataggtaagaggttagatgttaatctc
tcttatccgattccagttgctgagttcctaaatatagatatcgaagagaaatcagataaa
tactatgaagagttaaaaggaaagaaggaagattggctagattctataagtaagcaggag
aatagtttagataaaccaatgaaacctcagagagtagcttatatagtttcccagaagtgc
aagaaagacgcagtaatagttactgatactggaaatgtaactatgtggactgctagacac
tttagagcttcaggagagcaaacctttatattttctgcttggctaggttcaatgggcatt
ggagtcccaggaagtgtaggagcttcttttgctgtagaaaataaaagacaagttatttct
tttgtaggagatggaggttttactatgactatgatggaaatgataactgctaagaaatat
gatcttccagttaaaataatcgtttataataattctaaattaggaatgataaaatttgaa
caagaagtaatggggtacccagaatggggagtcgatttatataacccagatttcacaaag
atagctgaatctattggatttaaaggatttagattagaagagccaaaagaggctgaggaa
ataatagaagattttctaaacactaaaggacaggcacttttagatgcaatagtagatcca
aatgagagaccaatgccacctaaactaacttttaagcaagctggagaatacgttctttca
atatttagagagaaattagagggtatt
>SSO10122 ORF in partial transposon ISC774
ttgcacgatggtttatcagtttacaatgcctttgattggtttaatgttgggcacaagagg
gttacgttaggcgattacactgaagaagggtttaggaaattaaagtatagagtctcttca
atggacttcgcttgtaattccaataagttaatgagttggttctcgaccttcttcttaatc
tacaacctcctttacattcaagtgtatttagtggataagggagtgatgataaatgcaaac
atttcaactaca
>SSO1018 (hoxN) High-affinity nickel-transport protein
ttgcttcagaatagtagaaaaatttatatgatggatagacaatccatatatgcgatgaga
tccattctcaatacgttaacacaaacaattagttacaaaaatttagtcaccttatcactt
ttctacgtactcaacgtattactaacagcattactttttctcttcctatacacattaccg
caaaaaccactaacattaaacacagatagcggtgagctaataggaaccttcataacacta
ggagttttatcatacacctttggcttaagacacgcagtagacgctgatcacttggcagca
atagataacgtaactaggaaaatgttacaagaaggaaagaatccagtcttcgttggcact
ttcttctcatttggtcattcaacagtagtaattttactatcccttgcagtaatgatggct
tcaaggctggtaactaactcattaccgtccctcgagaacaccggaaatttgatcgagaca
ctaataagtggaggatttctttatcttttaggcctactaaacacaatagtattctacgaa
ttatactcgttttataaagaaggaaaatatgacaaacaaaaactagaggaaatattacag
aaaagaggtttcatgaataaatactttaacaagttgttcaaaataataacaaaccaatgg
caaatgtacattgtaggattcctctttggactaggatttgacaccgcgacagaagtggca
atactatcaatatcggcaatactatcatcaacgtacatacacataccaatctacataatc
ttactatacccaatcctattttcactaggaatgtcactagttgacactactgatggtcta
ttcatgaggttcgcctatggctgggcattcctatcaccactcagaaaaatatggtacaac
ttaacgataacactaatatcaattttaatagcgtttggaataggtacaatagagttgtta
ggactattacaagctgagttcaacctaactggattattctgggatcaaatagctgcgtta
aacaacgtttactgggaaacaataggatattatgtaatactaacctttgccataacttgg
attgggtctggaatgatttacaggataaagaaaatagag
>SSO1019 (cysA-1) Thiosulfate sulfurtransferase (EC: 2.8.1.1)
ttgttctttcatattatgcttgtaagtgttgaatggcttaacaacaacttaaaggacgtt
aaggttgtagagattggttataatccgcagataaattattatgaggggcatattccgggg
gcagtattaataaattggagagattttcttgacgataattctagagatttcgctagtccg
gggaagttgagtaaggttttaggaaacgcggggataaacaacgatgatctcattgtgtta
tatagcgaaatgaataataggtacgcattttacgtttattggattttaaaggcttatgga
cattcaaatttggctatattaaatgggggaatttataagtggttaaaagagggttatcct
atagaaagcgatggtatagtagttaataagaagagtgaatacaaggctaggaagcctgat
tggtcctcaaggattttagtatgggagttattgtctaaacttaaagagtttgttttaatc
gactctaggagtaaggaggagtatgatggtctgactactgcacctccagagcacaagtgt
gaacaaacccaaatgagtggtcacattccgggtgctaagaacattccatggacaattttg
cttaatgaagatgagactatgaaatctagggatgagttggagagaatattttcttggtta
agtaaagaggataagatagtggtgtactgtaggactggtgctagggcttctgttgcttgg
tatgctttaaaagaggttttgggatttaagttggtcagactttatgatggttcatgggtt
gaatatggcaatatggttggtgtcccagtagagaaatcagttagtgatcgtttc
>SSO1020 Hypothetical protein
atgttcaaaagaaaaagaactaaaggagaaaatagaggagaagataaggagaatagagga
actgaagaggagaatagaggaaacgagaagagacctagagaagatatatcaactacaatt
gatcacaatagagtgtacgaggaagaatgctcagaactactaaggcaattgcttaatcta
tcgtcacgagaatcagcgttaactttcgagctgtttcagctatcagaagaagcaaaagtt
gaaacattacgcttagcagggctaatagccaattgcaaatactacgacaaggcattagca
gaagaactgtataaagagttagacattttattttgtaaataccttgagagaaaa
>SSO1021 (hycC) Formate hydrogenlyase subunit 3
ttgcgctatctcaggaggaataataggcgaaggagtaccattagaagcagtagtggaaat
ccccggttgtccaccaaatccctttacaatactcgaagccttgatgaaggtgaagggaaa
atgaacacgctactctatacattacccccatttctaatttctattatattctcaatcttt
aataaaaaagcgggatatatcttgacaatgatatcatcaataatactacttatcacctcg
atttacgaatataatggagttctctcattcttctccataatttctacctcagtgtggatt
cttgcctcaattttctcaatagagtacgatcattacgggaaatggctctcccccttatac
atactaacaatcttaggcatgaccattgtcttaaactctgatggttatctgttattcctc
gcaggatgggaaataatgacaatcccagcatatgtagcaataggtctaacagcaaagaat
aatagaccaccattcgttttcatggcatttggagagctgagtacagttctcattttagcg
ggatttataatagcaaacactacaaacttcaattacttgccatctccagttcccttgatt
gtcgctacttttggattcataataaaaatgggaatgatgcctttccttgtatcggaatgg
ctacctatagcacatggaacagcaccatcaaacttttctgcaatactaagtgccacaatg
acgctaatgggggtttacggaatactaaaaattacaattttaacacaaactattccgatt
ggattttcacttacaataatggccataggtgcatttagcatattctttggagcactttac
ggatacgtaaatgagaacactaagggaattttagcctttagtacaatagaaaataacggg
gcaatactagtagccttaagtctatacatgatctcaaagcaactaaacattacctcaata
gagcacatttccttaatcactgtaattttatactcattcgcacactcagtagccaaaact
ggactattcctctcttctggcttacaagaaaaacagagcataacttattcaaaaaagata
agaaacattgaaataggactaaccctattggcttcctccatgtctggactattgccgaat
atagggggagtagcatcttggctattacttgaaaacctattcatgttctcatacgtactt
cataacatgatatctatcctcttcataatgactggagcaattatcgcaatgggagaaggt
ctagcaacagccttattaattagatacataacgtatacatcaatatttcagaatacaaga
gaacaattaagtaaaataaagaaatatcccatcttattatctgcacttatagtactcata
ctgggattcacgttaccttatttgatatacccttataaaaactctacaacaattctagga
atgctaaccaatagcgtgattctaacacaatactataacaccacattcggaggaatatcg
ccactctacataattttactattagtagccttctctattgtaagctatctcgcctttgga
aagcctaaaataagaaaagcagaaacgtggaacaatggggtaaacgagaaagaagaatac
acagcatttgcaatggcaaataacataagacaaatgctaaagaaaatcttaaggccagaa
gaagagaaattcttacctacatacggtttagatgtattctgggaatacctctacaaacta
gcaaattcaataagaagatttgggaagattttcgctaaaacacttatcaacagctcaatc
tcatggtacattatatacattattttgacgctcattgtagtaataatagtagttgtaatg
ggg
>SSO1022 (hycG) Formate hydrogenlyase subunit 7
gtgaagaattggtggtttattagaggtttaagaaaaggagtaatgacagagaaatacccg
aaggaaatagcggaatggagcactgaaatacaaggagagggaactgtaaactgtccaaca
aacgccataaaggatggaaagtggataaaggaaagatgcgtattttgcagaagatgctat
cccaactatagaccaaatctcaatccaagaatatatacaataaacaaaacacaacccctc
ttcaaaaggtcattttacctttacccaatagactccggcacatgcggaggatgtaacatg
gaactgaagctgatctcatcaccagaatacgatatgacaagatttagcatattcttcacc
aatactccaagacatgcagacgcattagtagtaatgggggtaatgacagagaaaatgaaa
gaagtgttaaaaaaagcttatgaagcaatgccagaacccaaagtagttatattattaggt
gcttgcgctatctcaggaggaataataggcgaaggagtaccattagaagcagtagtggaa
atccccggttgtccaccaaatccctttacaatactcgaagccttgatgaaggtgaaggga
aaa
>SSO10224 Hypothetical protein
atgaaaatatataatctcggaagagctttagttttgactggtataatagagttaatattg
gcttctcttttttattctgataagaaagttattttatcagtattattgggggattattcg
tatttttgtctacttatcggtgttatagttatagccgtatatggagctataactaagaat
>SSO10228 First ORF in transposon ISC1058
atgggaaagagtaagtacaagagggactggagcaagtacgacgagaacgtcataactaga
tataagttgatgttccccttctacgtattcgaacattggtgggacttattagcagaggag
aacaggaacgctaggacaaagtataaagcc
>SSO1023 (hycE) Formate hydrogenlyase subunit 5
atgaaatactataaatggactcaaaaaggcgagggaaggaaaataggcaaaataggggat
tattgtctctacgaaaaaacgataacagaagagaaatgtgaggaaaacaaaccaaatata
acacaaacgtatggatcattcaagttcatttacggaccctcagctggaggactactcgaa
acaataaaattcattattacaactaatggtgaaaaaattctaggaatagacgctgaggta
tacaagaacagagaaatagtaataagcggtttaactgtggacgatgccttactcagagta
gagagaataaacgctccatttagtgcttcccacacaatatcctttttactcgctgtagaa
gattcgttagaattagaacaagactatccaacccaactaaagagaatagccgaaatagaa
ttggaaagaataagaaatcacttattcgtaatatcgagattaactgaaaccacatcacta
aacgtacctacataccatctcttgcacctcgttgaaaaagtcaacagattaataggcaaa
atgtgtggtcacaggtatttctttggcgttaatgcaattaacggggttaactgcgatttc
ggaaatttattaagaataatagatattaccaaggaatttaaacaaatcttcgatgggcta
cttgaaagtagaatcttcatagatagactccaagaaaacggaaaaataatagatgaaaac
agtataggaccagctgcaagagctgctggactcgcttacgatgcgagaaaggactttaaa
gccttaccttatgaagacttaggttttagaacagttatcacacaagaggcagactcattc
ggaaggttcctagttaggggaatggagataatcgagtcggccaaaattttagtagagtta
cacgatgaaataaagaacagcaataacgagagagggaaaaatcacaaacaaggaggggga
gagggactagccagagtcgagagtccatctggtgatctagcctattacgtcaagttaaat
aacgggattatcgactcagtatcacttctcactccttcacaagtcaatctcaacctattt
ttgaaaagcgtgataaacacaatatttaccgattttcaattcaattgggaaagttttgga
atttgggtaagtgaaataggagtgatgttaaag
>SSO10237 Conserved hypothetical protein
atgggtaataaagttttcacatttggtgatatcagaattagggaagttaagggaaagtat
tatgtttacttaatagagaaggactcagaaggtaagagaagggataattatgtaggtcct
ttagatgaaatcgttaaagggtatatgcgggggacgggatttgaacccgtgcaggccttc
gccagcggagcctcagtccgccccctttgccctagctcgggcacccccgcatatcaatac
tttatattaactaggtataaagttttacca
>SSO1024 NADH-Ubiquinone/plastoquinone related
atgaatattgaacccatactcttactattaattcctataataagtaacgtaggctttttc
aaactcaagctaattaagaccctatccgtactatcagcagtactaacatcaatcatcagc
atcttcctttacttcttagcaccaatcaaaaactctttcttcttcatcactaagttcaca
acgtttttcctattggtgattgcatcaatttatctcctatctaccctttactccatgaat
tatataaaaccaagcaaaatagtaagtgaaagattatactacattctactaaattccttc
gcatcatcaatgctttttaccgttattatgaacaattacggtctaatgtgggttggggta
gaactcacaactgtgacctcagctcttctaataatagcggaagcatctgaaacctcactg
gaagccacgtggaggtatataatcatagtatccgctggagtaaccttagccctattctca
ataattttcatctactataattaccatacattaactgtaacggaaatacttacaaaacct
gaaaacaacataataactaaacttgcggtagctctagctttaataggatttggaacaaaa
gcaggagttttccccatgtacacgtggttaccagatgctcatagcgaagcgccatctcca
ataagcgcattattttctggagtactacttccagccgcaacttacgtggtgtacatggta
tatcaagtaaatccattaaccaatatctttgtaatattcacaactttatcgataataacc
gcatcgattatcctaacctatcaatggcatataaagagaatgtttgcatactcaaccata
gaaaacatgaacctagccttgcttggacttacaataggccaacccctcggagcaataatc
ctccttcttgcacacgcatttggcaaagcgggtgccttttactctagcggaattgtattg
aaagtccttggagaaaagagaattgaaaacataggcggtttacatacaaaactaaaactc
acctcagtatcgctattattgtcctctctagctgtaactggtacgccaccctttgcaact
ttcataggagaattcttcatattacaaacattaattcaaaaaggttatattatagagttt
atattaatagtaatttctctggcaacagctttcatctcaataaactataacgttaccaaa
atgatattcactcaaagagagctgacagtctcagaagaacccaagctaatcacgttcatt
tctcttgtatcatctataattccactcgttctcggtatacttttactggtgatcctttca
>SSO1025 Conserved hypothetical protein
gtgattaactcagagatcctagaactactctcaacgttcatattaatttcagccttttac
attcaaggacaagcttactttaaaccagcaatatatgcacaagccattcaatctacctta
atcgcaattctagccttccatctaggaatctcacttttttccatcgactatataatttta
ggaataacagtaatactactgaggactgtactaatcacaatatttttatttagaggtcta
gttaaagagaaaccaggagctagagaaagctctaagggagtagcatctgaactaatattg
aatctcgcattttccattatagcatctctagtagtatattatttcgtattggagaaaata
cccataagtacggaaatcaacaacacgctaatgctattgttcgcctttgtcttactcttc
cagggtctattccttattatttctagaaaaagtacaatatttcaattcatcggtttcata
gaagaagaaaactccacaattctttttggtattttattactacccattcccttcttaata
gaagtgagtgtattccttgatgtattagggctagttataatttcctcaattttgacgtta
gaaaaagcagaacattctaggttagatgaactaaaaggg
>SSO10258 Hypothetical protein
gtgattgttgtagtcaagtataggataatagataaaaacataagaggaataatcaactct
ctaagaaaaataccgtttataaaggaaatactgttttatagtggagagaagaatagcata
tttgcaaacggctacatgatttgggaagaagggtctgatttaaatcctatagaggaagta
tatgatgtgaaaattatagaactttccagaagattgtatttcccaatatgtggt
>SSO1026 (hycD) Formate hydrogenlyase subunit 4
gtgggaagtatggcgccaaatgaagctcagatagtagttttaaccataactcaagttatt
gtagttattctactatccccattatatcaaggaatttacgataggggaaaagccataata
gaagggcgtaaaggccccagtgttctgcaaccttactatgatataattaaactactaaga
aaagaaaccgttatttcaaataactcattatctctatttgtttatgctccttacatagtt
tttgggatttatctccttatttccttcgtcatcccagtagtttatccagtgcccatctta
ctcacccctacggtggatttcttagggggagcattactcttctccttagctgcgttcata
aaaataattgcctccctagaaagtggaagtaatttcgtagcattaggagtaagtagaatt
ctctctttcactttcttatctgaagctacactgataacggttttcttcggcgttgcacta
ataactggtacaaacaacccttacgtaacattagattacgtttcccaaagcctctctcat
tactttcaactagaccacatcttcgtatcgatctcattcttcatgttatggttattcgaa
accggtaaattacccgtagagagtcctggactaagcgaaatgggtatgatagacgatgga
gttctctacgaatatagcggaaaattacttgcaatactaaagtggggttcttacatcaaa
caatatctattaggctcagtactcctaaacgtatttatattcccttggtttttgcaagtt
ggaattataggctctttaatagacattgcggtgatgttcggcaaatggttactcctaatc
cttattagcgttataataaacaccaccctagctaaattaaggctatttaaagttcaggat
tatctcgcagtggcgttcctcctttccctactttcattaacgcttactgtcttgttgggg
>SSO10269 Conserved hypothetical protein
ttgtcaattaataaggaaaaactaggtgcagacaaggtaataaaaaattcgttagactat
tgcgatttatatatcatacaaaaaggtgataaagtgtttcttctatacctatttgagaga
cgaggatactattatttcaaaataatgccggaaattgtcggaaaatgggaagattgtgaa
aacgtagtctatactgcatttgggctttttggttttgtaagtaaccaagaagaattagag
caaaaaattaaagagaagattgaggtgttaatgcgaaatgtcagtact
>SSO1027 Hypothetical protein
ttgattatcatgataggcaaggtaattgttgtactagcaatcattctagtaggagtattt
ctcttaactcatactaacctattctatcatccacagactccagtttctaaagggcaagag
tactatacgactacaaatgttcaaaacataacttatcaatttggtataatatcaaatgtg
tcaacaaattacactgttcccttgaagttaagttatggcaatgttacaattaaagtaatg
ggacataacgcgtttaacttaaccgtggtaaataactccactgtaatttactctggtata
gttgatagatattttagtaagacatttatcattggtggcgatgttaagttagtgttttca
tcaaggcaagggttagaagttaatgtaacgatttttgatgtgttaagt
>SSO1028 Conserved hypothetical protein
atgtataagtactttgacgctcattgccattattcctatttaaagaagaagtatgaaggt
tatcttatagctgcggtttcaatggattaccaatccgctatggatactttctccttaaag
agtgacaacgtattagtaggagttggtattcatccttggcgtgttcatgaggaggatctg
actagaattttatcgttgattattaaagctgatttcgttggagaagttggtttggattac
agattcgctaaggctcctaaagaattgcagattaaatattttgaggagcagataaaagcg
ggagaaggtaagttgataaacgtccacgctttagacgcttggaaagacgctttcaacatt
ttagttaaaaacgacgtgaagagtgctatctttcactggtatactggtcccattaatctg
ttgaaggatattgagagtgctgggtattttatttctataaatccttccgtttctttccag
aagaagcatcaagaagtgttgaaaaatgtcgacctaaaaaacgttcttacagagagtgat
ggtgggtatgaatataggggtaagctattagaacctagtgatatacctaacgctatctca
tttatgagcaattttttaggtatagaagagtataagctagtgagaataataagcaataat
tttttcaaagcttatggagtaaacccagttaataat
>SSO10285 Hypothetical protein
gtgaattttgaagatgtgaaagataaaaaaccaaagaagataggcgagttgattgatagg
agcgaagagagtgataattacatagtaaaagtggctgaagacaaagtatacgagcttgct
cctatagcttattatatttgggctatgtgtgatggtaatagaagtgtggatgaaatagtt
aatgaattaagtaaagaggcaaatttagatatatcacaagtacgtgaccccgtagtaatg
gtattagacgagttagaaaaggcgtcactcataactttt
>SSO1029 (fdhF-1) Formate dehydrogenase Alpha subunit (EC: 1.2.1.2)
atggaagttaggaaaaccatatgccctttctgtggtgtaggttgtggtctagatttttat
gtagagaataactttatatttagggtatctccatcacaagagcacattgttagcagagga
cacgtttgcggtaagggcgctgttgcttcagaagtaatttacgcctgggaccgtttaact
tatcctttaaagagagttaaggacactttcgttaggactacttgggatgaagcaattagc
gatattgctagcaagttaaaggaaattaggagtaagtatggctcagaggctattgccttt
tacgggggttgtcagaatacgttggaggaaggatattcgttcatgaagttggctagagct
ttgggtactaataatgttgactcgtgtgctagggtttgtcatgagccctctgcaatggct
ttaaaggagttagtcggtattggagcttcttctgttaccgtttctgaaattttgaatgct
agaaatattgtaatttctggagaatctgtgactgatagccatcccgttttgtctcaatat
ttagttgaggctaagagaaagggtgtgaaaattgtagttattgatcctaggatgactggt
actgctaggattgctgatttgtttttacagattagtagtggtactgatatttatctatat
aacgctgttgcgaattatttgataagtaacggattatatgatagtaagttcgttaaggaa
cgtgttgagaactttgatgagtttagggagattgtaaagtcttatactattgaggaagcc
gagaggattactagtgttagtaaggataagattattgagttcgctaggattattgcaaat
aagcctacaatactctcatggggtttgggtttaactcagtcaagtggcgttaatgccgta
aaggcttacattaacctagcattgcttactgggaatgttggtattaatggtgggggacta
ttagtttataggggtcaaacaaatgttcaaggttctggtgatttaataaagccagatgtt
ttcccaaatggtccaatgaatgaggaaaacgctaaggagttgagtaagatttggggtttt
gttcctccaatcaagaagggtttgagcataactgaggcttttctaagggatagtaatgtt
aaggcactttttctaatgaattacaatccagcttttagtttgccaaatagatacaaggtt
attaagttcttgaagtcgttggaattgttagtagtaatggatccgtttatgactgagact
gctaaatatgcacattacgttttgcctactcctttatgggctgaaaaggagggttcagtt
actaatttagatcgtactgttaagtggaggtttaaggttgttgatcctcctggggaggtt
aggagtgagttgtggataattaagaggattgctgagaagttaggtcttactggttttcat
gacgatcctaaattggtgtttaaagagataaaggaggttgcaaagttgtactctaatttg
acccttgatgaattgatggattactctgtagactccaggtatcctgatcacgagtctagt
ctgtacaaggataggtttatgactcctagcggtaaggctaagtttggattagttaggtat
aacgaaatatctggtgatagttacattttaattactggtagagttgtgactaggtataat
tctgatgagttgatcaagagagtcccaggatataggaatttcagttctgatttgttgata
aacccagaggatgctacaaagctgaatatcaaagacggggatatggttaaggttgtttct
aaatgcggcatggctgtgatgaaagccaagctaactaacgaggttaaggttggtcatacg
tttgcttatatgcatgattactatgtaaacaacgttgtctgtgacgatttagatgatatt
tctaagactccaagatataagataacctttgtcaagattgaaaaattggga
>SSO1030 (fabG-2) 3-oxoacyl-(acyl carrier protein) reductase (EC: 1.1.1.100)
atgtctgaagttgctattgtaaccggagcatcaaaaggtatagggagagctgttgttaag
ttacttaaggagaataattatactgttgtttcgatttctaggagtaaatcggatattggt
gatgtaatttatgatgctgatgtcagtgataggagcactgtatttaggattgtaaatgag
gtactggagaagtttggcaagattgacgtcttggttaataatgcaggttttggagtttat
ggatcttttttagagactgatttaaacgaggaggagtacatgattaggactaatcttcta
gccccactatacttcatgaaggccgtgcttccacatatggtttctaggaggaagggaagt
gttgttaacatcgtttcggaagctgcttacgtatctacacccaagcttttagtttactcg
gcaactaaggctggtttagccagtttaactaatggcttgtgggctgaaatgaggaaatat
aatgttagggtaagtggtgtttaccctggccctgtcaggactaattttacctctcatcct
tcatttaaaaagaataatggcgatccttttgctaattatagcgttgagccagaggctgta
gctaaagccgttctaaaagcaataaggactggtaagagggagatttatgtaccttcaagg
ttgaaattggacccctatttccttaagcttgctaaccttttccagagtttcacttatact
atagtaagtaattattttagc
>SSO1031 Conserved hypothetical protein
ttgttagagaaaaatttattaccggaaatattactggctatacatatgccgttaaataaa
gggttaactagggttaaagctatcgtgataataattgttgttataatcgcagtgatagct
ggggttgtaggatattatttaattaatcatccttctaattctgtaactacttcatcttca
tctactacaactagttcttccctatctagtactagcatatcttcatctactactaatatt
acttcatctcaaggtattacagtcttcgtagcgggtgcttatcttgcaattctcaactac
ctagctgaccaatttcagaacgctactgaaattccagttcatgttgtaggtagtggctcc
ttcgcattagcttcacaaatagcttcccagactccagttccagcaaacgttttcattcca
gttgcctatattcaagctgttgagttaactggcagtaggaatcccggttgggctatagct
tttctatcagatcagatgacaatagtttactctaactacactaccaaatctccttattgg
tcccaactatactccaattacaccatggctatggagaccaacaatactaagtattggtat
aatttcttctacttattgaccaccaggttcagtctgggaattgctaatcctaacactgac
ccagagggattatatgcgtatttgatacttcaaatggcaagttatttatatgctaatcat
aatataagctactttgtgcatctcgttaaagcgaatccaaatgtcaaagtagcccctagt
acagctaactatgtagcgcccttaaaggcgggtactttagacttcacattctcttatgtt
tcctatgctgtatctcaaggattggaatatctaaaactacctccttggttaagttttggt
tattatccgaacgagacgacatggtacagtcaatttgcttataatataagtgtaaatggc
caaacattaacaattcatggaaatccagtttacttatacattaccattccattaaacgct
tcgaatatacaaactgcatatcagtttattggcttcgtactgggtcatgaatctcaactt
accagatttaatgtaattccaatacaaccagctttattgtataatgaaactagtaatatt
ccgcagcctatattgaacttgttaaaatctggtgagttgaagtatgcgggtaatttctct
gaagtt
>SSO1032 Sulfate ABC transporter, permease protein
atgcgggtaatttctctgaagtttaataccctacaagccatatccttttttctatctctc
cttttagctttaccaactctctatttgctattttacggctatggtccgttttttgttaaa
tcagtcgcgttcagtagctctttactttcctcaataggtttatcgttttttgcttcagcc
ctttccattgtaataactgttcttatctttactcccttggcatattatttatcaagacat
aggaatccaattattgagactttagtcgatgtgccagcatctataccgcatcccctagtt
ggcattgctttaattttcattgatagtcccactaatcctctaggtgctttactttactct
catggtattattttttactacacttatactggcttattgttggctttgattattgtttct
agtcctatctatattcgttcgatgcagaatttcttcgagtctcttccaaggtcttatgaa
atatatgccatgagtttaggtgcttccgagttcaaagtatttacttccgtagttttccct
ctttcaattagggggataatatctgctgggctaacttctattgctagagctataagtgaa
tttggatctgtggtaatagttgcaccttatgttactggctggttgtttaacaacgcgtat
gtggcttcagtatatatttataatgaatacgaaacgtattttagcgcttcaataagtgcc
tcagctacgcttctccttttctccctcatactaatagttacaagtaggatagttaaccat
ttcttgtataagaca
>SSO1033 Hypothetical protein
atgaagtatggtaatatgaaaaaatgggcgccattaatattatttctattttctctatta
ttattacaaggaatatctcttcatgcctcttcaccgtcattttccgtgaatgcaagttat
ttagcatcattgccttacgcaaattctcatgtcgcagtagtatactatcaaggtagctta
tatatcataggtggggattcacattcaaaccaagtttggatatactccaatggcacatgg
aatatcgggcctagtttgccttttagtttagtttcaccttcagcaatcgtctataataac
acaatttatgttatgggtggttataatagcactgggataaatccttacgttcttaaactt
aatggtaattcttgggttgtcgtaagtgaaatgccactcccagcatactcaccttacata
tttgtttataataatgcgatttacgttattggtggagagaacaccactagcccagctggc
ctttattttccaccttctaatgcaattagattattctaccccaataacgatagttggagg
ataataggttacatgccagttcctacatatggaggtgggtatgtatttaatgggacttcc
ttgataatagttagcggttacattggatatagtgcctataccaatgacatattgatttat
agtccacaaaacaataattggactattcttaatggcgttcttccctactggattcacgat
agtgccttagcctattataggggtgttttgtttattgtgggtggttatatttatactgca
ggttctggtggggttaataacgcaatccttgcctactataatggtaatttgcaaagagtt
ggatatcttcccgtcccagtatattctgctggttatgtacaagtaggaaatatgttgtat
cttgctggaggcattggtagttcattaagtgatgtctctgctttacagctaatcacgttt
aacttcccacctcttccccctaagataacctcttattctgcaggaaatgaatccgttacc
ttaggctggaatccagttagactatctagtggttatgagataatatattggaataacatg
ggattcaacagctcaattaatgtaggtaacgttactagttacactgtaactggtttgaaa
gatggtataacatactactttgaggttttagcttataattcaattggctattcttctccc
tcaagtataatcgcgttaactccagcttcagttcctaaccctccacaactcgtttctgtg
aagtacggtaatgataatgttacattgaattggttgcctccaactttttctggaggctat
cttttactaggttattacgttattgttaagaacgagaattcgatggttagctcacatttc
gttaatagtactagtttgacaataagtaatctgacaccaaacgtgacttataacgttttc
atttacgctgtaaataagcttggtaatagctctcccctagtacttaccgttgttccaatt
accaaggctagtgtttttgcatttataactaaactgggaaatggaattttagtcaattgg
actacttctttcccagctaatataactttggaactgtataatcctaatggtaacttaatt
tctcagattgcagctataaagggtaatagtagctatttgtttagagtacctcaaggtaat
tatacgctagtaataatagcttcaaactcagctggggtttctaaatacgtttatcaagta
gtttactatttaccaccagcctctccgcaagtctcgcttatcggatttggaaataatctg
tacattagttggaataatgaagcgaatgtaatcacatatctcgtttacgttaataatagt
ctggtttatgagggaccaagtaatagcattgtgactaatattagtaatggtacttattta
gtaaaggttatcggtgtgaatccagctggctcttcatctcctggcattgctgtaattcac
tataccggtgattacgtcactgtggttaagatgaaggttgttaatgttactattgtcagt
aagatcgcttcggcagtatcaggtaatggcaataatttaagtttaggtcaaagtattgtt
atcatattactggctgtaatgattttgttgagtattgctattattacgagaaataggagc
aatggatttgattgg
>SSO1034 ABC transporter, ATP binding protein.
ttgagtgagatagttaaagtagatgtttttaagaaatttaaaaattttgagctaaaagta
aatttcagtgtaaatgaaggagagaaagttttaattcaaggtccaaatggttctggtaag
actactttactatatctaatttatggcgtgttaaatccagattctggatacgtaagggta
tttaataagaatccaactgtagagctaagaaaaagtgaaatgtacatgctagaggagtat
ttaatatttctagaaaatgctagtttaaaggaaaacttagagttcataacgtcattaagg
gattttaatataaataaaacagaggagctaattaataaattcgatctacctctttataag
aaatcttaccaactaagttctggtcagagaaggttatttaaattagctttagccttctct
gccgaggccaaattactactacttgacgagcctacatctaatttagatatagaaaattct
aaagcggtcaaggatatgataagggagtatagcggtacaataatttttgcttctcatgat
cttctgctcaaagaatcatgtgataagacaatatatttaagaacaggaaaaatagagcga
attgagattaaa
>SSO10340 Transcription regulator, putative
atggcagaagttgtaagagcctatattctcgtctctactactgttggtaaagaaatggaa
gtagcagatatggctaaaaaggtctcaggtgtaataagagcagatccagtttatggtgaa
tatgacgtagtagtagaagtagaggccaagtcttctgacgatttgaagaaagtaatatat
gagataagaaggaatccgaacataataagaaccgtaactttaatagtaatg
>SSO10342 Hypothetical protein
atgagagttgtaacatttaaagtggaagaggatttgttagaactattagatagatatgct
ataaaatacggtttaaatagatctgaagccatacgtaaagccatagaaaaaatggtaaga
gatgagttatcaaaggagagagtcccagtggcaagagtggaaaagataaagctt
>SSO10348 Hypothetical protein
ttgagaaaatatatgacgaatttcacgattgacctagactcttatacatgctcaagtgac
ccattagaggctatagagtatttgttcaataacaacaatgtgatcttcaagataaaatca
gcaaatccatatttcgagataataaaagatagatatacgattaacataattaaacaagaa
ggtgatacaatttactttataatacgttatggtgga
>SSO1035 Hypothetical protein
gtgctaaatatgcttaaatctatttttaaacaattcttaacaagaaatagtataagagat
ttagtaatatttttattaattcttttattatttcttccaatcttgcaccttttctttttt
gccttatttagttccctaaccatatatcaagttagagcaacgagttatagcaatctatct
gtggtaagtatagccggtaataacaatactttagtaataaatcagttagaaaggctcttc
ggtaataattctttagcaccttttggatatatttatataggggctagacttggtggagct
acagttgaggctattgcaataaataatttaagtttggctaagaaaatatttcctatttcc
tctatgatcgcaataggtagatatccagaatatggagtatatttggtagctggtaaaatg
aatcagcttaatcttcagctaggtgagaacgttagtgtatatatgggaaaaaatatcata
agtttaagagttgttggaatattatataacgcgttcttttccgcagaaggatttgctatc
ttacctttaactaatataaactacactataaactcattagataatgttataattcttaaa
gataattatactgctttaaatgaattcaaagctttcttatctaatacaaaatacgaaggt
ttaccgctttcagactggtattctataactcgatttggttcctcgtttacattttcgtat
tttcagcttaactcattaaggactacctcagaaatagtcgaaaccatttacattctgatc
tcattactccttatatttagaattagaagtagattttcaaacgttctggcactattcata
attaatggagtagacgagaagagaagttttaagctgctaatattaccgtttctggtaata
ggtataattccattaatagtatatatagcttattattatttatacgatgtctactggtat
ccattatcggtcgtctatccattcatagctggactaattggattattagtatcttctatt
ttgattgagtactatacggtgttttctgcttacagtaatcagcacaaattcctaaaggtg
aggagtattgag
>SSO1036 Hypothetical protein
ttgttactaactacagtattaacggaggtagttatgcctaaactccaaataactggagaa
ataggtggtattccgccagttaatgtggtagctgctaactggggtaatgttaaagtatgg
gctgcagcttattattcaatatggtttattacatcacctgaaactatcggatactacata
gcgcaacccattccatctaacacaaacctgataggacaagtggattatggagcagcagga
gcaataaatcttaatataacaccatggtgggctcgttcagtatcagtaggttcagggtat
tcatattcctatcagacattatccataact
>SSO1038 Conserved hypothetical protein
atgggttggagaagatggaagattatactctataaaagagagaaaggaatacgatgcaga
gacaatagccaaaaagaatatagttctaaaggtgaagtacaatatcgagagttattggct
acaaaacacggaagatcaacaaataatgaaattcttgaggaaaactccaacttggttaaa
ataagctgttttatctaccctacttattctaaagaagttgaagaagagctaagaaaggcg
ggatttgattacgcgtactcatttggtcaaaagaacttagggagtttaaaagtattaggg
aaaggaaaaactggaatagtagtattagttgaaccatacaaagtcctaaaaataaggaga
acagatgctcctaaagaaaccttagaaattgaagcaaaattacaaatcaaagccggagag
gaagtagcaccaagggtttacgattacggtaagaattttattttaatggagtatatacat
gggagaaatttaatgaaaaatgagagaagagaaacaataattgatttactagaaagagct
agaattcttgaagagaaactcatagagcataaagaattgagtagaccatggaaaaacgta
atagtctcgtataacagaacgtatattatagattacgattctgcgacaataaaagagaaa
cccagaaatgtcacaaaactactttcaaactatctaaataggcgtgacttgggggtcaag
tattctaaatctgaaataacttttgaccagctcttatctcagttgttc
>SSO1039 tRNA nucleotidyltransferase (EC: 2.7.7.25)
ttgatagaggaggaagtactgaagataataaaacccactgaagaagacaaaaaaggaata
gaaaaagtattggaaatcattagggaaaggttaaataaattagatttcgaggtcgaggga
tcatttaggaaaggaacttggctaagacaagatacagatatagacgtcttcgtattttat
cctaaagatgttggaaaagaatatctagaaagaaacgctctaaacgatattattaacaga
ataaaagatctcgattatactttagcatacgctgaacatccgtatgtgatagtcaatata
aataacgtagaagtagatatagtcccagccttgagagtggaaagcggagataaggcaata
actgcagttgatagaacaccattccatacgaaatacgttacttcccacttggacgaaaga
ggaaaagatgaggttagattacttaaaaggttcatgaaaggaataggcgtttacggggct
gaattgaaagtacaaggattctctggatatgcaacagaactcttaattatatattatgga
aattttagaaaagttctagaagaggcctcaaaatggaagcatccaataaaaatagaatta
acgaaaccaatgaaaattttttctgagccattaattatcccagacccagtagaccctaaa
agaaatgtaaccgccgcagtgtcattaaaaaatatagcgacattttccattgccgcaaaa
tattatctaaaaaacccctctatagagttcttctttccatcaaaaaaagtagaggaaaaa
gttaagggagacgtgctaattttaaggttaaatttggacgagaagagttcagaggatatc
gtatggggtcaaataaagagaagtgtaaacaaaatagagagagcactaaaacaatatggt
tttagagtaatcgatgtacaagcatggggagataccaataatatcactattgcagtacaa
ctggaaagtaagaacattggacagtattatctaaatattggaccacaatactactcagga
actatagaagattttattcagaaaaatgataatatatgggttggagaagatggaagatta
tactctataaaagagagaaaggaatacgatgcagagacaatagccaaaaagaatatagtt
ctaaaggtgaagtacaatatcgagagttattggctacaaaacacggaagatcaacaaata
atgaaattcttgaggaaaactccaacttggttaaaa
>SSO1040 Conserved hypothetical protein
atgaggctctttataggcatagaagtaccgcaatccccaaaactgcttgaaatattcgag
atagtaaaaaatgcaggagccgacataaaattggtcgaaccatataacattcacattaca
ctattattcctaggcgaagttagagaggatagagtagaagaagtgaaagattcaatgagt
gggttaaaattcaataaatttaaagttacactaaaaggtttaggggcatttccaaattta
acaagaccaagagtagtttgggttggaatcgttgagggccaacaacagcttagacagatt
agatcttatatacttaacgagctattaaagcgaaaaattagaccagaagacgataaggat
ttctcaccacatttaacaataggcagggtaaaaagctacaactccattagcaacctcata
aatacgattaacgagaatatgaacgtggatattggaacctttgaagttaataatgttgtt
ctctttaaaagcacgttaactccaaaaggtccaatatatgataaactatttgaagtgagt
tcaattgatagaggaggaagtactgaagataataaaacccac
>SSO1041 (adkA-like) Adenylate kinase related protein (EC: 2.7.4.3)
atgagttatttggtggtcacaattaaagtcattctaattactggaatgccaggatctgga
aaaagtgaatttgcaaagctgttgaaggaaaggggagcaaaggttatagtgatgagtgat
gtagtaaggaagagatactccattgaggctaaacctggagagaggttaatggattttgca
aagaggttaagggaaatttatggagacggtgtggttgcaagactttgtgttgaggaattg
ggaactagtaaccatgatctagtagtgtttgatggcgtgaggagtttggcagaagttgag
gagtttaaaaggcttttaggtgacagtgtttacattgtggcagttcactctccgcctaag
ataagatataagaggatgattgagaggttaaggagtgatgactctaaggagatttctgag
ttgataagaagggatagggaggaattgaaattgggtatcggagaagtaatagctatggca
gattatattataactaatgattcaaactacgaggaatttaagagacgctgtgaagaagtg
acagatagagtgttaaaaaatggt
>SSO1042 Conserved hypothetical protein
atggttaaagttatggtagtcgcagaggttagaccttcagaggacgtaaataaggttctt
tcagcaatttcaaacttctttgattttgaaaaaatgaatacgagaaaggaaggaattatt
gatattttagttttagaagctagaacacttaaaagcttactaaaatttcatagagtgtta
aggaatgaacgaattttggattctgctaggaaatacttgatgaagggaatagagggtaac
acaatagcttttatgatacataaacaagctgcagcagttggtgttttaagcttcgtcgat
agcgataaggaatctcctcttggagcaatcaaattttatatagaataccaaaatcctaaa
gagatagtcgattggttagctccaaaaacggctcatggagtacctctttgggataacccc
gttcctccagatgtc
>SSO1043 Conserved hypothetical protein
gtgattcaaatattctttttaggtacgggagcaggttccccttctaagaagagaaaatta
ccagcattcttggtaaggagagagggagtaaacattttattagactgtggagaaggaaca
caatatacgttaatgaactataagttaggaataaattcaataaaaatcataggaatatct
cacatgcatggagatcacgtatttggactactaggagtgattgcaagcatgggtcttcta
gatagaaaggagacattatatatactaggcccaagaaaacttaaggatttcctatacaca
tccttcgaatactccaaattcaatccttcattcaagatagagttcatagataactataat
gacgagaatattacaatttctacatttaaaacttgccataccatagagtcccaaggatat
ttaatcatggaaaaggatagagtaaaaatagatgaagaaaaattagaaaaagaaaaaata
agagattggagagtaataagaaaattaaaagaaggaaagacagtggagtataatggcaag
ttattaaagcctgaggactatttagtgataaagagaggatcgaaagtagcctatactgga
gatactatgccttgtcaatctgtagtagactctgttaaaggtgtcgatatcttaattcac
gattcaacattcttagatgaaccctcagcttatacgtacggacattcaaacgtaacagat
gctgcaaaaatcgctttggaagcatcagttaaactgttagcattaacacacataagtccc
agatatgaggacgtaagtgagcatttaaaaatggctaggagaattttcccgaaatccatt
ttaccagacgacctatcttacataactattaag
>SSO1044 Conserved hypothetical protein
atgaaaactacatcctatgccgtattaaaagggaacaactattttttgtcattggccgaa
ttgagagctctgcttaacgatgataacgctgagattaactatttcactggggtagcaata
ttcgaaggaaataaaggagacatagctaacagatcggctagaataaaaagaagtggcgaa
cttgtgtatatctcagatgatccgaaaaaaattaatgagatgctaagagggggatgtttc
tggataaaggaagacgtaataatgggctctcaaaaggataagttgaatgcaataaattac
gagataaaaagaggagtaaaagtgtcgaaggaatgcgagaaaattgacataatactaact
gacggagtgattatattgggaaaaataaagggacaaattgactctaaaagtctccatgaa
cacgagaagaaaccattctctcagtctggaacaatgaaccctgagacttcgagattactg
gtaaacctctctagacctaaaaaagaagtacttgatcctttcgtcggtactggatcaata
ttaatagaagcaagatggttgaactatgagtgtataggaagtgacttagataaagcaatg
ttacaaaagaccaaaataaacctaaattatttcaattactattgtagtttattattctct
tctgctactaatttaccatttcgccaaataacgtcaatagcaacggatcccccatatgga
agatcaactaaaaataagggtgcagaattaacccaactctatgaggaattcttttcctca
gcatcagagacgttaacaaagggtggatttctggtcttcgcaacagactcacgattcaat
tttatagataaattaaaggaaaatagttttattataaaaggtctacattacttatactca
cataagagtttaacaagggcaatttacgtggtgcagaaaaag
>SSO10449 Conserved hypothetical protein
atggctaagaaaagaagcaagctagaaattatacaagcaatacttgaggcatgtaaatct
ggatctcctaagaccagaataatgtatggtgccaatctaagctatgctctaactgggaga
tatataaagatgttaatggatttagaaatcataaaacaagaaggaaaacagtacatgtta
actaagaagggagaggaactacttgaagatataaggagatttaatgatatgagaaagaat
atggatcaattaaaggagaaaattaatagcgtgctatccattaaa
>SSO1045 Ribose phosphate pyrophosphokinase (EC: 2.7.6.1)
atgataataatgataataataggtggatcagccactaatggaatagacgaaagcttatca
aaaatattatccatacctttagtaaaagtggaaaacaaaatatttcccgatggggaatct
tacataagagtaccctcttcaataagagatgaagaagtattattagtacagacaacagat
tacccacaagataaacatctaatagaactatttctaattgcagaaacaataagggatcta
ggagctaaaaaactgactgctatagtaccatacttagcatatagtagacaagacagaaga
ttcaaagatggagaagcaattagcataaaaacaatcttacatatactgagcgaagtagga
gttaacactttagtagtagtagaaccacataagccagaagagttatcgtactttaaaggg
gaacttaagatagtccatccttatcatcaaattgcgagaaaaataaaagaaattatcgaa
gacccattcatattggcaccggatagaggagcattagatagagctagaaaaatcgctgag
gaaattaatgctccgtactcttatatcgaaaaggaaagggatagaacaacgggtgaagtc
agaataaaagaggcgccaaatattaacctaaaaggtaaagatgtagttataatagacgat
ataattagcacagggggcaccatagtacaagctacacgcttagcctattcattaggtgct
aaaagcgttacagcagcagcaattcacctattgctagtaggaggtgcaaaagagagatta
agagaggtgggagtaaaaacgttaataggaacaaataccatcaatgtaaatgataaagat
ataataactatagacgtttcacaatcaatagcactaagctta
>SSO1046 Conserved hypothetical protein
gtgaaaagagatatgtactatgtttttatacttggaactgcgggatcaggaaagacaacc
ttgacaaaaaatttacaagattatttacttgatcaagagatggatacggcagtaataaac
ttggatccagcggttgaacacttaccttatacccccgattttgatgttagagattatgtt
gacgcatatgaggtgatgcaaaactatcatttagggcctaattctagtttaatagcatct
attgatttaattttgactaaggcgtctgagatcaaatcggaaatcgatcaaattgaagct
aattatgtactagttgatacacctggacaaatagagctatttgcgtatagggatactggt
aggctaatttcccagttaattagaggaaataataaggcattgggactatttcttctagac
tcttttttagctaaggaagctagaagttttatatccttattacttctttcaagttccata
aaatttaggttggacttaccgattatcaatatacttaataagatagatcttctgacagaa
aaggagttagagcagatattggcgtggggagataatgctgagaatttgattgacgagttg
ggtaggttagatgagtattcccttgagctagttaatttattaatagaaagcttgtcttat
aacctaattcccatgtcatcagaagagggcaagggatttaacgaactctacgctgaaatt
caaagagtaatagctggtggtgaggattatttaactgaagagtctaatcctaagtta
>SSO1047 (pcnA-2) Proliferating cell nuclear antigen homolog (PCNA)
atgatgaaagctaaggtaattgacgctgtctcattctcttatatattaagaactgtgggt
gacttcttgagtgaagccaactttattgttactaaggagggtataagagttagcggaatt
gatccttcaagagtagtttttctagatatatttctcccatcgagttactttgagggattt
gaagttagtcaagagaaggaaataatagggtttaagttagaggatgtaaatgatatacta
aaacgtgttttaaaggacgatacgttaatactatcctcgaacgaatctaaattaacactt
acttttgatggagaattcactagatctttcgagcttccattaattcaagttgaatctaca
cagccgccttcagtcaatttagagtttccatttaaggctcaactactcactataactttt
gcggatataattgacgagttatctgatttaggtgaagttttgaatatacactccaaggag
aataaactttattttgaagttattggagacctctccactgcaaaagtagagttgtcaacg
gataacggtacgttattagaagcttctggcgcagatgtcagtagcagttatgggatggaa
tacgttgcgaatacaactaaaatgagaagagcttccgattcaatggaattgtattttggt
tctcaaattcctttgaagcttcgatttaaattaccgcaggaaggctatggggacttttac
attgcaccaagggcagac
>SSO1048 DNA primase, putative
atggggacttttacattgcaccaagggcagactaatctaataaagagtttttttaggaac
tactatttaaatgcggaattggaattgccaaaggatatggaattaagggagtttgctctc
caaccatttggctcagacacctacgtaaggcatctttccttctcttctagcgaagaatta
agggactacttagttaacagaaatttaccacttcatttattttactcttcagctaggtat
cagttaccgagcgctagaaatatggaggagaaagcttggatggggtccgatttgttattt
gatatagatgctgatcacctatgcaaattaaggtcaattaggttttgtccagtttgtggt
aatgccgtagtttctgagaaatgtgagagagataacgtagagactttagagtatgttgag
atgactagcgagtgtataaaaaggggtttagaacagactagaaacttggttgaaattctt
gaggatgacttcggattaaaacctaaggtttacttttctggaaatagaggttttcacgta
caagtcgattgttatggtaattgtgcattattagattctgatgaaaggaaagaaattgcc
gagtacgtcatgggtattggtgttccaggctaccctggtggtagtgaaaatgctccggga
tgggttggaaggaaaaatcgcggtataaatggggttactattgatgagcaagtcactatt
gatgttaagaggctaattaggattccaaattctctacatgggaaatctggattaattgtt
aagagagtacctaatttggatgattttgaatttaatgagactttatctccatttacggga
tatacgatatttttgccgtatattactatagagactgaggttttaggtagtatcattaag
ttaaataggggtataccaattaagattaaatctagtattgggatttatcttcatttgaga
aacttgggtgaggtaaaggcttatgttaga
>SSO1049 Hypothetical protein
atgttagatgaattggttaaaaaggaattatcagaggaagaaattactgaaattaagcta
gaggaaataatcaagtacatcactctcattaagaaatctaaaacttttgttagttctgaa
atcagaaaggaggaattgaaatttctttcagagctggctgaatcgttatttgagctaaga
ttgtcaaaagttctagagggaaaggtcggcaaagggtttgacgaatttatcttcgatatt
tttaagatattaaaacaattttacgttgatttattaactggcagatacataatttataat
gataaaatctattgcatagtacagaaaccattaatatataatgatcacagggttaatgag
ggagatgttttggttttacctatgagagaagccttgccattaataatagcaagttattta
actccctataagatagatattgaagaacaatta
>SSO1050 (eiF2A) Translation initiation factor aif-2
atgatttacagtagaagcaaactaccctcagaaggagaaattttaattgcaactgtaaaa
caagtttttgattatggtagttatgtttctttagacgagtatgggggtttacaggccttt
ttgccttggagtgaagtaagtagcaaatgggttaagaatataagggatgttctcaaggaa
aataggaaagttatagtaaaagtaattagggttgataggagaaaaggtactgtagatgtg
tcattaaagaaagttaccgatgacgagagaagaaagaagaatttacaatggaagaaaatc
caacgattagataagattttggaactagtatcgcaaaaacttaaattaagtgaaaaagat
gcgtgggaacaagttgcgtggaaattagaagccaagtatggtgaccctattacagcaata
gaaaaagctgttaaagaaggagagaaaatactaattgatgcaggagtcccagaaatttgg
gttaagccattactagaagaggcttcaaagcacgctgaggaaaggaaagtgaaaatgtct
ggtcttataacagttaggacaaatgagccattaggagttgaaaagattaaagaagtgatc
tctaaggctttagaaaacatagaacaagactatgagagcctattaaatattaaaatatat
actattggtgcccctagatatagggttgatgtagtaggtactaatccaaaggaggcctca
gaggcactaaatcagattatatctaatttaattaagataggaaaagaagaaaacgtagat
ataagtgtggttaagaaa
>SSO1052 Oligosaccharyl transferase STT3 subunit (B5) (integral membrane protein 1)
atgcaatcagttaagggactgagaagagatttacgaaaaatgtcattcatagacttacct
ctaatagtgggtctttcattagtgtcaatattaattagaagcctaagcgctaattggcct
ttagcagttaacgaattcgatccttggtatctcttctacaacgcattgctgatagcgcaa
gttcatggaaattggtatgcagtacctccagacgtactgggctggttcccgtgggggtac
tttattgaactcgggaatactataggcttgccattcttggttgcattagcctctttaccc
ttttatggaacttacggagcaaatgcagtatatacggtagcgatattttctgacatttta
ttagctggactaggcgttatagcatcatatctttcgatagaatcaattactaatagtaga
ttagccggttatatggctgcagcaataatagcagtttctcctgcattaacatataagaac
ttgttaggtggacttcctaagacatcgtggggtgcggtatttatactatttgcaattttc
ctcctaaatcaaggtttaaagaagaagaacatctggtatggcataccggcaggtatagtg
ctatttttagccgagatttcttggggaggttacacctatattgacttaagtttgcttgta
gcagcgttcttactaattctcttaaatagaaatgacgagattactgcaaacctttacaca
ataatggtagttgtaacttcgtttctaacttccttggccccaaataatataggtttcatg
tcgggactagcacatggcttttccttacttttgatctccgcagttctttatctagactta
tatctatccagaacacttcctaaagaaatcgtagattcaagaaatttaatagtaattgcg
gtactaatttttatacttactttaggattgtctgggttatcaatactaagacctacatca
gccccaataccctcaaggtattacgctataataaatccgttttatcaggttacagtacct
atagataagacagtagcagaatatattcctcaaccaataaccgcaatgatccaagatttc
ggaatagcactattcttatcagtcataggaatgtactacttgataagaagaggaaaccta
gtgggtttatggctattagtgttaggagttgcgagtatatttggcacatcagaacaacca
tatctatttaactatacagcctatatggtagctacattaggaggtttaggagtatactat
atttcagataacctactaaagggagttaaaaatgggaatggtaacaaaatattggtaggt
ttcattttagcgctagtagggatatccttagtagcagatgctggattagcaacgctagca
agcaacgaacctccagcaataaccaatgcagctaccagcttcctgacaactaattattct
tgggtatctgcagcaaattggataagaacacattctccacaaaacgcatttgtattatct
tggtgggattacggatattggctagaagttttaacaaataggagtgtcatagatgaaaat
aatacacttaacgggacacaaattagattaatggctgaaatgtttttgaacaatgaaact
ttcgctgctaatgtactagaaaacgatttccatctatatccttacggtagtccaaactat
accataccagtttatatagtggcctacgatgctgtcacgtttgtgtatgctggtagccaa
gctcaatggtatgttggatatccgcctagttttcctggagcattctttggatacacaaca
agtttaggagatattggaaaagctatgggggcgatgacaacgatagctggatatccttta
gatgaatacgtaaatctaactgaaataaataatacgataacacaaataattaatacttat
gccactactaatccaactattgctcagaccttagcttcacaagtttcacaagctgaacca
tttgcgtggactcctaaggcctataactcacttatagtccaaatgttcattgagagtcta
tatcagataggatatggacaacctattgctccatttacaacgcaaatagtccctaccagt
tctggatatacgataacgggatctccattaccacgtgttcaactaatgtacttccaacct
gcatatatagcattattcccagtaggaaatggaggtgcgggaggattgtactacactgtt
tatataatggtaatggtataccagtttacccagcctggtacagtattaaaacctacagta
atggttaacagt
>SSO1053 Hypothetical protein
atgataaagaacagcgctttcattgctttaggaattatactcattgacattcttgttatc
tacttctttctctatatgccgttttcattatcaacattctacccctccttcttgcttggg
ccaatctacaattttaaccctatagaatacgccaaaagtttcccagtaagtattaactac
tcttcattaacttccaatgattcaagggcactcttcatttacaatacatctggaaagcca
attttacagcagattatcggtattttaaaacttaatgcaagtcgagtaagtccagaagct
tattggagtgttgcggatttagcgggtttcttttccaattatactgtaactaaaaattat
tctgtatactttctaaatccctactattacgataatatagcagaacaacctaatgtcaca
gaaatatatttaaatatttcagatatttatgcttctcccttttatacctcctatcctcca
agtgataagataaacgcaaccttctcctttattattacgaactcattttcgatccagagt
tacgctagttggaacttcactgatattgaatggcattttggaggaaatatatcccagaac
gaatcctactattactatactgctacattgaatttgaataaatatatggttgtcaacaat
tcacactactattatgaagggtctttgagttttcgaatagcagttaaaccttggggtgta
tccccaagtactatttcaacttacgtagtttataatcaaagcttaagtattcccttaacg
ctttatctatctacgcattcagtagagcatcagataggcaacaattcttgtgtgcttact
ccctcttatccacctaaggtaaaccaagaatctttcgggtataatttctataactattca
gcttatctctctctaaatgtagacgtttataatggatcatcccctgcgactttaatctta
ctcaacggcagcaagatatatacaacacaagaaaggcattttaattttacgttagattta
gaggaatttagcttttctcccaaagttttcaacatcagtttactgacttatgataatgtt
aaagtgggaaattattatattgataggtattggtccccaggatatatagtgatttatccg
cagaaacatattatatataatggaaaccttagactcattgtactgaatttttttattcaa
tatcatattatccagactccaccggactgggtttttaatcacaagccatatactgagata
tataagaacaattatgctaacatttatttacagcaagtaggttactactatggtcttaat
aggttacttaccgaaatcgtgaaaaactttactacagatgaaaaatatagtgtgtattta
agttgggaattgctattactttcgtctgaaatttctatgcagattaattactctagtcca
gctcaaaattacacaatggcattgttaagtaaagagggtagtgaatatcaagctttcatg
caaatggtttttatagtatcttggaatctgtggtatactacgtttaacggctcatattat
tttctaggtaaatggattccttggacctacggtcttttcaccggtttttctatcccaaat
ttttataataaaacatccgttctaccttatataatactaaatggctctaatagctcctat
ttgctttttaatattgaatcgtttagggtaacctcttggtggtatgaaaatgtgaatctg
gataacggctcaattcatgtaaactattttaacgtttattcatacattcctaagaaggga
gatgttttagtcctacataaatactataattttagtgatcttatatacgtaaatacctta
gtggcaaaatttgtagtaacggaaaacatgagtaatgggcccgacgggatt
>SSO1054 Ammonium transporter
atgaaatcgtggaaattcaaggcactgttaattggccaagtaatattggtaatgctttta
ttttcaaatattttagcacattctcaaactacaacaaattcatctgcacttcaacaacta
aatcaatcagtgcaatcaattcttaacagaacgtctagctatccagctgcagcagtacca
tcttggcttgatactggaagtaatgcgtggatgttaactgcagcgacttttgtaggattg
caaagcgttcctggtgttgcgttatattatgctggattgtctaaaaagaaatatgcagtg
aactctgcattaatgatattttatgcatttgcggcagtgttagttatatggataatagcc
ggatacagttttggtttcggttatcccgcactggtttccattcacggttatggaatattc
ggatatcctattcccgcatggggagggctttttgaagcttcacaaaccacctatggtcct
agtggtgctcacgctaatataccaaccgctacctttatattcttccaattcgtctttgct
gcaataacgccaatattattagccggaggagtattagaaagaatgaactttaaagcttgg
atggtttttgtacctttctggtctctcctagtgtatagtccagttgcatactggttattt
gcaggaggatggttaaatcaattaggtgctgtagacttctctggaggttatgtaatacat
gtagatgcaggagtaggagctctagctgcagcgttggctataggtcctagattagcttct
gaaagaaaattagaggcgcatagcttacctttagttttagttggagctggcttaatttgg
ttggggtgggatgggttcaatggcggtgatccattaggagctacagtggatgctgcaatc
gcagtgctgaatacgaatattgctaccgcagttagtgctgtagtatggatgttgatggat
atgaaattctttggaaaaccaacattaattggagctactagtggcgctataactggccta
gttgcaattactccagctgcaggttatgtaaacggatgggaagccgcattaattggaata
ttttctggaagtataccatggatggcattatattggttagagccaaagcttagagttgat
gatactttaggtgtgttctctactcacggtatagctggaatagtaggtggtttattaact
ggagtttttgcaaatcccgcagtcacacagtttgtggctccgggattaacaggagctctc
tatgggaattggtatcaactaggaattcaagcacttgcagcagtaatagtattcgtatat
gacttcgcaataacttttggccttctaaagtttataggattatttataccattacaagcg
ccacctcaagaactagcaataggagattacgctatgcacggagaggtagcatattcagaa
ttattagctacaattccagaaagcgctaaatctaaggaacagtcagtcgttttacctaag
aaagaaaaggaggagaatagtgaagaa
>SSO1055 Hypothetical protein
atgaaagaaaaggtaggaaatatagagcttgaagttgaggcgatagttgagattaacgga
aaggactataaggttgtaaatgtacctaatgctgatgaatataagggatttcctccctca
tgggagttcgtgaaatcacatatgctaacatggagaccttattttaaggccaagatgatt
gaaattaataatcaacttattcccgcagtagaagattttttacttaatctagacgaggat
atgtatgatctactattggatatttattatacatttaaagtgaataaaccctccatagag
actaacattagcacagtgcttactaggcaaatagacaagcttgaggaaaaatttggaagg
agatttaatgaagaagagaaaacgaaattatacattaagtatggaatagaggtagcaata
ttaagagatattggtgtgataaat
>SSO1056 Conserved hypothetical protein
ttgacagtgataacgtttactgcagaaggtagattagatggagataaagtcattgtggat
ctgaacgggactgagataaaggtaggcttattaggctctgataaccctaccccagaggaa
ttctgcctagcttctgcaatatcttgtcttatcttgactgtttactatattgcgagagaa
aaaggtgttactatcaattctattgaaggttacattgaaggaaaaatggatactaaaggg
tttcaaggagtagaagaggttcctccaggtttattggaggttagttatgagttaatagtt
tattcgaaagatagtagaattagcgatatattaaaagaagctgaagaacgatgtccaatg
agggatacgttaactagaagtgttaaagtaaatattaactggaaaattaaaagt
>SSO1057 Hypothetical protein
gtggggatactaatgacagtcgaagagagcatattgggaactggagagagggagagaaga
gaaatcgtaggctatattcagatgcttctagattctattaacgatttaatggtaaaatat
aagcaagaattaaagaatatgggtgtgattaatagactaggaattctaaccgagataata
accatgcataagtataatccagaagtatacatgggaaattactgggaggaattattaagt
ttaatcaatattattaaacaagaccagaaacttgccaatgaggtaaaggacatagaggaa
ttgattgagaaaataaatagtctgaaggaactggttaaattt
>SSO1059 Hypothetical protein
atgaaagagattgatttgacagaagaaaaagatgccaatgttaggaagtttattgttgtg
cagaatctacaatctgatgatactgagattgtattcaaagtggataaagatgggaaaaat
atgatagaagatctatgtcatgaattggagtacgagtgtgaagaatacgaaaaagatgga
gtatattctgtaaaaataaagaaaagtactgaagtaaaagggtctgtaagtgatgctacc
gattttcttgtacctttaccgcccaagagtgttaatgaaaaaattctgaatccagcaatt
ttgacattatttataccgcaaattaaagcagtttctagcattagagaaagaatataccta
ttaagaattaagtgggtcataagttgggatactcctttaactgtatatagtgtaaaactc
gatgataataggtacatagctagatattatgcgtcacaaaaaatcccattatttgttgtt
tcattcggatttgacttttatataatgtcagaaggtactggaagtaggataaaaatgaaa
gagtggtataagggaccctttaaacaactagctaaaggcgaaatagaaaaacacttaaaa
aaggcaaaggaggtcttacctgaatttctaattaaaatt
>SSO1060 (lplA-like1) Lipoate protein ligase A, hypothetical
atgagttggagatttgtctctctccctcctcaagatggctatcacatggtaacttcattt
gtatcggtagcggattatgtaaatagaggaggaaaaaatacattattggttttttcagtt
aaagagccttttgtaaatgtgggaatccaccaagaagtatggctagaagttgatttagaa
tttactaaaaagatgaaaatcccagtcgttaggcgtgatttaggaggaggcacagtagta
ataacaccaggtgagcatgattattttattgttgttagacaagaggacgcaccaagaaat
ccaagtgaattatataagaaattcctcacacccatagtaaacgttttacgttcatatggg
ttaaaagccgatttaagagatcaagatatagtagtaaatggaaagaaaataagtggaaat
ggcgcgatgacacacggtaattcaatcgtaatagccggcaacattttgttgagtctagat
attgacctaattagtaaatgtataagggttccaacagaaaagtttagggataaaatggct
aaggatatgtcagagtggttaacatcattagagagagaattaggatatattccgcctaag
gaggagattaacaagaaacttaaggaggcttttgaaaaggaattaggtataaaatttgag
gattcgacgttaacgccagaagaaatagaattatgggagaaattggcaagcgaaaaagct
aaagaggaatggatattttacaaagataataggcatcgtgatattcacacggagagatgc
gttaaaatttcgtctgcggcactctttgccaccttgactataaggctaggaagttgc
>SSO10604 Partial transposase ISC1058
atgggaaagagtaagtacaagagggactggagcaagtacgacgagaacgtcattactaga
tataagttgatgttccccttctacgtattcgaacattggtgggacttattagcagaggag
aacaggaacgctaggacaaagtataaagctccgaaggagttcaacgacttcctagccttc
ctccacatcttcctaccttacagagcaatagaaggagtattaagagccttagaacaattg
aagatcatccccacaagcctcgattactcaagagagtgtccaaagcgcaaa
>SSO1061 Glycine cleavage system protein H
atggtagttgaatcgaactgtgaaataccagaaaatctttattactttatagaaggtaaa
aacacagtttgggctaaattagagagcccagatacaatcgttgtaggaataactgatctt
gcacaaacgatggcaggaaagatagttaaagtaaggataaagaaaaaaggcaccaaggta
gagaagggaagaccagtagccactatggaaagtgggaagtgggctggaccagttccggca
ccagtaactggagaagttgttgaggttaatgcagaggctgagaaaagtccaatcattata
aatcaagatccatatggaaaaggatggttagtaaagatgaagatgagtaatccagaggag
ttaaaacaactatttagtggccaagcagctatacagaaattgaaggaattaatagcctct
gaaaaattaacatgcaagaggcta
>SSO10610 (ssh7A /Sso7d-1) 7 KD DNA-binding protein (SSO7D) (SSH7A)
ttggagatatcaatggcaacagtaaagttcaagtacaagggagaagagaaggaagtagat
ataagtaagataaagaaggtatggagagtaggcaaaatgataagtttcacctatgatgag
ggtggaggaaagactggtagaggagctgtaagcgagaaagacgctccaaaagaactacta
caaatgttagaaaagcaaaagaaa
>SSO1062 Conserved hypothetical protein
atgattatgaacactaaggaaagatcgctgcttggaagctggataatatggagtgttgca
tactatatgtactatccgtttatatccatctatctttctcgtttcgtggaagaatctaaa
ttaagcctatttttcgtagtatttcaagcagtatccttgcctcttccgctaataggggct
agactaagtaagcgtaacagaattcttccaataattattggaatgttagtaggagggata
ggtatgataatgcttcctttttctagaaacattttggaagctacaatatttatgtcactc
aattacttcatatccttatcgcttccctcttactattctttgatgtcagaagttggtgaa
ggtactataactagaatatggtcactatcgattttaccttctataataatgccttcattg
ggtggacttctagcccaatattttggtctaagattactttttatgataggtgggatagtc
cttgctacatctttcctacctatggtaaattcttcatataattcgtcgagtcaaagctta
ttgaactttaatattactataaggtctttccttccagcaattttaatattacctatagca
atggagtttccctatatctacttagtagtttataactactttcatttaacaaaggagtac
gttgggataatagctacttcagctgagattcttggtatgttgttaacctatctagcatcg
aagctcatatttagaaagaaataccttctctcactatctctttttctcttctctttaacg
tctttgtactttttatcaccaactattgcaatcttttttggttgttgggaggttatagta
ccgctaaccctagagtatttttcatctaggaaaacagtatatgattttgccttaattact
acgatgcaaggtttaggctgggttttaggatacttaatagactatttcatcccaaatata
agccttttattattaagtagtagtcttatagcttttttattagccttgatgatagtattt
accaaggat
>SSO1063 Conserved hypothetical protein
ttgattaagataatatttgtgttagaagtaaacccagctgatgagaatgaggtctttcag
ataattagtgaatctaaaaaagacaataagaaagtagggataagaggatttggctcacat
acaaagagggaaatcaaaccagatataatgataattacaactgaaaaacttaacaatttc
gaaataagtgaaaacaaggtaatagctgacagtggggctgatgtcaagaaaataagagaa
gaagcgttacaaaaggggcttttattcccatcaatttatgatggaagtataggtggtcta
ctagcacttaacgaaatgtcaagtatatctacggcatatggcacgccatggaatttcaca
gagtgggtagatttcataaatacttttggcaaaatcagatggagagctgtaatcggttca
caaggtttatttggagtaataacgaaagctagtctaaaactatatgagaaaccaagtaag
gtatttatatatgaaagagagataactgataagaaagaattaaaacttgaattaagaaaa
ttaataggtctgaaaccaattgcgctcctagtagaatatgaaggagataataaggctttt
gaaatacatgcatcttacgttactcaatatgatttgcaaagttactctaaggatgaagga
attcctatgatttccgaagtttctgataaaaacagttatatagttgaaataagcgatttt
gtggaagactttatatcaattgcggaaagagtctcaccatattatatgtacggaatatac
ggggttaacttactcaaagtttacgttactgatgattctttgctaagagatttaaaatat
taccccagaaacaagcctcatccagtcttctataagcttaaacgggtattggacttctat
aatatattcgca
>SSO1064 (purE) Phosphoribosylaminoimidazole carboxylase catalytic subunit (EC: 4.1.1.21)
gtgccaaaagtagctgtaattatgggaagtaaaaatgactgggaatatatgagagaagct
gtagagattttgaaacaattcgggatagactatgaggctagagtggtttcagctcataga
acaccagaatttatgatgcaatacgctaaagaagcagaaaaaagaggaatagaagtaatt
attgctggggctggtggagcagctcatttgccaggcatggttgcttcacttacaagtctt
ccagttattggtgttcctattccctcaaagaatctaaatggtcttgactcgcttctttca
atagtgcaaatgccctatggagtcccagtagctactgtggcaataggtggtgccaaaaac
gctgcgctactggcaattaggattttaggaataaaatataaggaattagcagataaaatt
aaaaaattctcagaggatatgaggaacgatgttctcagtactagactggaagcc
>SSO1065 (purK) Phosphoribosylaminoimidazole carboxylase ATPase subunit (EC: 4.1.1.21)
atgttctcagtactagactggaagcctaaaattggaatattaggaggaggacagctcggc
tggatgatagtattagagggtagaaaatacccatttactttttacgtattagagaacgat
aagaatgctccagcttgcagaattgcagataggtgtttctctcctcaagattataaggaa
ttcgttgattcctcagacgttataacatttgagttcgaacacgtgtatgaaaaggcatta
gagtatgctgagtatagtggcaagctattacctagacttaactctgtagagttgaagaga
gagcgttataaggagaagctgttctatagacaacataatttaccaactcctagattctat
gtagcagaggatggtgaggaagcattaaagatattaagagaggaattcaataatgtcgga
gttattaaggaatctaaaggaggatatgatggtaaggggcaatatttcatctttaatgac
gttgagaaatatcaatttctaagggaaaagaaagagaagatggtcgttgaggagtatgta
aaatttgattttgaggcctccattattatagcaagggataagagaggtgtttttattagt
taccctccaacttataattataatgaaaaaggtattttagtttataattatgggccgtat
aataatcagaatatagtagagattgcaagaaggttaagtgaggagttggattacgtagga
attatgggcgttgaggtattcgtagttaacggtaaagttttaattaatgagtttgcccca
agagttcacaatactgggcactatactcttgacggcgctctaatctctcaatttgaacaa
cacctaagggcaataatcggtatggagttaggtccatctaccatcttatctcctagcggg
atggttaatattcttggtacagataaaataccagttgaggtattaaaatacggtaaagtt
tactggtactctaagagtgaagttaggaagaggagaaaaatgggtcatgtaaatgtagta
gggaacaatcttgaagaagttaagcaaaaaattgataaaattatgcaactaatctatact
aatgggttagattta
>SSO1066 (modA) Molybdenum transport protein ModA related protein
atgaggttcagatttaaaatttggattgaagcagaggacggaaagccacttataggtaaa
ggaggggtaaaattactaagagcgattgaggaaaccggctctctttccagtgcttccaaa
tcacttggtgtatcatataagtttgcctgggaatatgtcaaaagaattaatgaaatatta
agcgattctgtagaaatgagaaaaggaggaaagaacgcaggaggttctaaggttaatgaa
aaattagataagctgttaaatatttatgaggaggcacaaaaggagatttcagaaatcctt
gaaaaatataataaaaagataaatgaagtattaaatcaagaaggggaaaaagct
>SSO1067 Intracellular proteinase (EC: 3.2.-.-)
atggactctaaaaaggtattattcttagttggagaagagtttgaagatatagagttatta
tatcccttctatagagttatggaagagggtttcaaacctgtaatagcgtggaaagaggct
aatagtaaggttatcggaaagcatggatatactgtaatttctgacatagcatttaaggac
gtaaggccggaagattatatagcattagttattccaggcggaagaggcccagagcatata
agaacattagaagaagtaaagaatattacgagaaagttctttgaattaaagaagccagta
gctgcaatatgccacggtcctcaaattttaatctcagctaatctagtaaaaggaagaaaa
ctaacgtcagttaactcaataaaagatgatgtaatagcagcgggaggaatttacgttgat
aacgatgtagtagtagatgaaaatctaatatcatctagagtccctagtgatctacctgct
tttgcgtccactttaattaaggcacttaagagtataaag
>SSO10674 Second ORF in transposon ISC1359
gtgaggaaggaactggtcctcgtcctgctctcctatcttctcttgaacgtctggttcttg
atccgttcttggaggaaggtcaagttgtgggagttctcggtctccctctcgaacctcctc
gatcgggaggtaagagtggaacagggacgcgcgttccgtgaagtgaagacgtcattccct
aaactccagctaaccctatgcacctccttccagctacgtgaaattaattct
>SSO1068 Hypothetical protein
ttgttttatcgttccttaatcatatttttccatttcttcagttctagattcggtataaat
agctgcgtaataacacgtatttcgatttcgcttgcaataattatatcccataagtatggt
aaaggcgctaaagaacataatagtctagcactaccaaagaaactaatgatacaaattatg
agtagcggtttaggaaaaattcccttacttaccttatatcttataataggtagggtaaat
tttctatggcagatattgcgtataatgttaaaagtgattctcagaaaacttattttt
>SSO1069 Amino acid transporter
atgggtgaaagagaagccaaaggagcaagagatttaggtatttcttcagataaacaatta
aggagaagcttaggaaaatttgagctattatacctctcattaggaggaattataggatct
ggatggttatttgcatctttaagtacagcagcttatgctggcggtgcagctatattgagc
tggataattgctggaattttagtaatgtttgtgggtttagcttatgctgaaataggtgca
gcaattccaaaaagtggtggaataacaagatatccgcattatactcacggagggctagta
gggtatataattacttgggcttatttcctttccgctgcatcagtgccagctattgaggca
gcagcagcaatagaatatataggatcttattaccctcagctaataacttctggaactttt
gatggaactaccgtaacaattttgacaccattaggcataggattagctggtctattgtta
attttcttcttctttttaaattacttcggagttaacattttaggaaaagtgactcatggt
gcaggttggtggaaattattggtgccaacaataacttttttagcattattagcgttggac
ctgcactcagctaactttacattaggtggaggtttcttcccatctgcacaatatgtaaaa
ggaggttcctctggaatttatggttttagtgcagttctctttgctattccttctaccgga
gtaattttcgcttatctaggatttagacaagcagtagaatatgggggtgaaggtaaaaat
cccagtaaagatataccatttgcggtgttaggttcattacttatagctattgcgttatat
acgttacttcaagttagctttataggaggaatagattggagcaaattatatcttgttaat
aagactactggtatattaatccccgttgtaccagggaattggtcagcattaagtacagca
gtcacagcatctaacgtctcaatatcttctggcccattcttagttctaactcagattgcc
ccagtctctggtctagctgcagcgtttttcacggctttagcggttttattaactattgat
gctgtagtttcaccatccggaactggatggatttatactggaacttcaactagaacacta
tacgcatttgctagtaatggttatttaccagaaattttcttaaagattggaaagactaaa
ataccaacttattcactaattgcagcattaatagtaggtttcatattcttactaccattt
ccatcgtggtatgctttagtaggtttcatatcttcagcgacagtattaacttacattatg
ggcggaattggattagcagtcttaagaaaacacgctaaggaattaaatagaccatttaga
gtacccgcatcagtaataattgcaccaatagcaacactagcagctggtttaatagtttac
tggtcaagttttgctattctcttttacgtatttactggaatattcttaggtcttccatta
ttctttatattctattccaatagaatattagggataaataaggcatattcaatagttgtt
ggcgttattaacttagtaatagatctagtaatggcattcttgttatttgatgagactagc
ggacttggtgctgctaacaatctcttcttcggaatttatatagtagttattgcagctatg
ctaattggcgatatgttattcttgctgaaaactgtacctccagatgttaagagagaaatt
aatgccggatggtggttaatttactttatcttagcaatttacataatatcatattttgga
ggatttgggctatatactataataccatttccatatgatactatagttgctgctattgta
atactcattggatacttctgggctataagaagtggtttcagaactcaagcaattcaagat
ataattcaggcaactagagaa
>SSO1070 Partial transposase ISC1229
atggtaaataagactaaagacacctacaaccccttgagagagctcgtatcactctacctc
ttcatgaaggatgcccaaacaaaacaagagaacaggttaaggagagctctcttcctcgtg
aacgacgaggagaagttgagcgaggagagattggagaagttctctaagggagacttctct
gacgtaaaactgtatcaactggaatacactggtacagtactacgtgagattcaagtccta
gctaggatactacttcaaacacgagaagagttgaaggaggtggggaaaatgatagagagt
aatgtgcctcaagaccacgtgttactcacgattcccggaatagggaaactggcagctggg
attataattgggattgtgggtgatattaggcgcttcccaagacctgaatccttcgttgct
tattgcggtttagacccggtggttgagaggagtggtaggattgaggttagaaagggtatc
tccaagaggggtaacaagtatttgcgtagcttgttttatttccttgccgagactcaatat
tcgcgtaacccaactctccttaagttctacgaaacccacaaggacaaactgaagggtaag
aagttgtacactgccttagctaggaagttggctaggatagtgtggagtgtttggtacaat
aataaaccttatgaggtaaag
>SSO10704 Conserved hypothetical protein
atggagccattctatttcaagtcctataatagaacagtaggaatagctcatgatataaat
gaattagagaaggagatagagagactaggaagggatgatcctggttgtgttgagtggcat
cttagggaggggcatattgtggtttggttgaactatattggtgagaggggtttggctgag
atgttgaggggggttggtaacgtgaaggaggcgttggctaggattagggagtttaaggca
ttgaagagtaggcagaggaagaggacaagatactatagcaaa
>SSO1072 Second ORF in transposon ISC1904
gtgctgaagaacttaagaattagaaaatttgaaccggaagaggaatacgtgcacttcacg
tactctatcaagaatagtgagagggagaagagcaaagagttaattaaagaatacagaaca
ctactacagaaagcaattgactacctgtggaatttaacgaaaatacaagtaagaaaaaag
aacggtaattacaagataacactaccgaagaagaaggaagtgtacaaaccacttagggaa
gagttggagaagatcaaccacctcgcgtcacactacgtcgataaggcaattaatgacgca
ttctcgatcttgaagtcgtggaggaaaagggccataaaggggagagcttcgattgaaaaa
ccaagggtgaagaaggcttacgttaggataaagacgactctgaggaaggttgtgggggaa
agcgttagaataactgtaagacctcacgagtacatcaccttcccgtggagtaagtcatgg
ttctcaagaagggttagggagttggaacttggcgaacctataattaaggaggagaaagtg
tatttgccatttcgttacaagttaccgtgggtaacaccagtgaactttctagctattgac
tccaacctttatactctagatgcttatgatggtgagaaattcgttacaatctctctgaag
cagttgtactcccttaagtactctatggaggtgaagagggctaaggtgcaatcatttgca
tcaaagcacacgaagagggggagagagttgttaaggaagtattcgcatagggagaggaat
cgcgttctggacttcgttcacaagtttgtaaacactttgttggacttgtaccccatgacg
tttttcgctgtggaaaagcttaacaaagagagtatgtttaaggatgctaatggctctctt
tcgaggaagatttctaggactgtttggaggagtatacatagagtgttgaagtacaaggct
ccgctttacggttctttcgttaaggaagtgaacccacacctcacctcgaggtcttgcccc
agatgtgggtttgtatcccgaaaggttggtaagacctttgagtgtgagaggtgtgggttc
aagttggataggcaactgaacgcgtcactgaatatttatctcaagatgtgcggttttcct
cacatccgtgaaatagcgcgggtgtgggttggggttatcccgctaatggggcggagaggg
atgaacgtccgcgacttcggtgaagcccaagggctgagggttgatattaaatatcatgaa
atccta
>SSO1073 First ORF in transposon ISC1904
atgggaattattagaaaaagaaaagtaatactttacgctagagtatcatcaaacacacaa
aaagacgatctagtaaaccaagttaagtacctagaggaacaggtcaaggagtacgaccaa
gtaatcactgacataggttccaagttaaacatgaagagaaaggggttcttgaagttgttg
agaatgatattaaataacgaagtatcacgcgtagttgttgcttacccagacaaacttgtt
agattcggcttcgaaatcctagaggagacttataaagcacatggctgtgaaatagtagta
ataaaccaagaggacaagacaccagaagaattggttgaagacttagtctcaacactagtc
tcattcagtgggaaactgtatggtatgaggagtcataaatacgaaaaggtgaagaaatgt
gctgaagaacttaagaat
>SSO1074 Conserved hypothetical protein
ttggcaataaaaatagtgttctttcatgatgttttatgtccattctgctttgtaacttca
agacgattaagaaaagtggtaaataagtttaaagaagaggtggttgttaagcacaaggca
ttcatgataatatcgtcgttagaagacttaaaagctgctgcacctactgaagaagaagca
aaggagattttcaaacaagaattttctatcataaagagatactatccagattatgatcca
gaaaaagtgataggtaaaggtaaaataatatgggtttggtctctcccccctttaatagca
tgtaaggcagctgaatatcaaagaggtgataatggatactgggattactttgataaggct
caagagaagttcttcttggaaggtgaaaatgttaatgacgataatattttgattcagatt
gcagaggagttaggcctagatgtggagaaatttaaagaggattttaagtctaaaaaggct
aggatgtcagttttcgaagacgaagctgaggcgcacgcaatgggaattaggggagtacca
gcgctactggttaatgattattggcttattaggggagttcaagaggagacttatcttgaa
tcggttatagaggatctgctatctaatggcggagaacctaaaaaggtgaaactaaaagct
tattgggaagctact
>SSO1075 Conserved hypothetical protein
ttgggaagctacttaaaatctttatacatgcttaaacgggttaaagatttcatgtcaaca
ccagtttttcaagttgaagcaaatacttcacttcaagaagtatgtaagttaatgctagag
agaggagtaggatcagtagtagtaactgagcaaggtattcctaagggaatatttactgat
agggacgcagttaaggcaattgctacaagtttaagttccagtgacgaggttagattagca
gctactatgggtaacctaataattgttgatgaggacatagatgtcttcgaggctttaaaa
ataatggctgctaataagattagacatttaccagttaagaataaggatggaaatattata
ggaatgttctcgataactgatgtgtataaggtttatggc
>SSO1076 Hypothetical protein
gtgaaagtaggttatctgataggcagtaatggctacattactaaccttaataatgcaatt
aagctagaggtaatagatggatctaaggagattataagcttagcttacggaaagatatca
gatatacctaaacttgatgttcttattggaagagattttttgcaaggtgaagttttattt
ctgaaaaattacgccaattttcttattgataaaaatagattaaccaatataattccgatt
caattacctttacataatcaagacgcaatttgtgttggaacttctaactgttctggtata
tcttttaaggatgttattttcacatatccatttccttttagagattcatcgtttaattct
gcaataatttttgaggttcttgatctagatataattagagaggtatatagggtagttaaa
agcggctctaaggtttacatgatcttacgtgataagttatttggcggagttgatccatta
gaaggtttaagaaagctgtccagtaaatttaaagtggccatggtaaaggagaaggaagga
ttttggataatagaaggtgttaaaaagagg
>SSO1077 Fumarate hydratase classe II (EC: 4.2.1.2)
atggattacgttcaattaattatgaaatataccgatactgcgcccaagctttttatgaat
actggaaccaaatttcctagaagaattatctggtctatgggagttttaaagaagtcctgt
gctaaagtcaacgcagatcttggattattagataaaaaaattgcggattcaattattaag
gcatctgacgatttaattgatggaaaattagatgataagatagtgcttgatgtatttcaa
acgggttcagggaccggacttaatatgaacgtaaatgaggttatagcagaagtagcttct
agctattctaatcttaaagtacatccaaatgatcatgtaaattttggtcagtcctcaaac
gatactgtgccaacagctataagaattgcagcagtagctgaggtaacaaataggctactg
cctgcattacagcaaataatatcctctttaaataagaaggctgaggagtacaaggatgtt
ataaaggctggtagaacccatttaagagacgcattaccagtaactttaggtcaagaactt
tcagcctacgcagacgctttccagcatgaacatgaacaagttatgaatattttggaatat
gtgaaggaattgccaattggaggtactgcgactggtactgggctaaatagccacccagaa
ttccaagaaagagttataaacgaaataaacagaattaccggtttaggatttaagccagct
aataggtttagagcaatgagattgctcaccgatctcttattattaagcggagcactgagg
aatattgcagtagacctatatagattagggcaagatataaggttaatgttttccggtccc
ttaactgggttaaatgaaattgatttacctacacaagaggagatagctggtagctcaata
atgcctggtaaaactaatccagttacggttgaggctactttactaatctcagcacaagtt
gtgggattagatcatgcaaaccaattcgcatcaatgttaggcgaatttgagttatcaatg
ggaattccattagttggttataatatcgtaacccaagttaatttcatctcagaggcttta
gagaagatgtcaagattagtgattgatggaatggtagcaaatgtagagaagatgaagaga
tatgctgaatcctctccttcacttataaccatagtatctccagtaataggctatgataaa
gcaacagaaataggaaagaagttaaataagggaatgtccatacgtgaagcattaagggaa
ttaggatatagcgataatgagataaataaaatattagacttaagcaaactagttaaacca
gggttcacagctaaa
>SSO1078 ABC transporter, ATP binding subunit
atgtccgtaataagacttgaaaatgttaccaagatctatgaggggaatgttaagactatt
gcacttagagatataaacctaagtattgatgaaggggagtttatttcaatattaggacct
tctggcagtggaaaatctactctcttatcaatcttaggaattttggatagaccatcacaa
ggaaaggtatacatttacgaagttgacgtaactaaactaagtgataacgagatctctaaa
attagaaacgaatacataggctttgtgtttcagaatttcaatctaattcaaagacttagt
gttctacaaaacgttgagttaccattagtagctagaggaataccaaaaaagaaaagagag
gaaattgcgataaattctctaaaactagtgggattagatggattaataaataaaaaacca
tctgaactttctggaggacagcagcaaagagttgccatagctcgtgcattagcacaaaat
ccaaagatcatattagctgatgaacctaccggaaatttggatagtagtaatgcaaaaatt
gtaatgaacatattcaaaaagattaacgaggagtttaaaactacgatagcagtagtaaca
catgatagagaagttgcgagttatacaaagagaaagatatacattagagatggaaagata
gttggtgaagaaaga
>SSO10784 CoA-ligase / coenzyme F390 synthetase, putative
atgagcgttaagttaacttataatgagatagatcccaaggcattaactaaggaagagatt
aaagagatccagcgatttagacttaggggtttaattaaaagagtttatgagagctcaccc
tactatcataaggtgtttaaagaaaggggattaacgccagatgatataagaactctagag
gatttagttaaacttcctttcaccactaaggaagatttaaggagatacgcttatcacatg
gtggcgatttct
>SSO10788 Conserved hypothetical protein
gtgagtagtcttaagatatataaggaattggatttgactagttcttcgtgtgctgggcct
attggtgagttgtccagtgttattgatgagttgagggatggcgaggctgttaaggtcatt
ttgggtgatgaggccactaagaaggacattactttgtggagtaagaagaagggcttgaaa
atagtacaagagtcgcaagagggaagcaagtacgtattattaataagcaaa
>SSO1079 Hypothetical protein
atgaggaataggttgataattatcttattgttactttcattaactctcccaataattcca
gtaaactcacagagtactgttgtcatatccagttgggggtggggaacaccacaaaatcca
ataagggtacatccgggttataatgatacgccattttatgttatagcctcacagccattg
ggataccagattatttacgcatatttggttctatcaggaacgccaataacatctgaagga
ggaaataccatagcttatggttcagtgacctcatcgtccttaacaacttctcaaataatg
ttcttcctcgatgtaagtaataacgctaaaccggggacatataatgtaccactagtagta
gtatatcagaacgcagtcactggtttggaaaaccaaatagttcaagagataactataccc
atttataatgtaacctttccaattttagatcaagtattttggggaactacagaacaatta
atatttgctcaagtaggagaaggcttaatacctcttacctttagcgtttttaatcccacg
acggaacccatgttaaacgtaaccttaaacgtagtcttacccaagggaatatttacccaa
agtggtagtagagatttaacagttacaattccagccttacctgctggagaaccaatattc
gtatcttcaatagtaaatgtaagtaaccttgttaaaccgggagtgtatagtcttaattat
tccttttcatttacgaactttctagaatatttctacaagcaagaatcaaataaaagtata
aatataacaatatatcctcaagccaagattaacattttttccgatcccatccagtcaact
ccagataatataactacactcgtaataggaatttcaactaacgttagtagctttataatt
agtgtaaagccagaattgccctcaagcttcctaccaatatcctcaaactttacgtctact
tctctatcaccgggagaaaaagtaatatatgctttcaagatttacatacctcaaggggta
ataccctcaatataccctataccaatagaggttaattacagtgcattggaccaaaagcta
gcagtagtttatctaacatatgcaaatatctactataatgaaactcctagggtagttgag
gcaatttggaatactacgataactccatttccagggatagggacaatccccttaacattg
gttatctataatccattaccaataccaataactggtgttaatattacatacaaatttcct
aatggtgtatttcctttacagccattcatttttttacctggaattcctcagtattcttct
gtaccaataactatcccagtggaaataacgccaaatgcctcagtaggcgtactcaatttc
acttataagatttcttacaatcaagataaaactgttgatggcgtaaataatatttatgtt
ttgccccctgctccagtgataattgaggctaatcaaacagtgataggcaatggagagtat
gcggtagttccaattaatgttgtgaaccttggagtggaatatgtttataacgtaaatcta
ataaccctcacacaaggcttagagataattacatctgtaaataatacggttccctttata
aagcccaactcatcagcaacattttattatacattatacgctccacaagatttaccacca
gctatgtatccgctagtaattaaattgacatatacctattttaccaatgaaatagtgagg
acgtttacaattccagttctagtaacttcgtcacaatcaccaatacttatatcattcctt
aaaaccacgctttattataacacaaacaacaccgagatcttagcaattcaaaacctagct
aactttacgatatataacataaggcttgacttaaattacccctcacaagaaatttacctc
tcacaaaaccagctttacattccatatcttccttctcacttaatttatactgtcccatta
tatgttataccacaaattccacaaacaacgtcaatacctatcgtagttaccctcaactac
gtattaggccaaggttctccacagacctatcaatatcaattaaacttactcagcacggga
ttcgttaaaatggagataacgcaagtttccgcacagattgtaaatgatacagtggtaatt
agcgggttattaataaatactggatcacaaaatgcacaatatgtaacaatatccgctaat
aactattcctcaatttatattggaaacgtacccccaaatagtccaacaccgttctctttt
actttaacgttgcctccgggtttatacaagttcaatattagtgtaaactacgaaaatgag
ttatatcaacctaatatgacattttatacattttcttacgttgtatcttatccaacgtca
accagttctcaaggtaaaatatcagcaacaacaatattattgatagcgatgatagtaatt
ctcataactattataatatatttgagtcttagagggttacgcaaa
>SSO1080 Conserved hypothetical protein
atgaagatactggattttatatcttatgctttaaactcactaaaagaaagaaaggttagg
gcaatacttactatccttgggatagttgtcggacctgctacaataatttctataaactcc
atggtattgggctactcacacacaataatttcgcaaatatccaactttctctcaccctat
gatattatcgtgacccccactggaaggggtctgccattatcccaatacctcatactccaa
ctggagactatccttggagtaaaaatggttattccattctattcatttccggcgttaatt
agaacacctaatggctatgaaggggcaacagtatttgcggttaatataaaccagcttaag
atagcagctccagctataagcttatcatcaggttactttccagctgcggaggttagctat
gaagcttcaataggctatcagttgggaaatccgcaaggtggatatagtccaataagacca
aatcaagtgatacaaacaattatattctataacgggaataatttcactaagacatttcta
gtaactggagttttgaacgaatatggaagttttctcggagttgatatagataagtcaata
atagtacctttatcttttggtcagtcaatctcaagttcttatagtggagccataataata
gtgagctctctaggagaagtgaatgaagttgtaaatgaaataaaacaaaagtttggaaat
tctttagatattgtagtggcggaggaatttatacaattaatagataatactttacaatct
cttaacggattgctagtatctgcaggagctacgtcattcatagtttcgtttatgggagta
actacaacaatgttcacaacagtggtggaaagaactaaggagatagggatattaagagca
ttaggatttactaggtttgatgtactcacaatgtttttagttgaagctagtgtgatgggg
ttcataggtagtataacagggctcgcattaggttcagtagttgcattaatattaacacaa
gaacatttcggattgggatttagttttctaaagggtctttcagtatcaccggtctattct
cctacctttatgttgttagtgctaatattttctacaattctaagcgtcattgcagcacta
ggacctgcttacaatgcatccaaactagatccaaataaagctttaagatacgag
>SSO10802 (cutC-2) Carbon monoxide dehydrogenase, small chain. Carboxy-end fragment (EC: 1.2.99.2)
ttgatatccagtacacctacaaatgttaccgtgaagtccatctctaacctcctcttcaga
aggatttggattttctttcagcaagaaatatgcctgcattatcattcccggcgtacagaa
accacactgaagggcgaaattttccttaaacgcctcttgaattggatgaagcttagaatc
tac
>SSO1082 Transcriptional regulator, marR family, putative
gtgatgatgaaaaactttattgtttataaagttagatatctaactatgatattagctaca
aagtactcagaagtttgggatctaataactggactgacaagaaagataaataaggataca
gataaggctcttgagcaaataggcctatcatactttgagttcaaagtaatgtgtgcgcta
gaggaagaaggaaaagttccaatgagcagaatagctgaaaaatatatgctgacaaaggcg
ggattaactagcatcattgatagacttgaagagaaagaacttgttagaagggtaagaagt
gaaagtgatagaagggtaatttatgttgaactcacagaaaaaggaagagaacgattaatg
gaaagtaggaagatcttcttaaatgtcttatcttcttttctaagcaaattgtcagaagat
gaaataagagaactggagagactctttagtaagcttttttcc
>SSO10828 (soxC) Quinol oxidase (SoxABC), cytochrome B subunit, C-terminal part
atgaataagttaggtattgcaattttggctctaatattcggagctacagcgttcatggct
gggtttatggcatataatttgctatgggactctgttaaaatcattgccatgctggtgagg
>SSO1083 (gctA) Glutaconate CoA-transferase, subunit A (EC: 2.8.3.12)
gtggaggaggtatttatatatatcttttttgtagagattataaatatggaaagtaaactt
ttgagtctggaagaagcagtggaagtagtgaagaaaggagattctgttacaataagtggt
ataagcatacatagaaatcctatggcatttatatatgctttggtgaagaagggagttaga
gatctgtatttcatagatagagagcctggctttggtcttgaggtcctattaaaatatgga
ttgataaggaaattgagaatagccatgtctactttagaatggttctcgagtattccaaag
cattttaggaaaatgaccgaagaaagagaggttgaaatattggaagatacttgtggtgct
tttattgctgggataagagcagggagcttcggtataccgtttatgccggttaggggaata
atagggtctgatctagttaaaattcatgaaagagaaggtacatggaaagttgtcgaggat
ccatttagtggagagaaagttgtactcgtaaaggctatcaacccagatgttgcaataata
catgtaaataaggctgatgaagagggaaatgcggaaatcctaggtccactatatgaagat
gagtacaaggctaaagcagccaaaaaggtgataataactgccgaagagatagttcctaga
tcttacttctatggtaggagaccgactattaatggagaatacgttactgctgtggttcac
gcaccaaagggtgcagagccgactagtatgttcccactttatgatgcagattacgagaaa
attatagagtttctagagcacttc
>SSO1085 (gctB) Glutaconate CoA-transferase, subunit B (EC: 2.8.3.12)
atgaaaagttacaatgtagattatgtcataaaggctatttcgacattattagaagatgga
gaattagtctatattggcctgaactcaataccttcactaattgcgtctttcatggccaga
gacctttacagaaaaaagataagaataataggagtagcagaagcctcaaatccatcaaga
gtagtattatcgccatctacagggaacccattctttgtggaagcctctccagttatgatt
actgctgacgcattcgacctcgcacagaaaggtaaactagatgtcatgttcttaggtcca
gcacaaatagacgaggaaactaatgtaaatttaactatgattggaaatgaataccataat
cctaaagttaaattaccaggtggagcagctacagcatttatcctacctctttctagaaag
gcaatcttatggaacctaaaacactctaaaagatctcttgtcagaagggtggacttcata
actggaacagcaaagttttcaaataataaagtatttgtggtgactaatttgggagtttta
gcatataatagagaggaaaggaaatggtacttagaggcaatctatccatttagctcatat
gagaaagtagtggagaatactgactttgaggtaaagagaaaagatagcgaaaggttaata
gatctaactgatgaagatttgagattcattaattatatggatccttataaccttagaagt
gctctagaaactcta
>SSO1086 Hypothetical protein
ttgatggtaaaggtttacaagataggtgattattacatagctggtgtagagcacgtaatt
caaggatatttacaagatgttgttttcgtttataagaacaataataattgggttagtgtt
agcgcggaaagatttaggagcaatgacccttctattaacaaggtgaaagaagcggtaaag
tatgctactcatgaggaagatctaaaaaaggcgatagaggagttacgaagcagtggtatt
aagatagaagaagttaaggaaatcccgttccccagaaagtttattgaagggaggaagaag
attcaagaagagtttgat
>SSO1087 Conserved hypothetical protein
atgatcttaggtaaggctttcgcaagatatctcacaaacactctcggtgtagagacatta
aaaattaccactctaaaaaaatttttcaaaacaggatatctgcaatcaattgcaataaac
atgcttctttacgattatggaatatctaaaaaacatgattatggtaagcttgcatcagtt
gaggaaaggataaagattctaaaagggaaaggagaggaaattacggattatatttttttg
aaaaatggggagataaagatacccagctatataataccggaaaatccgcaattcataata
gatttagggaatatggatttattacaagatgaggagaaaataagtctagaacaacaaata
ctggtttcaataaaaaccattagggagtatttgtttgactataacttgaagttagctcat
actccagattctttcaaattagaaggtagaaataaaatagaaattcttaattacattcct
aaagacaatgctattgtgttaaacccctatggtgacactatcgcaaatgaggagataata
aggaatacgaagtttttcataattggggggatagtagataagggaagaaggcttaagaat
gctacctacgaactatcaagaagatatggatatgatgagttaccacaagtcaagatttcg
ttaagaaactctacagttggagtcccagataggataaattcaataattgaaatactatta
aaggtaatcgtgggatataacctagaagaggctattatatcgacacaatcaaatgcagac
aaagtgagcaggttaattaaggaattaaatacgttagataaatttgattataacacaata
cttgatttgaaaaattggttaaaaattgatgatagattattgaaattagcactaaagaaa
agtaaatttagggttcatctcccc
>SSO1088 Conserved hypothetical protein
atgacatggagatgtccagtctgtggttatgaaaatgcggacgattccctcttttgcatc
aaatgtggtactaaaaaaccagagcaacaagtagagcaacctccagcacctcccgttgaa
caacaagcaagcggacaacagtctgtagagcagcagcctgcagatcagaatcaactctct
caacaatctgcaacatcagaacaacagccagtgactgaacaacaagcacctcagcaagtg
gtagttgaacaacccagtgaaactgcaaaaactgaacaacctcaatcagccacaactact
gtaagtaagtactatcttcttttcattaatactcctaatccagcattcaataagactaaa
ctacctttagatttcgatatatttccctcaatatcgataggtagaagtcccgaaaacgta
atagtgattccagatcctgaagtgtctagaaaacatgcaattattagttttgaaaataac
gagttgtatctagaggatctgaatagtactaatggtacttatgtttatgatggtaaagta
ttccagccagtaaaggggaagatcaaggttcagcataattcaattataaaattaggtaat
aacactgtagtgagaattgtgggagaa
>SSO1089 Hypothetical protein
ttgttgagagagttgattctgatctgcaggctgctgctctacagactgttgtccgcttgc
ttgttgttcaacgggaggtgctggaggttgctctacttgttgctctggttttttagtacc
acatttgatgcaaaagagggaatcgtccgcattttcataaccacagactggacatctcca
tgtcatgtttgtataaaaggcgtcatagtacttaaaaatttctactataatatcttagat
atggctattgctattagcctgaaacaatcacatacttacgtttatagtgatagaccaacc
gaagtaggctttatagtttatatagttcctcagcaaggtgcaataacaagtagcatacac
tatatcataatgattgataatagtccatcaatgcgtggtgaaaagctaaatactgcagta
caatcagcccaaaagcttttatatagtctaaatgagggagactatgtaacgctaattcta
ttctctaaccacccggaaataaagtatcaagggccagccaaaggaataataactttcgat
gtaggtaaaggatataccactagacttcatgaagccgttaattttgcccttaacttagca
aaacaatcacaagtacctaacaagatcatcatgctaactgatggaaaaccaactgataag
aggaacgttaaggattatgaaaaattcgatatcccaccaaacactcaaataattacaata
ggtataggtagtgattataatgagagaattctaaagaaattagcagacaaatcatcagga
aagttctaccatttgaaagatatctctgaattacccgatgtttttgaaagccaaagaacc
acatcgacatacgcccataatttgaatttaatagttcctcaaggctttatgccttttaac
tacgatctccccataagaatacctatagtagaaaaactaattgcagtttacggaagtttt
gttatacccgctggaaaggatccatatacaattacgttcactgcagactatattgaccct
atagataatcaaaggaagactgtaacaaaaagcgttattttacaaaggggtaatccggaa
gttgtggaaagtcatctggatagagatgttatattagagattagatattatagattacta
agagagtactcagaagctttagaggctggaaaagatacgactaaagttctcaatgagtta
aagagagttgctgatgaaactagaaaaccagagttaattgaggagactaaaaagttgagt
aatgacagtaagagtgatttatcagaaataacgagaaaaatgcgacaa
>SSO1090 Serine/threonine phosphatase type 1 (EC: 3.1.3.16)
atgatgaatttagacgaagttaagagcgtcgtaagtaatgctatagagatttataaatcc
aagtatgattcaccatttgtggggaattttgaagttgacggtaatgtagtttttgtagga
gatacccacggcgcgattgacgttaccagtaaggttttttctgatttcgctgagaatgca
gatttagtagtgtttttaggggattatgttgacagaggggaggatcaattaggtaactta
ttattaatcttacgtaaaatgatagagaagccagataaatatatagtattaagagggaac
cacgagagtccaataaccaatgagtactacggatttaaggaggaggttaaggaaaagtta
ggggaagaaaactatgaaatgtttgtggatctcttctcctatatgccctatgcagtagtg
gtcaatgggtatttttgtattcatggaggtttaccaatgggtttagagaaggttgaggag
attaagaaattgcccagaccagatgtaaatccagataacccgatagcctttcaattattg
tggaatgatccgagagaaggaattgacgatttagacttcttacctagcataaggggggag
gggatatatttctttggaaaacgtgtcgttgataattttttggagaataattctctaaaa
ggtataataagaggacatgaagctgcagatggttttagaactgacatgggtggtaaagtg
attacagttttttctagtagatatcatcatatgagagctggaattttagttttaaaaaag
gatggtgaattcgattacgcgtatgtt
>SSO1091 Hypothetical protein
atgaccctttcgttaagagtagatacaagccataagtactcatttaatgcagatgttagg
tatatctttaaggtattattagttccagagaaattaggctctgcaactggtttccactac
atagtagcccttgatacaagcgggtctatgacgggatataaaatagagttagctaaacaa
ggtgccatagaattattcaaaagaatacctaatggcaataaggtttccttcatcactttt
tcatcaaatgtgaacgtgattaaggaattcgttgatcctttagacttaacgaatgagata
ttgcagataacagcaggaggtcaaacggcactatatacagcgatcttaactgcaaatagt
ttagctaagaagtatcaaatgccaacctatctattactgttaactgacggaaatcccaca
gatgagacgaatattgggaattatctaaagttaccctattatgaaaaaatacaggtctat
tcatttggaattggtgacgactataatgaacaactacttcaaagtgttagtgataagacg
ggaggggtaatgtatcatatttcagatgctaacgaaataccgcaaaagcttcctcaaaag
gctgtaacgcaaatagctgcaaagaatgttacggttgatataactgctgagggtaacgta
aaacttttgaattatgtaacaacaccagtaaaagtaaatgggatagagaacgttattaaa
atttttggagaaaccattttaccagccaattatgagggtaacttcttaactgtgaaagtc
aattatgaagatccggtaactaataagccagaatcacttttgcaagttattcaagttagg
aaagcacaagatcaaaatacatttgtatctggcataaacaatgacgtgataaatgaatat
agatactatgaactattggataaatacgcgaaacaagttcaagccgaacaattggttgaa
gctacgaaaactcttaaccaactaaatgaaatagcccaacagaccagaagaatagacttc
atggagactactagaaggttgtctgaaggtttagagaccactaaaaggataggtacagtt
gaacagactaagaggttatcaaaagaggttactagtgaggttactagaaagcttagggaa
>SSO1092 Hypothetical protein
atgaaactaaatggaattgatatctcgtctataattgctgctgaaaccggatacataata
accaggtatgagttcatagattcctttgcagaggaatttccagcgtacgtgtcatatgat
ctaaccaataacgctctacgaaagcttataatatttgatcctccaaaagttggttttaac
ttctatcctaactacaagtataaaataaaggtgaaaaagagtgctgaaacattatactca
cttaaaggcagtgatagagtactgatagctctgaaagcctacaaaaaggttataggagaa
atgaacgtattaatgacgaaactatatttccttggtttaaagaacggaaagccctatcga
atgttaattttaaatgacgtaccaattatagcatcagataaaagggaattgatcgacaaa
ttaataggttatttaaaagaaaattacaatattacagtttctaatatacctataatagta
gatggtatagaatatagggaaagaaatgatgtaagaattttagatgtggattacgctacc
atcattccc
>SSO1093 Conserved hypothetical protein
atgaaaggaagagttagaataaggggaatctacgctacagcattaacgtcaattttttcc
tctctttcatacgaaattgtacaacaatctgtggaaatatcagaacgatttatgcaagaa
attaataacttatcagctgatatcacaataaaggattttgaggatgatagaggcaagatc
atcgtaatgggaaatggaattatagaagatgacttacgtaacgtttttaaatactcattc
cattggagaagcccagttaaactatactcggtaatagaaatagacgaaagttgcacttac
gctaactttaaagtagaaccttgcttgagagagggaatcgttataaaaccaccttatgac
ggaaaaataatactaagtgaaactaaggccgtaagtaaatacgctattgtatggagaggg
aagggaataactactttttcagagcacatcgttgatgaggaagaaaaaatgaggctatta
accttgagtttacctcttaatagaaaaggatataatgtaaagtggagaagtaatgcaaag
tatgtcgcattaaatgaattgaaagaggatctagaaaggttaatattaaggtatgaaaat
agggagttcagagatcaaggagaggatttttatttaataactctttcattaccggataaa
ctgtatttagatgaggttagaaagaatgtagttgatactgttaagtatcatcatatgtta
aagttaagctataatagggaagttgattctttggaaaaggataagaaaggttctctcggt
aaattattggaagggctaatctcagatttcttgaaaattgaacacattaaggctgatgga
aaggtaatttatttgagaggtggaaaggtaattgaaaaggaagttaacgataacggatat
agaatagtccttaggcgtgagtttgaaggtaacgggattctagatggtataggtaagaag
atagaggagggtgattacgatattgtagaatataattctgataagtggtatcagatacat
aagtattatagtggtatagataactcactaaagggagtctacattaatatatcaacacca
ccggaattacttagaggaaaaataaggtatttggatctagaaatagatattgcaattaga
gattcagaaatagcattattagatgaagatgaactaaataaaaagagtatttacatgccc
tcttcgctagtaaataaagctaaggaagttgtaaattatctaataaatcgaattcaacaa
aataagttgagt
>SSO1095 Aconitate hydratase (EC: 4.2.1.3)
atgccaaataaattttcatacaaaggctcagagatatattattatcccttaaaagaattg
gaagagaaaggttacaaaataagtgatctaccctattcgataagaatacttatcgaaaat
gtatacagaaatctagatgggagtaaaattacagaggaagatcttgagaatataacaaaa
tggaaaataggagaggaattagcttttatgccaactagagttgtaatgcaagattacact
ggagttcccttactagtggatttagctgcgatgagggagaagatgattcaactgaaaagg
gatcccaaaatgattaacccagtggtccctgctgacctagttatagatcactcagtacaa
gttgactattatggcacagtttactcgctagagtttaatatgaaaaaagaatttgaaaga
aatttagaaagatatcagtttttaaaatgggctcaaggtgcttttaggaacttaagaata
gttcctccaggtaagggtataattcatcaagtaaacttagagtacctaagtactgtagtc
gcaaaggctgaagtcaaaggtttattaacagcgtttccagaggtaataattgggacagat
tctcacactactatgattgaaggtctgggaatcctaggatggggtgttggcggattagaa
gcagaggctgtacttttaggagaaccatactaccttaatgtaccagaggtaataggtgtg
agattaactggagaaattcaagaaggggtaactcctactgatgtggttctttacattaca
gagttattaaggaaaaagaacgtcgtaagtaaatttgttgaattcttcggaccatcctta
tcattactttcagtaccggatagggcgaccatagctaatatggcaccagagtatggtgca
acagcagcgtacttcccgattgatgatgtaacggtaagctatcttgaactcacaaacaga
gatggagaattcgttaagaaatacgcccagttacaagaactattttatgacgattctagg
aagataagatatagtgatatagtagaagtggatttaagtaagattgaaccggcaattgcg
ggacctagaaaccctgatgagagaatcagcttaagagaagttaaaggaaaactgagcaaa
gagaagaagaaaaagggcaaatatgttgaggataacgctgtagttttggctgcaattacc
agctgtacaaatacttctaaccctactgtaatgttgggtgcaggtatcttggctaaaaag
gctgttgagatgggattaagagtacctccctacatcaaaacgagtactgcacctggatca
ccggttgtagctgagtacttaaaggaaacagggttactaccatatttagaggccttaggt
tttcacttagttggcttcggatgtactacgtgtataggcaatgcaggacctttaccaaaa
tatgtggaggaagacattaaggaaaacggtatcgagacctatgcggtaattagtggaaat
aggaattttgaaggtagaataaacccgctactaaagggtacttttctagcctctccgata
ttagtagttgcttatgcattagcagggagaattgatatagatttctacaatgagcctata
ggatttgatcctaatgggaaaccagtatatttaagagacatctggccttctttaaaggag
ataaaagcttacgtgaacatggccttaaaaccagaattatataaaaggaattccaacatc
tttgaaggaaacgaattatggaactcattaaagacaccacaaggagacatatatagttgg
gatgagaagtctacctacataaggctgcccccatggtacagtgaagaaaaacaagaggag
ttagatgatataactaacgctagaatacttttactactgggagacaagataactactgat
catatttcgccagctggaccaattactccagattcacccgcaggattatacttaaagcaa
tttggtgtgagcgatctaaatacctatggtgctagaagaggcaaccatgaagtaatgtta
agaggaggattcttcaatcctaagatgaagaacctattagtggaaaaagaaggagggtat
actgtccacttcccagatagaaagatagctagtgtgtatgaagtggcaatgcagtataaa
aaggaaggtgtacctctagtaatagtagctggtaaacagtatggaagtggaagttcaaga
gattgggcggcaaaagtgactaaattgttaggagtcaaagctgtcttagcagaaagtttt
gagaggatacataggagtaacttagtagctatgggtgtaatacctatacaaattccagac
tggagagacttgggaataaagggagatgagactgttaacataaagggtattaaggatctc
aaacccaaaaaggaattaaccatagagttcgtaaaatctaatggcgagaaaataactact
aagggagttgcaagaatagataataacgttgaactaatgtatgttaagaaaggaggaata
ttaaattatgtgctcgagaaattcttagaaaatgaaaggaagagt
>SSO1096 Hypothetical protein
gtgagcgagattttagagatctgcaagaaagttaaactacttgcgtattttggatcgtac
acaaggcaagaggatttcgtagagggtatctcagatataaacgttttcctcatatctgag
gataaatacttaatactagagcttgcgagtttaggctattctccaattgaactttctgaa
aagagtttcatagatctatgtgagaaaggtgatccaatctgttattatttgctttacgat
tctaacgtagtctgtggtcaatttcctaagagcgttaaattcaatttaaatgactttaca
tgtgaaaggattagaagatcaatttttcccctcttatcattatcagtttcaagtttttta
aggcaagatgagatttccgctgtttcaaactcctttagggctttgagaagtattatacaa
tggagatcgtgtactgatctaaagactattccattaaggaatgatgacttgagggataga
tgtagagaactaaatctttcaatatgtaacgaattttcagatatagtgttaattagacgt
aggaaagccccactatcgttatggagtttggacaagatagttgaggctatctgtagcgag
ttaaaaatcagctgtactaagccatctaaaattttacaagtagttaagaatcctatacaa
gttacatacaaagaagatggtagggttacggtaaaggatagcttaaatagggaaacgaag
atagca
>SSO1098 Conserved hypothetical protein
ttgatgagcgaagagattaaccgtgatatggaaagagcagaagaatatgaacaaacaaca
actagggtttctgtgttaggtcaaaatagatttgaattaagtactgggctcattattgct
gctagatacgcagataagttaagaagagtagcattagtagcatttagtaagatagctcct
aaggaagttattattagggatgtgagtgagctgaataagcagttatatactaaaattgtt
gaggagatgaagctaggtaaattagatgttattagaatatcagtagatgctgaatatgat
gatcgaaataaaaaattaatttttagtaatttacgaatcttgagatatattactgaagaa
cagtgtggggagaagtataaggatatcataagtgagaatgaaagattaaaaggagaaatt
ttagaattaaagaaaaaattagaggatatattatcccttttaaag
>SSO10982 Third ORF in transposon ISC1225
gtgatgtatttcgcaagagcaaccaacctcgacttgaccaagagggaagtgctggagctt
tacaacaaggttaggggtcccattgagacgtcttacaagaatatcaagaccttccttccc
ttcacgagctccaccaagttcgtctttcgcgagttgatcttcgtactggccatggtcttc
tactcgctttacaccgtgttcaaggacgtcatgagaagagaggagtttagattgctttca
tcctctgttttc
>SSO1100 Hypothetical protein
atgaaagttgtaaagtacaatttgaaggctaagattgaaagagctgggagagatcctata
accatagagaggaaattcagaaaattagttaatgcaagaaagtttatagatgaagtagta
ggagaagatcaagtaaagtgtactccattaagtaagtctgagactttaattactaagcag
tgtgaaggtgatcaagtaaagtacttcttcgaaattactatagagaggatcaagaaacca
aagaaggaggaaaagccggagaaagaggaaaagaaacaagaacaaggaactactcct
>SSO1101 Transcriptional regulator, putative
atggctgaaaaagtaaggttccctgatggaagggaagtagatatacacgatttcatagca
ttcatgtacggtctatctaaaagcgatgtagaagtattacacatactactacaaaatgga
aagatgactactgatgatctctcccagaaattaaatgtaactaaagcgtctataagcaag
gcactaaataacttacttgacaagggcttaatacagagggaaaaggctccagctgaaaaa
gaggaaagaaaaggaagaccaaactacatatactgggtagaaaaagagagattatatagg
aaattggaggcagatctagaaaaacttgcaggaactgttaaagaggcattacagaagcac
accgcattagaaatagtcatt
>SSO1102 Hypothetical protein
atgcgttactccacatattgtgaagatggatatattaatatcgttccggctcttaaggtt
gcgttaataattagtttgctaagtaagggccaaccacttcgagaggcttgcagatgtgtt
aacatgtcgattactgcgtatgagagacataagaaggatagtgtggaaaagatccagaaa
atcagagaagacaaagaaattagtcaaatgatcgattctttgtcctcgagaataattaat
aaggagaaaatagatccaatgctgttctgtctagtttgtagtaagtcacgaaggttattt
aacttaccagtatgtttt
>SSO11020 Hypothetical protein
atggattattctgcaatactaggcaccttaactaaagataaaagagagtgccaatccttt
ctaagcatttgtaacaatggaaaattcgtatttgtggcaatttgcgacacccaaacaaag
gtctactgcggagaggttaatgaaaactcaataatatttggtgaaaaaggaaataataat
agtgtaacctatgaaatacctataagcgataataacataaaagtgataaaagttagtgat
agtatttatgcatataacgttaatgaatctcttttatcagat
>SSO1103 Transport membrane protein (permease)
gtgaaagcgaagagagtaatttttctctcagcatcctcattttttctctcctatttttcc
agagtgacttggagtattgtagcgcctctttctacgttaaaaactactactactgaagat
agtataatatttgcacttttcttcttgggctatattctagtccaaattccttctgggatg
ttagcagatcgtatttctgcaaatcacctacttttcctctctttattaggtgtggcaatt
acgtcgtttatctcatcgacttttcctctcattatgcttgaatatgtcgccagttttcta
atgggtttttcagctggatggatttatcctattacagtaaaactcttgagtgcatccttt
gatagcagagacttaccgattgccatgagtatttacagtatatcttggcctttatccatc
gtagcttcgggagttataataccctttttagctttaacatttggttgggagttctcgttc
tattttataactgcactttctataattttaggtattttagctctcctctatcttccttcc
ttgaagttatctaaaagtataattaaatttaaggatgtggttaaggataaaaactccata
tatatctcagttggaggttttttattctatttaacatattggatccttgttctatatctt
tacaagtatttacttagtgtagtcggaaacgaatacacggcgggtatcatttactcattc
actgcattaactggaattttctctactattctagctggttatataataaaatctttaggt
gttaaaaggacttttctatcgtttattactctctatagtttttcgttactccttttttcg
ttttcaaaaaatgtgatagttattggtattgacgcattagccttaggtttctttaggttc
gttataacgccaacaagctctacagcagttgctgtaatcggaggaaaagaaaggagtggt
agtgtaactggccttgctaacttcttttggcaatttagcggtatagttgggtccataatt
gctcctcttctaataaacttatttacttatacatatttgtggacttttgttagcgtgttt
tcttttctttctttaattttttactataaacttaaatttatgagagattatctt
>SSO1104 Hypothetical protein
ttgaggaggaggcaaaaagagttgttagatgataaagaaatactgttaagcgcattagat
aaggttgataagttttacgtttaccttgccggaataaatagtagtgagatacttctggtt
actacattaaacgttcctaatgaaatcgaggttgagggaaagaaatttaaggtagttaaa
tatcaccctgaagattatttaagtcaagtagtggaaaaagaagatgagatatttcgaaaa
tataagatatactattttgtgaaagcttatatgagaaagatacttgatacgctttcctcc
gcagaagtggaacgaatgagcttagatcttaaagataatctctca
>SSO1105 Glycine cleavage system protein H, hypothetical
atgaagatcctaggttttacattccctgacgatttactttatgaacctgaaaaacatgtg
tgggtaagaatagaggataatagtgtagttagtataggtgtcactgatctaggacaatat
atggctggtaaaatattccaagttacggcaaagcagaaaggtgagaaagtaaatggaaga
agcgtgctcttctctattgaaagtgcaaagtggataggtaagtttaggttgccaatagag
ggtgaagtctttgacgtaaatgaagaagtagtaaaaaacccttcaataattaatgaaaga
ccctatgatagttggatagttaagataagggtagaggatatggatattataaaaagaact
ttcaaaccaattcaagaggtatacaaacaatttgaggaggaggcaaaaagagttgttaga
>SSO1106 Hypothetical protein
atggttaatttcgcagtttggttagatggtgtaattctaaaaatagacctaactgattca
ctttacaagatctataagggagatcaaattagcttacccattacgtatgaggttaatgat
gactggattaaagtctacgatagaattagagaagcgaatttagccatactctctccctat
gacgaaatcactacaaaggctattttggaaagaattaacttgaaacccacttacgttata
gctaatagaggaaaaactaaaccatcaagagagccgtataggattttaatcgaggtcact
ggatgggatcctttacaagtagtaactttagcttcttctcccctagatttgttatctgcg
aggttttttgattctagaattaaagttatttgtgtgaagagatatcaagattgctctaag
tactctcccttcttatattctgaaaatttggatgacgctatatcctcacttaagagactt
aaaattataagg
>SSO1107 Hypothetical protein
atgtcaattgagaatgaggctaagaagttagctgccacttatgcgagatggttgaggaat
ccacaagatgctctctttgggaaagatggagagggagttgttcttaaaatttataagaaa
ataaagcaagctaaagataaaaatgaaataatagagatattaaggttagatcagtacaca
atggaaaagactacgtttaacgatatgaccagatttgtaaacgatttactaaataagatt
cagcaaatggatgatcaactcgctttgagatttactgtggaggtatttagatattttcaa
atagcattggctactaaaatggaggatatgaataagggtttatggacg
>SSO11071 (porD-2) Pyruvate synthase delta chain (Pyruvic-ferredoxin oxidoreductase delta chain) (EC: 1.2.7.1)
atggacaagttggtgtcgagtatgtcactgcttgaatatcagtactttccaataactaga
cctaataagggtgctggaggaagaaccggagcatggaggatagtaaagcctgtagttgac
tatagtaaatgcataggctgtaaagcgtgttttatgttctgcccagaatctacaatagtg
ccaagcaacggtaaagtaagagttgattacgagtattgtaaaggttgtggagtttgtgcg
aatgtatgtccagtgaaggctataagtatggtgagtgaacaa
>SSO1108 Transcriptional regulator Lrs14
atgcaagtagagaatataagagttaggctcccatctggaaaagaagttggattagtagac
gcactaaatttctgctatgatatttcagatacggacttccaggtgttaaagacattacta
aatagtggaccaaagactgaagacgaactagctgaaatgcttcatttaagtaaggcttca
ataaatagatcggtaaataagttagtttccttgggttttgtagatagggtaaaggactca
tcatcgaagggaggtaggccaagatatatatacaaacctatagatgcggatagaattacc
acgaagatttcaaatgatttcaaatattgtgctgacttattctctagcgtgataccacaa
gaattgaaagaaaag
>SSO1109 Hypothetical protein
gtgtgcattcagcttcaaatagcctattgcatactgggcatacgaccttcatgctgtcaa
aataaaattttttatctttataacgttaattctttgactatgattgaagaaatggattta
actccgcttgagtgcccggagccctttatgaaggtagttgctaaactaatgaagatagaa
aatggagaacttaagatcaggtataaggatcctaagtgcagagaaatgttactagaggct
atgaagttaatgaattgtaaggttcttgaggattcgcaaaataatggagtatttttcatg
catattaaaaaagaaagtggtagttctgaaaaacctaaaaaaattgaactaactggaggt
tgc
>SSO1110 Transcriptional regulator, putative
atgagtttaaaactttcagaaagtaaagaggtaataagatgttgttataaaatatcagat
actgatgtcgagtgtctatttaaattagttgagcttaacagaccgatttccgcggaagag
ttagcttcgataatgaaactcagcaaaactaccgttgaaaatagtctgaagaaattaata
gaaatagggttaatagtcaggaataaagatggagaagaaggtaagagaataggaagacct
aaatatctatatgcggtaatacataatgctgaaactaaaataaaacaagacttgactaac
tgcgcttctaaaatattgtcagcaacctccagt
>SSO1111 Conserved hypothetical protein
atggagaacgaagaggaagtcataaaggaagttttacttaaatataaaaatattgcaact
gttggtttctccaaagacccatccaaggcagcttttcaagtgcctaagtttttaatggat
catggttataatgtcatcccagtaaatccatccgcgagtgaaatattaggtaaaaagtct
tatccctcaattctcgacgtaccagataaggtagaaattgttgagatatttagaccatca
aatgaagtacctaaaattgttgatcaagttttggagagagtgaaaaaggttggcgatgtg
aaggtaatatggatgcaggaaggtattagaaatgatgaggctgcggaaaaggccagaaaa
gctggacttgtagttatccaagataggtgtatgtacaaggaatatatgaaaaaaatattt
aatgtaaataatcctcccccagtatcatccttaaaaaatagt
>SSO11114 (zfx-like1) Ferredoxin like protein
atgatggatcttctgaaaaggttgtctttaaataagtataatgtagataagaccacccat
atagaggtaaatactgatatatgtttaacttgcaaagataagccttgcactaaagtttgc
cctgctggaacgtatgagccttctcccgatggaagaattgtggtacactatgagagatgc
ttagaatgcggtgcggcattagtagcttgcccatatggtgcaataaagtttcatttccca
gaaggaggtataagctataaatatgga
>SSO1112 (lplA-like2) Lipoate protein ligase A, hypothetical
atgagagaattaaggttcttaattgaacgaaatagtcaagctcatatactagcaggtgaa
gaagctcttcttttatcagtcgctaatggttcccaaccaattttacgatttgtaatattt
gatcctccagcagttcttgtaggctatcatcaagcggttgagcaagaagtaaatatagaa
gaggtgaaaaaaagaggctgggaaataggtagaaggcctactgggggaggtacaattata
atgggcccatggcaattgggttgggaaatctacgcaaacaatgatctattagggtatact
ccagaaaatgcaataaaaattggtgctgaaggcgttattagggcactagacaagttgggt
ataaaagcatcttttaggccaaagaatgatgtagaggtaaacgggaggaagatttctgga
atcggagcattttctgagggtaattacattgcagttaccggaacaattctactagatttt
gatgtggacgcgatgatttcagttcttaggttatcttctgaaaaacttaaggacaaacta
gccagagattttaaggaccgattaacgtgggttaataaggaattaaaacgctcacttgat
atggaagaattaataaaaatctctagagattcctttgctgaagtgctagggataaagctt
tcggatgactactacaatgaatttgaaaagaagaccatacaagaattagcgttaaagtat
tcatcgcccgaatggatatttaacttaaggcgaccattaattggggacgatataagatac
gtagaaaggaaacttccaggtggactggttaaggtgcaagttaaaatggtcagtaaaaat
ctaatagaatctgtactagtaactggtgatttcttcatagaaccgagaactgccatatat
gatttggaagctagattgaaatggagtagagttgaagatttagaaaacgaaatcagaacg
tggtttaacagtgtgaaggcaattggaataactgctgatgatctcataaaaataatagaa
gaggtggtaagg
>SSO11133 Hypothetical protein
atggaaacagttacaataaaggttgataaagagatagccgagctgataaaaaagatgatc
tcactgggaattgcaaaatcaaagaatgaagcggttaatatgttaattgaatacgggaga
gctgaaatagagaggagagttaaagaagaggaggaagtgaagaaacttgtagaaaaatgg
ctccaagagggttttccatataaaaaccttgatacttcagatttaagggaagaaagatat
gga
>SSO11138 Second ORF in transposon ISC1225
gtgaaacaaatctcactcgaaacgcttaagggcgtggaggagatggatctatcattagat
tggacaagctggtacggaaaacttgtagaaggtttgggaagctcagaaaagggatactcg
tggaactacgcaacaacgacgaaatacgaggtaaaaatcctcatactcgccttcataccg
caagttaatgacaaagga
>SSO11139 First ORF in transposon ISC1225
atgccaattccctcattaaacattcaacaaatagtgtataaattactttccatgattaac
ttccacgggaggaagggagaggaagctacaaaaaccttggtctcgacatcattacacaac
gattcagtggaaaaacgtttccaaagcttacaacgtatcaccacaaacagtgaggaatta
cgt
>SSO1114 Conserved hypothetical protein
gtgaggccattattcctttatgctcccaatttaaagaggtatgagagtgagtttttagat
tctagaaaaggttggaaatcaatatctgttacgggtacttattgtgcatttaactgtaaa
cattgtggtaggcgagtattagaatcaatgattgacggttctactcaaggtaaaattgag
aaagaaattatggaagcaattagtagaggagatgagggaattatactatctggtggttct
acatcgagaggagatgttccgatatggaggtattctaatttattgaagagatattccgat
agacttacaataatagctcacactggtgtagttaaaaacgaagaaatagctaggaaattt
aaggaaagtggtgtgaaaatcgcattgttagatatggtatccgataatgatgcaattaaa
gatattttagggcaaccatttaccgtagatgactatcttaattcatttaaatatctaaaa
aaggttaatataaaaatagttcctcatgtgatattaggattgagcaaaaagggcttagaa
ggtgacttagagtcaataagactgcttcaggaagttaatcctgatgcgctaataatcgtt
ggactaatgccattagttggaacacagatgaatgcatctagacctccgactccagaggag
attatagtcgccttaagaactgcgagagatactttccctaatattccgataaacttaggt
tgcgcaaggcctaggggtaagtcgtatcttgaagtcgagaagttcgctgtggattacgat
attgacgcaatagcttttcccgaagacgaaacgtacgaatacgcaaaaagtaagagggaa
atatttttaagtaatgcgtgttgtggtaatatagtttttgatatatttaaggtgataacc
tca
>SSO1115 (bioB) Biotin synthase (EC: 2.8.1.6)
atgacattacgtctaatttcaagtccagattgggtaagactaagttttggcgcagatatg
gtcttaggtttttcttctggagtgtttttaaagggagctctgaataccacgataaatctg
ttgcaatattacccagatggatgcaaagcaaattgctcatattgtggccaagctagagag
gtcgccaatggtccagaatgtaaaacgttaataagggtagaatggccacttagacctcta
aatgaggtattaaagagaatttatgagagacaaggcaatccagaatacggtcttcaaagg
atatgtataggacaattggcccatcctagggcatctccagatgccatagagataacgaga
aggataagaaatgcggggattgagctacaaatttcagaattagttacagcaacttatact
ttcaaacatcacatgattgaaatgaggaaagctggagctgatatgattgatgttgcaata
gacgcggcaaatgagaaggtgtttgaagagctaaggggtaagaaagctagaagcatgcac
tcatggaagagatatttagaggcaatagatgaagctgtggaagtatttggtaaaaagaac
gctggtattcacttaataataggtttaggggagagtgagaaagacgcagtcaaccttatg
tggtacgctcatagtaggggagctaaaatttcactctttgcgttttatccagaggctggt
actccaatggaaaaacgaaaaccagtcccagttcacgtctatagaaggatgcaaatagct
agatggctgattgaaaatgatattgtcgatattaatgcgttcaagtttgacgacaaggga
gaactaatagatgtagaaataccgtccgatataaccttaaatgaattagccccagcattt
atgactagtggatgtccaggttgtaacagaccatattccaatgagaggccaggtagagta
ttaaagaacgttccttggtatctagacagagaaatgactttacgttcaattaaagcttcc
agattagattccttaataaagaaagtagtaagg
>SSO1116 Hypothetical protein
atgttcataaaggatggctctttaataagctatttttcaagtggttttccttcacatgtt
agagttaaggcaatagatatctcatctccagactatgaagtattttactccccggttaaa
ggtgaggtcgtagacatagtgcgatttgaaataggacggccaaataggttctctactata
aattacgactatatgatcttaattaatagtgaaaatcaaagaattattaaagtccttcac
gttttaccgtgggtggagaagggagaatacgttaaagaagggcgagtaataggggagttc
cttcaaacgccttatactggaggtgattttcctcacgcccatattgaaggtattacaata
agatttcctaagatttcaaattatagagattctaaaatcggtatagtgcataagaaggac
aaggagtttttcgatgtcataataaaagattttgcggaagctgggaagcttagaggatta
ggttgctgtggagggctattaaatgcgagtttaccatatgcatgctatggtggaattatt
ggcggattcaccggtcaactatcactttatgacctaaatttaggatacttagcggttaga
cgtaaaacttacctcttgtttgaaggtaggaagaacttattgagaaattgggaagaagat
gcgtcattcaaggttctcgtaaataaacctatatgtggttttgcgtttatggagattgtc
ttatctcataatggttatcctatgattagattctttttaaacaatgttaatttgagtgaa
ggtgatgagattgacatatcagaattcgttagggatcgtttgggatcaaagatttac
>SSO1117 Acetoin utilization protein
gtgaaggtgatgagattgacatatcagaattcgttagggatcgtttgggatcaaagattt
actgaaatctctttctctcaccccatgattagggatatatctaaggctagagtaagagat
ttcatcaaattagctaaggaaaaagtctcttttgtagaaataaggccagaatacgctact
aaagaggatttgatggttgttcacacaagggattacattggtttactcgaagagagcagt
aagattccctatataggatttttagatcaaggtgatactgttcattatccagggatgttt
gaagatatactactagtattaggttcctcatttactgccataaaatattctaaattcttg
gattacgtctatattcctctaggcggatttcatcacgcaatgcctaatagagcagtaggg
ttttgtccgataaatgatgttgcaataacagctctcaaactattagagaagggtgaaagg
gttgctattgtggatgtggacgctcatcatggcaacggtttacaattcatactatatgat
aaaccaattttaaagataaatatttacgcatatgatggtaactttttccctggaactggg
aagattgatgaaataggcgaggggaagggtagggggtataacataaatattcctttacct
ttaggatcaacggatgatatttttgagaaaagtctagaaatattagacttattagaactt
tataatccttcttatgttctagtcgtagctggagtagatggtcataaaaatgatcagcta
aaatccttagacctaacaactaattcctataacctattaggtcttaggataagaagaata
aagaagaccataaattctagtatcattgcttacggtggagggggatatggtccaatgtcg
tccttaagtatggtttcgttcttagaaggattgttaggcagaagaacttcttatgaaccg
cttacatcttctgaggatataggaaaaataagaagaatagaaaaaattatttcaagattt
aaaactctttccaacttctttagc
>SSO1118 Hypothetical protein
ttggataacctacttaagttttccggttttaatatttcctcaagtggatctactgttgat
acactcatactactataccctaaattaattaatctagcatgtttatatatatttaatatg
tttgcagttatctcgccaagcgctttcggaaaattaaaagaaatactgggttcaaataag
aattacaaatttgttattacaacattaggagtttcttttgcgataaagagcggtatagat
attgatagcgcactagatcgtggagtaatagttagagccttttctcacaaacctcccaag
gtaggaaatctaccacaatatgagtctgaagcaataatggttgcctttgagttaaatgca
ttacttatagcagaagacaaggatgttataaacaaagcaaaagagcttggggttaacgca
attccgattgaagagcttttagcatcatct
>SSO1119 Hypothetical protein
atgagtgtatcaacagtagatccacttgaggaaatattaaaaccggaaaacttaagtagg
ttatccaagatagttgacgcattacctacaatagagaaagtaactgataaaataacagaa
atggataaaaaaggtcaagtggacttcttactctcattatttgatcaaacagtttccata
cttgatgctgtacagaaggcagacctaataaacacactcatctcattcggaatggatcaa
ctaccaaaaatacaagcaatatggccaatactagaaaaactaacaagcgaaagggctttg
caattactatcgcagattgatatagactctactcttaccgcgttagagaaattatcgcca
ataattaagaagctaactgacgaaaaagtgttgaaagtaattgatcagatagactatgat
tctttaatagatagtacttcgaagttagtacctattttatctaaacttgcaaatgagagg
actgttaagactattgaagccctagatattgatatgttacttaacttagcgtcaaagatg
gctcctacgctaaacaaatttgcgtcattaatggatcagatgtctagcaaaggccaagtc
gacatgttagttaacttaatggagcaaggaatatcgctacttgatgctgtacagaaggca
gacctaataaacacactcatctcattcggaatggatcaactaccaaaaatacaagcaata
tggccaatactagaaaaactaacaagcgaaagaacccttaacttaatacaaagtttagat
ctggactcaatgttcaacgcgttagaagcactaacgccaataatgaaacagctaacaagc
gataaggcaataaagatcattcaacaattcgatattgcttctacacttggcgccttagag
gcagcaatgccactattaaagaaactaactgacgaaaaaactgttaagataatatctcaa
atagacgttaactcgttacttatgcttacaaacaaactagtcgaaatgcagaagtctggt
agtttggatagactaatgcagttattggaaataatttctgatccacaattcgttaacgga
ctggttacagtcatggataagttttctaaggcctttaaagcttgggttaatgacatacca
aacgcaagaccagtcggaactatgggcttattgagagctacaagcgataaagatgtcagt
tatgctttaggattaatgcttgaactagctaaagaagttggaaagagttttaaatct
>SSO11196 Conserved hypothetical protein
atgattaatgttggtttttattataaggttaagagaggttttgagaaggattttgagaat
aagtttaaggaagttttaagttatttgagggctaatgctgatggttttgttgatgcgaaa
ctttacaagaatgttgatgaaccatcggagtatttgatttacagtgtttggagagatttg
gattcgtttaagaaattcgtttccagtagtgcgtataagaatactgtaaattacggtaag
agtattattgagagtaaaccaatacatagaatactacaagaaataaatgat
>SSO1120 Glutaredoxin related protein
atgagctatgattacgttatcaaggaatatcttaacgcgattaaaaagggagatataaca
atacagcaatgtaatggagatagtttatttcacgagtttaaaaattacgttaacgttgaa
actctaaataattgtaaaaaacctcttgttaaagttaagaggggagatagggtttactat
acttattatggtattccgatagcaaatgaattatggccgtttcttaactcattggtaaga
atctctaataacgttgttaacctagatgaaagggaggtggaattagcaaagcaagtaaga
ggaagcgttaaattgtttgtaactccagattgtactaaatgtccaattaccgcggagttc
ttatatcaagtttctcagataaatgaaaatgttaaactggagatatatgacgcaacagag
tatgaagaggaaagagacaagtatagggttttaagtgtgcctaaaatcatatttaacgat
aaggtggaaatcccaggggattcccttcaactg
>SSO1121 Hypothetical protein
atgtggataaatataagagtaaagatgggaaaacttgaggattatttaaagaagaaggga
ttttccctagttaatgagggaaaaagggaaagagtggtaatggatgattatgagtttttt
attgagaacttaactatattgttaccaattccattgcccactggtaaggagagtttggat
gatcttataggaatgggaacaagatatgctagagcatctagaatctctcaaggattagga
gcaccactagaatatgaattgaatggtacaaccatttatattattaaaaggtttcaaaat
agagaagatttagaaaactcaattattaagtcactagaaggtatagaaagtttgaggtat
ttcata
>SSO1123 (pdhD-1) Dihydrolipoamide dehydrogenase (EC: 1.8.1.4)
atgaaatatgatatcgtaataattggcggtggtactgccggttatgttgctggaagcata
ttagcgagaaagggcaagaaggtactagttgccgaaaaagagaaatttggtggagtttgt
gtaaacttcggctgtgtaccaagtatttttctttttgatgcaacctttttattaaataga
tttaaagaaattgtgtattatataggcttagatggtgaaattgaatataaagatctcctt
ttcagtaaaagaaacgaaattatagactacttatcaaacgccggaagaaagctaattgaa
gattcgggcggtgaaactgagttaggtgaagttgaaataatttctcctagtacggtaaag
gtaaatgggagaattgtggagttcgataatttaatcatagctactggttctaaaccgatg
gtaccaagtattaatggcattgaaaatactttaagtgaagatgatgcggttaatttgaat
tcagtaccttcttcaatggttattattggcggaggctatgcaggagttgagatagctcaa
atgtattccagattagggtcacaagttaccttattgtccagaagtaaaattttaccaaca
tttccagaggatgctagaagtattataaaggattccttggaattcgatggagtaaatata
gaggaaaacattagaatagtgaagattcatgatggaaaagtgattacggaaaagggtgag
gtagaaggaaacgtaatagtgtatgccacagggagaagaccgcaattgcctaagggtatt
gaaatacttggattgagtattaatgaatgtgggatagtagttgataagtatagaagagta
aagaacaatgtatacgcaataggtgatgtaatagacaaagagagaaaaactgcacattca
gcaattttagatgcagtaattgcatcactacatatccttaaggacgcaacatttcttccc
ctaatagataatcttaagataccccaagtgttatatactgatcctcaagttggtatcgta
ggtaacgataaagaggctaaggagttttctgtttttccgtttgctgcaactaccagagca
attatcaatggatttaaggatgggtacgttaaactaggaataaatgagagaaatgagata
gtttttggagaagtaattggcgataaggctgaggaattaatcaatattttaacgttagta
gtaaataatagaataagaatcgagagtttagcgctaatgtcttttgttcacccttcattc
tctgaggccatagttaatgcagcgaagggcttttttgatttagatgtggataaatataag
agtaaagatgggaaaact
>SSO11231 (zfx-like2) Ferredoxin like protein
atgagaatagaggaaaaactttacactctaagatataagaaggacgaacaaccccatcta
gccattattgatccaaacaaatgtctcagatgtgaacaagttaatggggttccacaacca
tgcattgcagtctgccctgcaaatgtttattcatggatcgatcaaagaattgtgatatct
tatgagaattgtgttgagtgtggcgcttgtagaattgcttgtccctattctaacatctta
tggaagtatccaagatatgggttaggcatagcattaaggtatggt
>SSO1125 Conserved hypothetical protein
atggctcaagctcaaactcagggtcaagaggaagagcaaaagaagaagatattaatcgta
gtaacccatggtcctgaggatttagataggacatatgccccattatttatggcttcaata
tctgcctcaatggaatatgagacttcagtgttctttatgataaaggggccaaaattatta
gataagaaatggcaagaggaagagaggaaaaaaggcggaaatccatttatacacttcttc
gatatggcaaaagaaaatggagttaaaatgtatgtttgtgtacaaagcctaaaggatatg
tgccatatgaaagaggatgatgtagtggaaggcatagaactagtcggaggatctacatta
atagatctgacattggaagctgataggacattattcttc
>SSO1126 Conserved hypothetical protein
atggctgaagaaaagaagaagaaattatccataatagtcttctctggtacgatagataag
ttaatgccagttggaattttaacatcaggtgctgcagcatctggatacgaagttaacttg
ttcttcacattttggggattacaagcaatcacgaaaaggagcctaaatagccaacaacca
cctcaaattgataagaactacgaacagatgggtccaataatgatgcaaaaaatgcaagaa
atgaaatacccaatgtggcatcaactagtacagcaggctaaggaaattggagaagttaaa
gtgtttgcgtgctcaaccactatggaattcttcggaataaagagagaagacttagcggaa
tttgtagatgatgtagttggtgttgcaacgtttttagacagagcagaaggaggaacaact
ctattcatt
>SSO1127 (hdrC-1) Heterodisulfide reductase, subunit C
atggctactaaaactatattacctcctcttcctgatgatccaagatttctagacatgtca
tatgatgttcaagccccactaccagaggaagagaggaacttgctaagtaatttaaaaccg
gaagaaagagaagttgcagtaaagttttgggaagctgttaaaagcgatttcagatataat
gagtatttaagaggatgtttgaactgtggtgtttgtacctcgggatgtcctgctgcaaaa
ttctacgatttcggtcctagggaaatgatacagtacatgatgagggatgaagtagacaag
atatgggagtttgtaaataagaaagtttgggcctgtgtacaatgctacacttgctcaatg
agatgtccatttaataatgagatcgctggtttgataatggtattaagagaatatgctgta
aagtttggtttacaatcagctaaggaagtattagctccttatagaagagtcttattaaca
gtaattacaacgggcaaccaggttacaccagatatgatccaacccgatgcgttcccggac
tggggaccacaagctgtagaggagtctaagaatatggatgtgtataggaaggcagttcca
gtggatcttttacaaaggactgatataggctggcacgcttcattacagactgctgttgaa
atgatgactatatttgtagaagcaggagttcttgattccttaaagaacgtcgataaggac
ttatatgatatgatcatggatatatatgaggaaaggaagcaacaattagaggagatcaag
gagaagtgggagaaaggagagttaaaggaagaggatttacctgatagttggttagagtta
>SSO11277 Second ORF in transposon ISC1190
ttgatcttcacgattctgggtattggcagaacgctgggttgtataattttagcaagggtt
ggtgatgttaagcgttttggtgacaagaagaggtttgttgcttattgtggtctcgatcct
cttgttgagtccggtgttgtatcgagaggcatatctagg
>SSO11280 Third ORF in transposon ISC1190
ttgattgctatcaaggttaatcctattatcaagcgtttttacgaggagcataagggtagg
cttaggggtaagaagttgattactgcttgtgccaggaagcttgctgttattacttgggct
gtgctgtattataataagccctttgatgctaacgag
>SSO11281 Last part of transposase in ISC1250
gtgtgtactatgctcgattttttcacggaaaggttttataccggaagctctcagcttcca
aggaactttggaagtgaatctaataacttaatcgagtccttcaactccctcttggaaagg
agattcggtaagtttcactccccttggaggatgctccagatcgctcgaaccatagctaat
aactataacctattaacctattttctcattattgtaataatattacattgtacctattct
tctcgctttatcagaaatattcacaataatttcttcatcgaattatct
>SSO1129 (hdrB-1) Heterodisulfite reductase, subunit B
atgttgagtcaagatgagaaacaaatacaaagggaagttcgagaagccttcccaatgtca
gatgatgttgactggaatgaggtttatcagagaataatttataggtatagcacacctcat
ggactagaacatgttaaagaggaaatgtataaattagaagataagggcgaaattataata
caccatattaagccctacaataacccagtagaagcccaaacactaaacggatctccaaag
aaaatacccacaacaaaattatggcatcataagagttgtggacagtgtggccacataccc
ggttatccaacctctgttttctgggtaatgaataagttagaaatagattacctagatgaa
ccgcatcaaacatcgtgtactggatggaattatcacgcgtctggtgcctccaaccccgta
gccttggcaggagtatatgtaaggaacatgtggagagcttatgaaacgggttacttccca
ttaatacattgcggaacatcatttggtcattataaagaagttagaaacatgataatatta
cacaaagagataagagacaaacttagaccaatcatgagaaaactggatatggacattgta
ataccagaagaggtagttcattattctgaatggttatatgtaatgagcaagaaagctgca
cagcagaagaaatacaatctagataatattaaggcagctgtacatactccttgtcatgtt
tataagttagttccagaggatactgtttacgatcccgaagtattccaaggtagaagacca
gcagccccatctggaactgtacagaatttcggcgctaaactagtggattactcaacctgg
tgggattgctgtggattcggatttagacatatcctaacagagagggaattcagtagaagt
ttcgcactatttaagaaggttataccagcagttgaggaagggaatgctgatatctttgta
acctcagatactgggtgtgttactactttagataagagtcagtgggctggaaaggctcat
ggtttcaattataacttaccagtattagctgatgcgcaatttgcagctttagcaatgggc
gctgatccatatataattgctcaaattcactggcacgcgacagatgtagaaggtttctta
agaaagataggtgttccggttgatgattataaagagaagttcgtacaatatctacaagat
ctaagagaaggtaagacggaaccacaatacttatatccaaagcatagaaagattgacttc
tacttatcacttccagatagagtaaaatggtacaagaaggaggttccaaag
>SSO11307 Second ORF in transposon ISC1439
gtgaggaagttaaccaacaagatcttcctctacctctattacactgtcctagattcagtg
tggaacctcgtgaattacctcctcttcaacttcaagtccacgaaaaggaagcctctctcc
ttcgactccttcgtcaggcttctc
>SSO1131 (hdrA) Heterodisulfide reductase, subunit A
gtggcaagtaaatcagtcttggttataggtgctgggccagcgggtctctcagctactaag
gaactagcgaatatgggagttaatgttgtagttgttgagagagaaccgttcttaggtggt
acgcccaagaggttaaagtatagtttattattccccgagctaagaccagcttctgaggtt
atcgatccattagtaaaaactgtccaagagaacggtaatgttaagatttacacggaaagc
atagttgatgctgctaaaaacacctctgacggctttgaaataagtattaaagataagaat
ggcaaagtaaaggtggagaaagctaatgcaataattgcagcttctggttttgagcacttc
gattctagaaggaagtatgaatacggttatggtataattcccaacatataccaaatatct
gacatagagggtatgcttcacgagaataagctagttaccacaaagggaactccgcctaag
agggttgcaatattattatgtgtaggttctagagacgctactgtaggaaatacttattgc
tcaagagtatgttgtgctgtgtcaataaagcaagctatggagatcaaacagaggattcca
gatgcggtagttcacatctactacatggatataagaacttatggtctaatggaggacaaa
ttatactggaaatcgcaactagattacagggttggttatattagaggtagaatttcagag
ttcatgagaggtcctaacgacactgtcataataaagggagaagatacgatgaacttgaat
agggcgctgactgtgccttatgacatggtaatattggctaatggaatggagcttggattg
ggttcaaaacaagtggctaagatattgggattggagtttgaagagcatggtttcgttaag
ccgttagatccagatagattaccagtccaatcaactaagaaaggaatattcttagctggt
gcaataactgggcctaagactatttcagattccataactgagggatatgcagcagcaatg
aaagcttatgaatatatcacgcatggaatatgggaagagtcggatttcgcaaagaaaact
gcggagatgaaggtggtacatcat
>SSO1133 Conserved hypothetical protein
atgcagatgaagactgatttccttaattctttagagattaatactgaggaagacgtaaag
aagttatttgacgtaatattttatgctaagaaacattatagtgaaattataggtaataat
gggattgataaggttaagctagctttcaaaacccttaaaaacaaggatttaccttatgat
gagagagttaaagcttttacttcacttaaggctagtgaaccagaagatattgaggacatg
gctaaggaaataattcacttcctagaacctgaaaaatatccgttatggactagatgggtc
tggaaccccagtaagaactctggttcaatcacttatgtgttaaaggatggagtagtgttg
aagaatgaaaaggagtattttgacgcggtttctgagctgagggaagttctttcaatcttt
ggattagactcacctaattattattatacttcaatttttttagtatactcttacgttaga
tatgtagattatgctactctgctggctgtagataggaagggaggtgggctttatccatct
cacctttctactacagccatggttttaggtctaaagtctttccttagggtgatccaactt
gccaattcc
>SSO1134 (hdrC-2) Heterodisulfide reductase subunit C
ttgccaattcctgaattagaaaaacccataattaaaggtctaattcaaaaagacaaggta
atagttgatggtgtagaactagacggaacatggaacgcattcatgattgaaagaacacag
actggctacgatcctacagtatgggacgagatagccaatactctagaaggcgttacaata
agcgcgtgctggcaatgcggaacttgtacctctggttgtacgatgagagaatacgatcca
gactatagtccaagaagatttatagacttagccagaaagggcgacaaacaagcacttatt
gaactacaaaactcactctggagatgtgtatcatgtcagaaatgtactcacagatgtcct
aagggagtgctggtagaagaagtggtacattcaattcatcattatctattaaagcatggg
ttagttaagaaagatccaggtacagttttcgatgagttattcttagagactgtaattaaa
aacggtggaaggatttcagaactaacactaggtgccgctgcagctaaagctggaatggtt
acactgagtttgaaagaccttattaatataggtgcagcaatattgaaaggagggcttata
aaagatgtattaaggccaaatagagttaagaactgggataaaatacaaaaggtactggag
gaagcaatgaaggaggaggtggtaccagaa
>SSO1135 (hdrB-2) Heterodisulfide reductase, subunit B (EC: 1.12.99.2)
atgacattacctacaccttatggtaaagtagcattttatccaggctgtgctttagatgga
ttaggtaaatcttatgacgtctcattaaaactagttgcacaagatctaggtatcccgttg
gagaaaatcgaggactataactgttgtggcgcattagaagtaaagaacgtaaatactatg
gcaggagtgttattaccagcaaggaacttggcattagctagggaaatgggggccgatgcg
gtagtttcagcttgtcctggttgtcactattccttatctagaactcaatattatctgact
aaataccccaaattaagagaaaagactaatatgtatttagaaaaaatgggtactaagaat
tatgatctaaagttaatgctagttcacgctgttgaatatatttacaatactgtagggatt
gaggctattaaaactaaggtaagaagaccgctcactgggttaaaagtagcaccatattat
ggatgcctatacgttaggcctaaatcatatacactagctggatatatgaaaatgagggat
gacccagagaggccattctttatggacgagatactgaaggccttaggtgcagaagtggta
ccatttgaggctaagacgatgtgttgtggtggtcctcatgtatactctgatgtagaagta
gccttacacttagaggctagaatattaaaggaggctaaaagaaatggtgcggagatatta
gtcacagattgtcctctaggtcacgtggctattgaaactaacatggagaaaatagctcaa
aagtatggcgaagatctaaggacgccattagcttacttctcgcaactggtggccttcgcc
tttggccatagcccagaagagactttgcttacggcaaatattactaatccaatgtcaata
ctcaaaagatatttg
>SSO1136 Hypothetical protein
atgtcttttttattcatagattttaacacgcattacggtataagactttataattacacg
gaagagcctaagcttacagaagatgaaatagagataaagcgaattttactaaatccgatt
tataagtactcatgcgactgctgtgtagatggtttttatcagcaatatctttggggaagg
aaagattatacactaaagcttggtatatataatccgagatgcagagttcctcctcaggtg
gagctcattagacaagtggataggggtataattggtgtagttctaagccctaaacatcac
aacttttcattacttcattcatcgcttaacttcgtgtatgaactaatagataagagggga
ttaattctggtactatatgatccttctttagacgaactaagatggttattggataaatat
acttttcccgttgtactcattaatagtgaacacgttgttgacaacgagagagtctattat
gtagtgaatcattcttcgaaaattatcgatccaagaagaagtatttatggtagtgatgct
ccgtataattctcttaatttaattcaaagtgcaaaactctttataaaaaaccacggctat
aatgaggatgttgcatataaaaacgcaatagaactattgaaccatgttaatgctaatttt
>SSO11362 First ORF in transposon ISC1225
gtgaggaagccggtattatcacgtggtgaagacaaggtgataacacctggtcttccccac
caaaataatatacaacaagtagggtataaattactttccatgttgagcttcaagggaaga
aaggctgaggaggtatcgagagttctggtctccgcgtgcttgtggaacgactccgtggaa
agcaagtccaaagggtataacgtgagagtgtccggaatg
>SSO1137 Hypothetical protein
atgtgcgagtttaaagtagttactattgaaagacccataagagaagataataatactgtc
ttaattgactattatgattttgttaaaataagtgatactaaaataatgaacgtccttgtc
aaagattcaagggaaaattacagtaaaagctattattattacataagagattatctcaat
aagttaagaatacttaaggagaacatgattaacgtcaagctagtatttccttttgaaaag
gctaatggttcgttaaaccttaagaaagggataatttacgtaactaacgacaagcaatta
gtttacatgaacctacattcaaatgtatacgctaattgtgaaaattgcattgcgaaaccc
ttctgtacttactatttagccaaaatcattggggaaaataggttaaagattggtgtaaat
aagggcaatcctggagaaagttgggataaggctctatcctctttacaatctaagtatgta
aagactaaagtaattgaactccctccttctgat
>SSO1138 Na(+)/H(+) antiporter
atgaatccgataattctagcactttttgatgtgtcaattttcatcttgttagcagaaatt
ttaagctcccttgtacagaaatacggtttacctaagcttataggtgaattattagctgga
atgataataggcccttacgccttaggttctttattaaatcagttgctgggcttcccccta
ataggcataaatagttatatcgaatttttagctgagttttccgtaattctattgatattc
gcctctggtttagaacatggaattgcaccaataaagtcttctggcattctaggattccta
ggagcaacgtttggtgcattattaccctttttcgcagcatattacttctatatctcaagt
tttggtttagattctgctttgatactcggtaccgcgatgggggctactagtcttgcagct
gtagcgtctataattgaagaagggaaattgaaaggtaagggtataaactttatggtctcc
tctgctgcagcagacgatgtagtggatttacttttattatcggttgttatagctatttta
caaggtgagtctacaagcgttacctctatcagtttgaaaataatcgcacttgtagtcata
tgggtagtcattttagtagtttcaattatcttaattccgaaaataactgataggataagc
gataagtacatagaagagttcccattagcagtactatttggtttgacgctattaatggtg
tcactgggttactccccaataatttcggcgttcgttgcgggcgttgcatttgcaaatagt
gtaaagaacagcaaaataaaggaaataagtagtacgttacttagtgttttcggcccatta
tttttcgtgtacataggtgccgaagtcaactttctaacgcttaatcttaatactgtaata
ttatccttagaactaactgcaattgccacaattttcaaatggttagggatattcccgttt
gctctagcttatttaaggaatgcaaaagcagcgaatacggtagcgttaggaatggtacct
agaggtgaaactggattagttattgcttccttaggcctttcatataacgcactaaaccaa
gaggaatttgagggtatagttttcatgtcaatatttaccacattgataggtagtgcgttg
tttaaaatctacgctaagaagcatttggtctca
>SSO11387 Conserved hypothetical protein
atggaaaaagtggtaataaagaaagttgatgatcagagaagaattgttataccaaaagag
tggagagccggattcgatacggaagaccttattatggttttaaaggatgatagaatcgaa
atttatcctaaggtctctaatgtatcaaaactaatagatagtgtagaagttgatgaattg
ccggatgactggcatgagctcaagcgtaagatttatagatta
>SSO11389 First ORF in transposon ISC1225
ttgacaagaacgcaactaattgaagatagatttaaggtgaggaacccggtattatcacgt
ggtgaagacaaggtgataacacctggtcttccccaccaaaataatatacaacaagtaggg
tataaattactttccatgttgagcttcaaggaagaaaggctgaggaggtatcgagagttc
tggtctccgcgtgcttgtggaacgactccgtggaaagcaagtccaaagggtataacgtgt
caccacagaccg
>SSO1140 Conserved hypothetical protein
atgcttaaaaacagaaacgaagtcttgaaaatctccttttcagcctttttcgctgatctt
ggataccaggctgtagtagcctcttttccaataattttcgtattgatctttaaagctcca
attcccctttatggttttgctgaggcattaaattacgggattggtactgttatggcttat
gctggaggtttagctggggataggtttgggagaaaaaggattgctattcttggaaatgtt
cttattctatttacttccctaataggactatctagggattacattcaagccctcatattc
ttcatgatagggtggtggtttaggaactttagatcaccaccaagaagggcgatgatggct
gaagtcacatcaccggaagagagatctgaggcatttggaattttgcattctttagacatc
gctggtgcgttaatagcaataatttatctaactgtattactttaccttcgcgtttccatc
ttttttgttcttttattcacctcaatacctttgcttatgtcaacaattgttttaaccatg
gtaaatgctgggaagaaaagtgagaaagcgaagagaaaagaagcagaaagtaaaataacc
caaaaaagggtcttctggactcttatattatctacaatgttcttcggatttagtcagtac
agctttggatttcctattctaactacaacagagattactggaaaggagtatttgggagta
ttatcttatggcatatttcttggcgcttcctctttatttgggtacctatttggtagaata
agaatgaaagaatttgaaagtttagcatttctaggatatttaattggagcactaggatct
ctggggtttgcgtatttatcgagttttggagtgttttccctttatcctctctctttctta
atgggaactagtgtcgcctcaactgagacttttgaacctaccataatatcgaagataact
aaagaagaagcatttagtacaagtatgggctacttatcagcaggtagaagtattgggata
tttcttggtaatgtaataatggggttcttatatcaaataagctatacatatgcgtatcta
ttcgccgctataacttcgttaatctcctttgcactaatcttaaacttgatcatgagacca
aatgcttct
>SSO1141 Protease related protein
atgtatcgatatatatttttaatgtcgatgctattaatttccattataccattagttttt
gcatcaaatcccaatatgtaccagaatccaataactttgaaagaatttagagaaatagga
acactaaatgccaatgaagaggtaatagttacaatcttcgtaccacttaaaaatctagat
ctattatactattacgccagtggagcttcaaatccagcttcaccattatatcataaattc
ttaagtcctcacgaggttcagcagttattcttacctactgaagagtataaccaaattcta
aactacgtcaaaagtagcggatttcaagtgatatttactgcatcgaactcagtaatagta
ataaaaggtacagtggggcaagttgagaagtatttaggtactaagtatgcggtttactct
aatggttccgtaacctattacactaattacggatatcccaagataaacgcctatgtatac
tccagtaacatttctgcaatattcttcgcccatccatctacattaattacagagagtaca
ataaagagttttcagcaagagataaatcaaacatttccacttgaaggctattggccaact
gtgttacaaaaagtgtacaatgttactacagagggagagaatactacaataggaatacta
gacttttatggcgatccttacattgtacagcaattagcgtattttgataaaataactgga
ttaccaaatcctcccaactttagtgtagtaccaattggaccctataatcctaacttaggt
attgtaactggttgggctggagagattagcctggatgttgaagtagcacacgcaatagct
ccaaaggctaacataacgctatatatcgctaatccaaatattcctttacccgctattatc
gcatatattacaagtcaaaataaagttgatacgttatcccaaagctttagcataccagaa
agtctcttttcctcacttttcaacgggccattattctattcatgtataatattaagtgat
gagtactatgcactaggttcagctgagggaataactttcctagcaagttctggagatgct
ggaggctctgggtatagtaatggaccaataggcactgtagggtatccctcaacgtcacct
ttcgtaacttcagtgggaggtacgactgtatatgtgcaattccctaacggttcgtattat
cagactgcttggtccaactatggtttcgttccaaataatgtaaattatggtggttcaact
ggtggtgtaagtataatagagcctaaaccgtggtatcaatggggactacctacaccatct
acttatccaaacggtaagttaataccagagatctccgctaacgccaatgtatatcctgga
atatacatcgttttaccaagtaacacaaccgggataacaggtggcacaagtgaggcttct
cctttaactgctggagtgctagccacaattgaaagctatactcatcatagaataggttta
cttaatcctatactaacttacatggctgagaattactacggtaaggtaatagagccaata
acgtttggttataacataccgtgggttgcaacttatggctataacttggtaacaggctac
ggtacaattaacgcaggatattttgaaaaaatactacccacacttaatttatcaaaagag
ctaaatgtgatagttagcgtttacaatacatcaatacccacagtatctcctcaacaattc
tatcctggacaacgtattctagtcactgctaatataacatatcctaacggaagtccagta
caaactggcgaattcaaggcattaatagagaactatcttgggaacttaactacgtttaat
ctgacatataattcacttactaaattatggactggtagtggtgttttatccaataaagct
agtggtatcttatttgtctacgtttatggaagtagtgatggattaagaggaattgggtac
tatgagaccttctctggatactacataacattcaattatacgacgacttttacaccagtt
tatgtagagttgggtaatgctgaactgggaattaccttatctaactcatatttccaggcg
ccaattggagtaatgaatattacccttaatatttactcctataacataacaacaaacgca
tacacgtttgtaacgacgttaagtgtacctattaagaatggagtaggagttatcgatttg
ccaccagacttaagcataggagatctattgattatagctgaaggtaatgcctatggattt
gacgcatttaccaatggagtatacatgcaaaccttattcatattgccacaagtggtagtt
gaaccgggcagtgtttcccctgggcaacacattacaatagagggatcaattataccgcca
gttaacttacccagtactacattccaagatgcattacaaggtactaacattactgctaaa
ttggtaagtagtaatggtgtcgtaataaatgaggctaatataccattatcaccaaatgga
atctacttcggatatttgtacatacctaaaaatactccctctgggctttataatgttcta
ctatttgcaacctattactcttatactttgaacactacaattcgaggattctactacggt
caaatatacgtttctaatcaagccacgatctcagtgaagtcagttaactatgcatttgag
ggacaaactgttttcatttacgctaatataacaaatggtactaatgaaattaagttcgga
atgtttagtgctaccgtgtacccctcgagcctctcatttaattatactacgataagttca
ataatagagataccgctgtggtataatcctaagataggagaatgggaagggaatttcaca
ctgccttcagcaattagtgcaggaaatctaacttatttagctggacaaggatatttcgga
gtgccattcaaggtcttaataaccggaatttcagccttaggtaatccaaccactaccaat
tctggtaatgcttatacaatcaacgtattgccatataccttatttacaaatcaaacctta
gataagacgttaccatcatatgcaagtttagttaacgtgaagatattgaatgtaagtggc
aatctattaaatgacttccttactaacgttattatcgttaacagcaatgtaaaaatattg
aatgggaacatatctaatatagtaattagaaattccactgtgttgataatgcagagtaat
gcgaataacattacattatacaattcaactctgtacgccataggtggaagtataaatgga
ttaaacgtagttaactctaaagtagttccaataaacattcatatccaaggtttataccct
gaattaccaagtatttcgataaacttaccttctaagaacgtaactggaacagttaatgtt
accgtcaatgtaattggtgaagatgtaagtaggattaacgtatacttgaatggtaacttg
ataaattcatttacaacaaatgggacccatatagtaactataaatactcaaaattatcca
gatggtgggtataatttaacagtaacagcaattcaaagtgatggtttaagtagtagtaat
agtagttatctgtattttgaaaacggtctaactaatctaaatactaaggtgaatgtaata
tctaaccaattaactaatgtaagtaatagtttatcatcttctatatcttctttaaggact
gcatcattagaatatcagagtatatctttagcgatcggtattatagcaatagttctggca
atattggctctagtaagaaggagaagg
>SSO11412 Copper binding protein
gtggcgaagataaggaaattagaagttgaagtaagaaacatgtgctgcggtcactgtgct
actaatgtaagtaaaagtgtaaaggagataagtggtgtaagagaagtggatgtagattta
agagaagggctagcatttattagcatagatgaaaaggctgatatgaacagagtaataaat
aatataagagaaaaaattactgacctcggatacatggtaggtgaaataaagataatagga
ggtgta
>SSO11417 Second ORF in transposon ISC774
ttgcacgatggtttatcagtttacaatgcctttgattggtttaatgttgggcacaagagg
gttacgttaggcgattacactgaagaagggtttaggaaattaaagtatagagtctcttca
atggacttcgcttgtaattccaataagttaatgagttggttctcgaccttcttcttaatc
tacaacctcctttacattcaagtgtatttagtggataagggagtgatgataaatgcaaac
atttcaactaca
>SSO1142 Transport protein, permease
atgaaaaggaacaagtacataattattggcttcgtaataatgtgctttaattcactttac
caatattcttggaacgctttagagcctctcttaagagagggatttaatgttagtgtagtt
gagatagccttaggctttacgttgttcagcgtattctcctctgtttttcaaccaattggg
ggtcactttgctgataaacaaggtccaaaaaggataggggttatctcagcaattttatca
gcaattggttttctgggtacttatctttcccctaatatttacgtcttttttgtaagctgg
tcaataggtagtataggagagggcatactttacggaatagctgcaaacctagcaatgaag
tggtttagggaaagaatgggatttgcaactgggattgtgtcaatgggatttggaataggt
tcggccatagctaatccctttatatccatggctggtaattacagaatagtaacactcgca
ataggattagttgagatagtactattaccaattctcttgtacatctcagattatcctcct
aaactatctggtcagactccaaggcaagccgttttaagtgtcaaattctggctaatctac
ctttctttcgcaacttccatagttccgctaacagtactttcttcagaattaccaatacta
ggaaaaggtttacctcaacaagaattagtaactttgatctcaatcttacccttattaagt
ggaggattaaggccaattttcggctatattgctgatagattaggtatattgagaacaacg
ttccttcttaccattgtattaacgttaggtagtatttctttacttttaggggaaatagca
ctttcaacgattttagtaggctttgcaggaggctcactaattacactctattttaacgtt
tccacggagatattcggctttaagttttccacagtgaatagtggtatattatatactggt
aaggctttaggcggtgtgttaggtagtattatatttgcattgctttacacgataagtctt
agaacctctgaaatatatactttgtcttgtagcctaataggagttcttaccttattgcca
cttttatttactaagcagagcagaaaggttcaa
>SSO1143 Conserved hypothetical protein
atgttgagtgaatttcttaacttaattgtaatgcaactaaagatgataagggcgtactta
ccggtgtttctcttcttctcaatacttttcccaataggatttatgctagtatttggatat
atctcaattagatcattgacgccattcatagtagctggaacaataacgttttacgtttca
attggtgttttaacttctgttgctcaatctcttgcatttgagagaaatgctggcagattc
tccttgatgatagcaactggtataccgagagagttctatgcaataagtatagctcttagt
aatggtattgccacactaattatgataccaataatcctagtcctaggtagttatttactt
catgtagaaataaaatcaattccttttctacttatcgcactggtatcgtctctatttatg
gcttcaatgttaggtatggcattaggcttaggaattaggaacatatacgccgtaaatcaa
tactcaacaattataagcttcgtactttccttcttcgccccagtttacttcccagtagcc
tttataccattaccatttcgctatttgacttatattgaacctactacttacgtctctcaa
gccctttactacgctttcattggtaatcctttatctttactatggagtttagggataata
attttcggtttcattttcgtcattttaagtagatatgttataagaaggcaa
>SSO1144 ABC transporter, ATP binding protein
atgtatgtcattgaggtaaataacgtatggaaggcttatggtaagattattgcaaatgag
gacattacgatgagagttaaagagggagaaatagtagcgttattgggacccaatggcgct
ggtaagacgaccctcgttaagcaaatttacggtgagttaaccccaactaagggtgaaata
agggttctaggtaagaaaccaactgatagacacgttaagaaattcttaggagtaatcccg
caagaatgtgagccctatggtgatctaacagtatgggataatatatattacatggggaga
ttaaagggagcttctaaggatgaaattaagaagagaggagaggaattattggaaagattg
gatttgagaagtaaaaggaacactctggctagggatctatctggaggtttaaagaggaga
actctaatcgcaatggctttgataaataatcctaaactcctaatacttgatgaacccacg
actggtttagatcctgaagctagaagggaggtgtgggaaatattgcttaacatgagaaag
gagggtcagagcatgttacttactactcactatttggatgaggcagagagactagccgat
aagatatattttctaagcaggaagattatagttgagggaacacctacacaaataaaggag
aaattcgctgattggtacgaggtaattgattatactaacggtaaggtctataaggtgaag
ggtgaggaggagctcaagaaaatcataatgacaattaacggcaaatttgaagttagaatg
cctagtttagaggaaatatatcttcaagtgatgaaggatgttgag
>SSO1145 (trpB-like) Tryptophan synthase beta chain, hypothetical (EC: 4.2.1.20)
atggctatgagaataagaatagatttacctcaagatgaaatacccgcacaatggtataat
atcctaccagacttaccggaggaactacccccgccacaagatcccactggcaaatcctta
gaactattgaaggaagttttaccgagcaaggtgctggagttagagttcgctaaggaaaga
tacgtaaaaattccagatgaggttctggagagatatttacaagttggaagaccgactcca
ataattagggcaaaaaggttagaggagtacttaggaaataatatcaaaatctatctgaag
atggagagctacacttacactggttctcacaaaatcaacagtgccttagcacatgtatat
tacgctaaattggataacgcgaaattcgttacgacagaaactggagctggtcagtgggga
tcatcagttgcactagcctcagccctatttaggatgaaagcacacatatttatggttagg
actagctattatgcaaagccttacagaaaatatatgatgcagatgtatggagcggaagtt
catccttctccttcagatttaacagaattcggtagacaattattggccaaagactccaat
catcctggatctttaggcatcgcaataagtgatgcagtagaatatgctcataaaaacggt
ggaaaatacgttgtaggtagtgtggtaaattcagatataatgtttaaaacgattgccgga
atggaggctaagaagcaaatggaactgattggtgaagatccagattacattataggagta
gtaggagggggatcaaattacgcagcattagcttatccattcttaggagatgagctgagg
agtggaaaggttaggaggaagtatattgcctctggatcctcagaagttccaaaaatgact
aagggtgtttataaatacgattatccagacactgcgaaattgttgccaatgctaaaaatg
tacacaatagggtcggacttcgtaccacctccagtttatgcaggtgggctaagatatcat
ggagtagccccaactctcagtctattaattagcaagggaattgtacaagcaagagattac
tctcaagaggagtcgttcaaatgggctaaattattctcagaactggagggatatatacca
gctccagagacttctcacgcattgccaatattggctgaaatagctgaagaggctaagaag
agcggagaaaggaagacagtactggttagcttctctgggcatggactactagatttgggc
aactacgcctcagtgttatttaaggag
>SSO11456 Second ORF in transposon ISC1058
ttgaagactcctctttccggggtaggcctcacggaagaatgtgtcaattatgtggtagtc
ctcgaacctatcgttttttctctcccaacttcaagttcaaagcccttttccctatactcg
ctgatcgccttgtccaaagccttgtttaactcatccatcagtgttgttctcatcgtctcg
ccctct
>SSO1146 Hypothetical protein
gtgttgatacctaatgtctatcctttaattatttcaagacttttgcaaggtcttagttta
ggcggggaatggggtggagctagtactatcgtcatagaagcgtattctgaacataaattt
agagggtttattacaagtttattgcaattatcagtcccaattggcattatattatcttca
ctcactatcctagtaatctataattactctgtttactggccttactcatttctctcaata
accttcctatcgcttctctcattattgttagtcaaggatataactacgcaaaaggtgact
agaagtgaaacacaaccactattagaagcaaagagacatgattggaagaatattttaaaa
tcaatagggattaaagtgagtgaaagtgcaaacttctatatttttacctcatatattttc
acaaactcatcctcaatttccttcctctcgttaatagtactaatctctatttcctttcag
ctcttcctaaatcccattctttggctacctaag
>SSO1147 Hypothetical protein
atgatcctagccggtattgtgctatcaagaagaaatttccttccaggggaaatactgatg
tcaatttcggattcagctttatatgccccacaatcctcaatatttactgaaatatttgat
aaaaaatacagattcacggtctcaaatttttcctatcaagcagcaagtatactaggtggt
tcactagcaccagtaatactaagagctaatcaatcttcactagtgctagtcacattatca
tacgttctggtgacgtttataagtgtattgctgattgcagaaactaaggggaagaaaatc
>SSO1148 Arginine deiminase, hypothetical (EC: 3.5.3.6)
atgattgctgagtggggaaagcttagagctgtaggaatgcataagcctggcttagaggta
atgctgggtcttttagatccctcatctttcctttatgaaaggcaattcaattggagtaaa
gctaggagagaacatgataatcttagaagagtgttaaaagaggaaggagttaaaatatat
aggctaagacaaacaattgtgaacaagattagaagagacgatagatttagggagaaggtg
atagaaaaagttggagttaataatgatgatcccgaattccttgtcgagttgttgatctta
agacctattcttggttacgagaagagggataaaggtacacacttagaggttaaactgact
gaccctctttccaatctctatttcatgagggatcaacagattactacggaaaaaggaata
ataatgggaaggatggctacacatcagagagaaaaagaagttgaagttatgaagttgttt
tgggaagcgttaaatataaaatataaggaaataggtagaggtaaatttgaaggtggagat
ttctttccaatgggtgatttcaatctggtaggtgttggagttagaactgatttagagggt
gtaagtgagttatttaatattttgaatggaggagagataggtataattcattggaatagg
gaagagttcattcatttggatactttcttcaatgttggatcttctagttcagtagttagt
gttaggagtttcatggaagagagtagggttgctgtctattacgataggaagatcataagg
gagactacgttatacgattacgtggttaaagaaaagggatttaatttaattgaagtgagt
gtggatgaggcaaaaaagtatgtaactaattttttgaccatagacgacggtaagattgtc
tctcctaaaatttccgcaaataggaagcttgaaaaagagtatgatgtaatagaggttgaa
gtttcaaatttgactggtggtgccggtgggattcattgtatgacagctgtgataaggagg
gat
>SSO1149 Conserved hypothetical protein
atgtttttatccttgagcgagattattatcattatgatagagttcgtaattgagaagagt
ttcaatatgccagaggatatagtatggcggatagccagagatgtaaattcaattccaaac
tactggaagggtgttagggaattaaacgttaaggaagtggataagaatgtttacgaggga
agaatcaggtttgcgtttccctcttcgggtaaagttaggataatcataaatgacgatgag
agaaccttaacctttgaatatctagacggaccaataaggggatataataaggtgaaaatc
tctaaagggaaaatctcttctgaatggaaggttactatgactggtcttttaaaactaaca
gagggttggaatagagatcacttcatggaaggtactgagcacgcactggaaatgatatta
aatgctacccttagtttatctcct
>SSO1150 Hypothetical protein
ttgagtatgatagattctactgttatacaaaaacttacgaaatcattgcattacgttcag
aggtttggtgaccataatcacgagttgctgggtgagttaactgggttagaaaacgttagg
aatgtcttatctaatcttaaagtattggttattccgtctcccaaacttgattctctagga
ttatcgctctttcatactactattaagttgacaaggaattctaaggtccaacctttagat
ttctattacctacttgatggcatggtggttgcgtcattgagggatgttttgactagtgat
actatagttttggatgttgtgtttcctaggggtaggtgggattttgttcaaattttagag
atgatgagtagggggggattaattgataattataagacttacttggagtataggagggag
gtttatccagttgattattcaacttttaatttcgatactttgacttttgaaagggttata
ctggataagcctagggaacctttccaattgccggatcttactgacgattttaagccggac
tggattgacgtttatacacttggaaagaaacaagagaatcctttaaggtcgtgggatgag
atagcagaatctataggtttaacatcagatgaagtagtagatcattattttaatcacgtt
gttggtaagggtttggtggatgcgttttacacttatttaggtaagactgactttagaatg
tcgttgatcgtaaacgatactaatgaggagattactagggagttgagtaggattgttaca
cttctaagaatatcttatttacataacgataaaatatacgcatttattgttgggcaaaga
catacattgatagatatcatggagttcattaataaactatcctcagcataccatttttca
tatgaaatttacgtccatccaattacgcctttaagggatttcgttagaacgtattcaata
ccttacgaacacttcacaaaggacaataagtggtcaattacgcttaaagagttaaaggag
aactttgagaaggaattgagtagagtattagaagaaaggaaaaacacc
>SSO1151 Conserved hypothetical protein
atgactgatctgcaatctctttacgataagttcagatacccttacgtggaggttaggaga
catatcgtatcgacgtttgggatgtcttttcttaatggcagattaatgggatcgtttagg
tttacagatgatggctattcagttaggtattacaaggatggcgtgttatattttgcttca
tcaaataatcccaatgatctactgagcagcaacaaggagtataagatagaggggtgggag
agcggtttagataatactgaacctaaggagggtagttatgaggttaaagagggtaaacct
tttgatctcatgtcagttgacgagaagataagcttcttcaagaacctatacgaggctgta
aaggacttccgttcagtcaaaagcgtttcatttttctatgacgaaagtattgaggagaag
gagattattgtcaatggttcacgtatagttggaagggttcctaggctttacgtaggaatg
aacttagtccttaacgagaacaataggacggctactgcgttttacgaacttggaggaagt
ggtgggctggaagtattagagaggatgaatttgaatgaggtcgtagtggacaaggttaga
tctgttactgaggtcttggctaagggtaagagctttggtgagcggactactgatgtagtt
ttgagtaatatgttaacaggtataatggctcatgaatctgttgggcatccatttgaggcc
gatagagttttgggtagggaattcgcccaggctggtttgagttatctagccgaattgaag
gataataggataggtagcgatgtcgttactgttatagatgatcctacaataccgaacagt
ggcggttattacacaacagacgatgagggtgttgaagctagacctaaatacttaattaag
gatggtaaggttaacgaatatttacaaaataggtttagtagtagtaaatttaacgttaag
agtaatggctcggccagggctgcgaatttcgatagggaacctttaattaggatgtctaat
actttctttaaacctggtaacatgacctttgatgagcttttggaagacgtcaaggaaggc
gtttatataaagagttacatggagtggaatattgatgatatgagactaggtcaacgatat
gttgggttggaagcttatgagattaagaacggaaagattggtgatccagtgctattcccg
gtttttcaagggaagactactgaattgttaaaggcagttgatgcagttgacaatacttta
gtattttatccgggtacttgtggcaagggtgatccggatcaaggtatacccgtttggcta
ggtgggcctaatatgagattgagaaatgttaggattaaggtgatgggaaatgaa
>SSO1152 Conserved hypothetical protein
atgaatgaggaaatggtaaaatacgtgcaagaagtaaagggagaagaagtaggactattg
agagtgaagacaaggaggataatcattaagctagttgagagtaaggtagctacaatacag
agaatgactaacagctactatttcctagcgttaaagaaggatagccaggggttcttgggt
aggataaacaatttaaatgaaaaacctaaactaactccagtagacttcttccctattatg
agtaaaaatgagcgggaatacaaaatggttaagaataacactaacattttatcactattt
gacgatttatcacctcttttatctctcatacagtcggaatatcccctttacggtattata
tcaatagatgatgtggaaagatccttggttacatctaagggattcaacggaacggaaagc
aatctgagcataagcggttactttagggctaagaataaagaacatagcggacagtgggct
ttctcgtcaactagcttctcctcctctcaagttaaggatagtataaagaaggctaatgag
ttggcatcgattactggcaaatacgagattaccgaaggtaaatatgatgtaatcctctct
cctttagtaatgggtaatttaatggagagtgttgcgaggatggcttctggatatgcgata
atgtctggtatgtctatgttaaagcctggggaaaaggcaggatcagataagtttacctta
ctagatactcctaaggaggataggcctaactcatggggattcgacgatgaaggcacgttt
acctacaataaggctataatagagaatggtgtatttacaactcctttattaaataatgaa
ctatccaatgtcttcaaattgcctagtactggaaatgcgggatggatatatccaacggct
tggaatttagaggttaaggagggagacactagttttgaatcattgctgtccggtaatgtc
gtttttataaataatgtgtggtataccagattccaaaattacgctgagggcgatttctca
acagttgctagagatgccactgtagtctatagaaacggcaatcccgttggagttattggt
agggtaaggatagctgataacttaaagaggattttaaagaatatagtagaattatctaga
gagaggtactccgtaagatggtgggatgccccaatgcaaggggtttatccatacgcttta
gtcaaggatgttaggctaagtatagcg
>SSO1153 (acd-1) Acyl-CoA dehydrogenase (EC: 1.3.99.-)
gtgaatgaggaggagtataggttaaagttaagggaatggataagaaatagcgctccggag
tcattaaagggaagaaaaatcctatttgagacggtagaatttgatgattataatgagtta
aggtcttggcaaaggaaattggctgatgccggatatttgggaataacttggcctaaggag
tacggtgggcaaggtttagatccaatttacgaagtaatcgcttatgaggagttcataagg
gcaggattgccatatggtagaagtttagggtcaattggtttaatggtagtagctcctgcc
attttaaagcatggaaatgaagatcagaagaggagatatctacctagaatactaagggcc
gaggatatatggtgtcaaggtttttctgaaccacaagctggctcagatttggcttctgtg
accactagggccgaggataagggtgattactttttagttaatggacaaaaaatctggagt
agttatgcccatattgctgattatatgatactcttagcaagaactggtgaggataagtat
aagggcttaacgatgttcattcttaacatgaagcaggagggaattagagtatcccccata
aatcaattaacgggaaagagtgactttaacacggtgtatttcaacaacgtaaaagttcct
aaaaataacgttataggtaacgttggtgatggttggaaagtcgccatgacagttttaaat
catgagaggttcatgttgggagttacaatgttatttacgtcaaagatagccttggagagt
ttgaagggggtaaaggagaaagaggagttggaagatgaagttgaaggtctagaggcgttt
tatagaaggattttaataaagttgaggaaaggagaggatatagacgtggagggatcgatg
ttgaagcttttggcatcagagttgctccagaggatatatgagatcgcagtgatgaattac
gatttggaaaccataatgaaagagaagtggtatttaggtatgttagcttctaggggtaga
acaatagctgggggtacttcagagattcttagaaacgtggtaggtgagagagctcttaaa
cttccgaaa
>SSO1154 Monoamine oxidase regulatory protein
gtgagagagctcttaaacttccgaaataattatattgcgtttctcttttcttataatatg
ttcttcgatgattttcaagtcggtcaaaagtgggagagcaagggaaggactataactgat
gcagatgttgtaattttcactggaataactggtgcgcttaatccactattcttagatgag
gagtatggtaaaaagactagatttaaaggtagaataataccaggtttgttaacagcctca
attgcaatcggcttaacttatcaattacccgtagatccttttggcgagggtttcgtagct
ctaactaaattagagatggatgccaagaaaccagtgaaaataggggacacgttaagggcg
atagttgaggttactgacaagaaggagagggagaaggatggcagagtatatttgacaatt
aggaccctgaatcaattgggagaggaagtaatgacgttaaaaatggaaatattgtgcaat
aagagaagt
>SSO11549 Third ORF in transposon ISC1212
ttgataaacgttaagttaatggccgatagggcttggatttttagggaggacgtcttagtt
aaggatgttggtagtgctagacttccggttgagggtagtggtgttaagattagggaaggt
aaggcttcgtctacaaccttaaggggagtggttatggaggtattcttccttaacttctat
cgtgatctcgaaattctttcgacgaggattaggacgaaggtactcgttaat
>SSO1155 Conserved hypothetical protein
gtgaatagggagttaatattaaaggcgttaatagactggaatttctggtacaagaaccaa
ttcgtcggtatagaaagagagtactctgatcaattgttagacctattggaaaaaggttta
gcgatatcagtaattggcgtgaaaagatctggaaagtccacaatcattaatcaagtagtt
aagaagctaatagagaaaaaaggagaagatccattcgacacgctaatagttaactttgag
gactctcgctttggcgatataagaactgctaacgatttgttctccttatatgagttatat
aaggagttaagaaaaaagaaaaaagatagtaaaccgtacattttcttagatgaagttcag
aagatcaagggatgggagggatttgttcggtccatcgtagatagaaaggaagctaatata
gtgatttctggatctacagcgtcagtgaacaataagagcgtcagagaagtactagctggt
aggcatttaattctagaagtatttccactatcctttaaagaattcttagaatttaagaac
attagattggaaacggaattagatatgatagccaaagaaagcgagattaaagtgctcttc
tcagaatatttaagctacggaggatttcccctagtagtatccaatgagagggataaggag
aagatattactacaattgtatgaggatataatttttaaagacgtaattagcgaatgcaat
ataaggaatgaggaagaagctaagaacctagccatattttacatctcaaacgtagggaat
aagatacgttttagaaaaatatctaggtcccttaatatcccctttagaaacgttcaaagg
tatactgagtgcatgaaaaacgcttatcttattttcttcgtaaaagccctaagcccaaag
ctaagtgaaatggctaaatacgataagaaagtgtattgcatagacaatggtatatccaac
gtattaggatataggctaaatcaaaatatcggtagcttatttgaaaatctaatattccta
gaactcttgaggagatatgggattaacaatgtcttctattataggggtagaaggggcgaa
gtagacttcgtcgtaaaagttaaggatgagataagggaaatatatcaagtgacttaccag
ttgagtgacgtagagagggaactaaaaggtatcgaggagtttctaaagataagaaaaaca
aaggcttacattataacttttgatgatgagggagagataaaggttggagatgacttagtg
aaagtggttaagggctggaaatggttactgttggaa
>SSO11553 ORF in partial transposon ISC774
ttgcatgatggtttatcagtttgcaatgcctttgattggtttaatgttgggcacaagagg
gtcacgttaggcgattacactgaacaagggtttaggaaattaaagcatagagtctcttca
atggacttcgcttgtaattccaataagttaatgagttggctctcgaccttcttcttaatc
tacaacctcctttacattcaagtgtatttagtggataagggagtgatgataaatgcaaac
atttcaactaca
>SSO1156 (acd-like1) Acyl-CoA dehydrogenase related protein (EC: 1.3.99.-)
ttgcttttggacgttgagacaaatgaggatttagaactgattaaaaactcatttaatgag
ttcttaagtagggagtggaataagtatgggtctaagaaacatgaggttagtagagataaa
attatggaagttttcggtaaggttaaggatttaggtatcttccagttcatcagagagact
ggtttgacaaacgccttattgttaaacgagattattggtgagaacttattgccggggata
gttgcttttagctcgatgttaggagttgattatcttgtaagtgttggcgttaattacgtt
gctgaggttgataaagctgaggccattgttacaccaaaggggatttcaaataaaaatgac
gtagatgttgaggagatagaatcaccagatccttcagtgagagtttataagataattgag
ggagagtggagaaaatcagatttcgattttaacaaggtaattttacttgcctcggctcaa
attataggtcatgcaactgctgtgcttaaggagactgttgagtactctaaaaataggata
gcgtttggtaagccaattgggtcttatcaagcaataaaacataggattgttgacgatgcc
ttaagaatagagttagttaggtctagatatttggttaatccgacaagtccagagaggata
tttaaacacgcatacaagaaagccttcaaagcaattctcaactcaattcagtctcatggg
ggaatagggtttactgcagatctggatttgcaccttcatctaaaaagggttatattacta
gggaagttattccaacag
>SSO1157 Conserved hypothetical protein
atgaaagtctttgagattcctctaagtttcgttaaggtatttttaatagagactaatgag
aatggactgatcctaatcgatagtggtactccaggtagtgggagaagaatcattgagggt
ataactaggcttgggaagaaccctaacaagataaaaagcgtaatatttactcattcacac
gtagatcatattggaggggcttatgaagtaaagaggtttgttaatgatgctaagtttggg
attgataataacggtgttaattatttaaagaacggtaaaataagagaaccagtcttgcat
tcttcagcgcttaaggttattttctcaattggcagacctttcttctttaggaaattcaac
ggtgtaaatgttgattttgttctagaggaaggtgaactcgtaaagggagtcgaaataatt
aagactcccggtcacactaacgattccatttcaatttacttgccggaattaaacgctata
atagttggtgatactttgcaaggtgataagaggggattaaagtatcctaatatttatgag
gacttcgatgggctaaggaaaagtgttgagaatataaagtcgtttaatccatcaatggtc
tacgtttcgcatggtgtaagttcctctaagtttttagta
>SSO11571 Hypothetical protein
ttgtctctttatcaagggcacggaaactactattttagtgaagtttttacaacagttatc
atattttcccttggtaatactagaaaaccgttatcatggagaaaatatttaaattctcta
gaccccccaatgaaaagatatgaaagtacagacaactcagctggtaaacagggc
>SSO11575 Hypothetical protein
ttgatgaaagttgttgagttgaagaaaatatattctcaaatcttatccctttcggaggaa
tgtaaaaaatgtgtagattgtgaagcttgtgatagagtagaagaattaatagattacgta
attgaaaacatagataaaatgccgattgaagagcaaacagaggctagaagaatattaaat
agtatacttacgcttagaaaggaaatt
>SSO1159 Haloacetate dehalogenase (EC: 3.8.1.3)
atgggaaaagaaaagaaaatcttagcatttgacttatacggtacaattttggatctatca
gcaatttcacaagaaatgagaaggaaacagttagaatatacttggctattgaccataatg
ggaagatatgtggattttgacgagataaccaagatagcaataagttacaccctaggagag
gataaaatagaggaggaattaaataagtggagaagtctaaggacacatcaagatgcaatc
tacttaaaggacatctccacaatagctgatatttacattttatccaatggtacaactaag
actatagaggaacttttgaaacttaatggtttatcaagctattttaaaggaatatttagt
gcagaaagagtaaaggaatataaaccttcacccaaggtctacagatacttccttgaggca
gttaagggagaggcttatctggtttcatcaaatccatttgatgtcattggtgctaagaat
agtggaatgaagggcatatacgttaataggagaaatatgccagttgacccgttaggctat
gaaccagatgttgtggtaagggatttcaaggagctatatgaatggttacaaaaa
>SSO1160 Hypothetical protein
ttgcagagaattatcttagaaaacatggagttatttagaaaagccacctttttattgaga
agagaaggagtacttgcaatagtattctttggaagtagagttatggggaaatataagaag
gactctgatttggatgtattaattattgtaaaggacgaagcaaaggaattgaattttagc
gatgctagattgagattcgtaaaagatacaaatatttatctggatactgttataatgaca
aataaagaatttaagaataatctaactctaggaactgttttaatgggagtatctatagca
ttttgtgttacatacgatgaaattaacgtttacgaggaattagaaaagtggagtaacgat
ataaggaaatacggtgctgtacttcaactaccttatgggagttttattgttggtagaact
attagaaagtgcaagataagtttc
>SSO1161 Conserved hypothetical protein
gtgattccacctaagtttagagaatattctaaggccttcttaaatatagcaaaaaaagat
aatattagagctaaaagagctttagagcttaaagattatcctgaatgtctcttttactct
caacaatctgttgaaaaaagcgtgaaagcgatgttagaagtaaaattgatatataagaaa
gaacacgacattatagcagatgcttcgaataatttacaagatcttggaaacgaattagat
gtagtcttgaacgcattagactatctttctggcgcatggaacatatctagatacccgttt
tttaacggaaataatataactaccccagaggagtttgtaactgaggaaatgtgtaaagaa
ggaataaagtattctgatgaggtgatcgaaattgcagagaattatcttagaaaacatgga
gttatt
>SSO11614 Hypothetical protein
gtgaactattcaaaattttgggcaaggtttaaggaatgggctttgaccacaaacgatgaa
gttatcttacctcataagctgagaaagatagttgaaataatcaaacgaaatcccgatata
accttagttagacttgcgggatatttagatactgatgctctatacttagctagatattta
cgtaacagctataagaatatcgtagaaacc
>SSO1162 Multidrug resistance protein
atgaactcaagcaatctagcacttctagttctagtctttgggactttgatgtcagcaata
gataccacaatagtaattttggcaataccaacaataactgaagacttacatgcagaccta
ttcattatgatctgggtaatcattttgtatttactagttatagcagtattcactactcag
ttgggaagattgggcgacatatatggaagggcgaaattttacaacttaggctttgcaatc
tttaccttaggttcagcgttatgtggggcgtctcccaatgcgatttatttagtagtcttt
aggggtattcaaggtattggggcagctatgatgcaagccaatgcaggggcaataatagcg
gatatttttcctccaaatagaagaggaagggcttatggatatactgcaataggttggaat
gctggagctacattgggtatagtcctaggtggatttattactaccttcgttggttggcgt
tacatattttacattaatgtaccgataggaattatcgcattgatcttaggtttaaggtac
atcaaaaccttagaaactaggaaagttaaattggatattgctggaatgggtactctatta
gtcgcattgtcatccatggtttatggcgctgtcgatattgctggatatgggattagagct
ttgaatatggtcttgatttcccttggtctagtaattttgctaatattcttctggttagag
ggaagacatgaattcccaataattgacttaagggtctttaagggtaatagagtcttcacg
ttttcattgttagcgtctttcttacaaagtactggttatttagctacggcgtttattata
ataatgtatttacaaggcataagagctctgtcacctcttaatgcgtcccttcttctcgtt
cccggttatgtcttagccagtctagtagctccatttactggtagattatctgataagata
ggtgctagaatgcccgctactatagggttaagtttaatgatagttgctgtcttaatttac
ctcactctctccctgaataccccactctatattgtaatattggcttctacaattggaggc
ataggttcttcattgtttttccctgccaataacagcgcgatcatggcaaatgctcctaag
ggattttatggtggtgcgtctggactagcaaggacattagccaacttagggagtataatc
agttatacaatagcaattagcgtatcatctatcgtcattcctagatatgtggcatttgag
gttttcctagggacttcaaaccttataggtggtgtggcttctgcgtttctaacaggatta
aaggccgcattttacgtttccttagctatcttagcaatagcgttagtactttctgcaatt
agaggtaaggaggttagaactcaagtttcaaag
>SSO1163 Hypothetical protein
gtgaagtatcagattaaagagataactgagtccaattaccatctgcttccacaagatcta
agtgtatgggaggatagagacgcatatcacttctggacagaagcttttaacgttcttgga
ttacaaagcgttgctgaaatatataaggcactaaactttagcaattacactatagttcta
aactacgagaaagaattaaatcaaagcattttgaagaatttctggaataacgattatttt
gcctcagcattaggagtttcagttatatttgaaggggggaaaagtgagtcaatattgact
ccagaacccccatcagtagattccgctacgttattaccaattgattttggttaccttcct
cccacttccaattactccatttcaaactttaaactagtaaacagaacgctcttcctaact
ggcgggctagcaagattccctaatgatatgtatcattactcccaatcgctttacgatgct
agtgccccagaacctccttggatgataaccacattttttgaagccttatacctagaagaa
ttaggtaaaagcaatgaggctttaaacttaatgtattgggcttataatcactcccaacat
ggccttttaccagaagctatagatcctaaatatgcatatcctttacctactacgtcacca
ttaacttggtcatcagcaatgtttgtaataacggctttaaactataagcccccaagcgag
tcacaaagtgtatctcctttattatacgttataattgtgattatactagctactattgta
ataacggtaattagcgtattgaggagaaga
>SSO11637 Hypothetical protein
gtggtatatagacagtgtataagatggaaaaaggggctagtgaatacgcagtgtgagata
gaggttcaaattagtgatgatgatgaagtttacgttataaaaaatgggatagttaaaaga
gttaaaggagaaaacgatatcataccctatataaacaccatttcccctgcatttagagca
ttagtgttatacttcgtcagactt
>SSO1164 Transposase ISC1250
atggaactcttaactgttaacgaggtagccctctacggcgttaagctaagggagctcgta
gagggacccggacagagctcgaccctcacgctcgtccccaagatattacccgatgatgcc
ctattaaacaaatcggtcccggagatcgagaggatggccttggaggaggcggagagggtg
agccccaactacaggaggggtaaggaggtgaagaggaagggttacgcgaggtacaggttc
cttaaggggtttaggattgtgatggtgggaagggagatgaggtacgagctggagtggatc
tcggtgaggcttcccgtgctttactgtgaggggagagtgaggacgcaggttgaggagact
ctcctgagggaggaaaggaaggtattcatggccttgatggcggtctactcggtgaagggt
ggtaagctcaacgcaaagatctggatgcccgagattgaaattggcggtgacttcaggtac
gttatagttgacgggaagtacgtgaagcttaagaggcgaaaggctgtcctcctggtggcc
attggcgtgacccaggaaggaaggagggcggtactcgaggtcatcgtaagcgaggctgag
gacaccatggcctattggagtctcctggtcagggtttggaagaggtcgagcttcgtcctg
gtcgtagccgacgggatccaggccttggacaaggccatctccctcgccgaacttcacgtg
ggaaggcagggctgcctggtccacctcaagcgccgcgcgaccaaggaggaaagggaggct
ttagacgcgatcacctcgtcggccgagctcggagagatcaagcccgagaccaacccaacc
cttctaagctacctcgttgcgagcaaggagctctggaaatggctcaagaccaacaacctg
gtcgagtccttcaactcgctcctggagaggaggaggttcgggtcgtttcacagtccctgg
aggatactccagatcgcgcgggccatagccctctactacaacctattgacctattttctc
actattgtaataatattacaatcatcttcattcctcccaattcctcagaaatatatccaa
>SSO1167 Hypothetical protein
gtgagaggagaagaaattatttttataattctgatatttttatcctttctaaaccccttg
ttaacattttctgctacatcatcactgaaatattattcaccatcttatctactattaaac
aattggaaaaaccaatccatttggatagtaaccggaataccagtaccgaatccccaactt
aatggatttcctctctttaatacatccataagaaacttttacattggaaaatacggtata
gttaacctcaccgtgagctttaacgttataacgactttagcctatttgaatctcaataat
accattaatctagcctccactagtggaaatatctctataatcatgccacctaaaactcca
tatatccttattctgttaaatgcgaactcaacaacctcgattgatattgccactaatact
agcatatcaataaacaattctattattagtgtagacactactccccaaatttacatttta
acgaatactagttaccttattcagaacaagaccgtaaaaataaacgttaacaaaggagaa
tggttcttggagttgagcattggagagaaacctaattttaacatatcggggttacttgaa
ttaaatgatatagaagtagaaaaatggcttaacgcatctaagttaccaaatagcttgcca
aacgatttattgaaagaatactatctttcacttctactaattaaagatgaccaaaatcca
tatttagggacattcgctgcttcaccatcaccaatttatctgttttcctgggtgagggat
tcggcctttagtgctatggccttgcaattggctggacattacgactccgctttaaagttt
tggctatggatgagtcatgctgagcaattacaacccggagtttggtacactagatatgat
ttctataatggcaatcctgatactacatttggaataccaggggcggctcaggagtccatt
gcgaattgtatttcc
>SSO1168 Sugar ABC transporter
atgatgagttacgttaaattagagaatatttggaaggagtatgaggagaagaaaaggaaa
gtgcaagttcttaggggactgaatttagagatagaaaagggagaatttgtagtaatctta
gggccatctggagaaggaaaaactacaattttgaagattatagctggattattaagacaa
gataagggacatgtctatttgagaggtgaagttgtagacgatttacctcctaaagataga
agagtagcaatggtacctcaaaactacgcaatatacccttttatgtcagtttatgataac
atagcgttcccgctaaaagtaatgcacttgtcaaaagatgagataaagaaaagggtgtta
gaggtagctagaatgctaaggatagacaatttgttagagaggaaacctagccagttaagc
ggagggcaaatgcaaagggttgctattgcaagggcattagtaaaaggagctgatataatc
ctaatggacgaacctttatctaatttagacgcacaagttagggtagtggctagagaagag
ctcaagcaactacaacgtgatcttaagcctacaataatatacgttactcacgatcaagtt
gaagctctaagcttagcaacaaaagttgcaatacttcacgatggtgtagtacaagcttat
ggcgatccgatggaaatctacaagagaccaaatagtgcttgggtagggagcttcttagga
aatcccccaatgaacattataagaggtgaaatagaaggcgactccataataatagatagc
tatagaataggattaccagaagagtacaaaaatttagtgaaaaatggtcaaaaagttctt
gtaggagttagaccagaagatatggagatacgtaatagtggagaaatagaaggaaaggtt
gaaatggtagaggatctaggaccatatagtataattcacttaaagatcaatgaagaaact
actattagagttatagagaaatcattgtctagacgagaaaggggagaaaaggtacgaata
tccattgatactagcaaagtagtcctcttcgatgcttcaagcgaaagaaatctacttgag
caatatgagaaagtgagcaagaag
>SSO1169 Sugar ABC transporter
gtgattcacatgatgcaaataaaaaaatataggttatttaaaatcctaagattagccatc
tcatatttagtgttaataattatggctgctttttctatattcccgctctattatgtcttc
atgacatctttcagcaacgctccaaatttgatttcactagctgtgtcggatttattgcct
aaacacatttacttcacagcctacaaatatttatttactacaaacttatatggaggctct
ttcccgttatggataagaaatagtttaatattagctggttctaccgctatcatatcagtt
ctattagccttaataactggatatgccctatctaggctcaacgtgcctgctaagaaaatt
ttagcaactttcatctatattgttacgtttttcccatacaccgcttctgcagtaccctta
tatctattgtttgctaagttccatttgcttaactacataggtcttattttagcctatact
cctggaacatcaatttttgcagctttcatagcaaagttaagcatagattcgattcctcca
tcatatgaggagatagcaatgatcgatggtctatctagatttggggcatttttaagaata
gtgatgagattggcattaccagtggtggctttaacagctctattaggctttagtggaaca
tacttggatttcgcattagcgtattcttttctccttcccaacgtaaaggagtggactgca
acgatagggctgtattatatggctggtttactaaatcaagcaagtgctccagcatacaat
atatttgcagctggagcagttataatggggataccgttaatggcattgttcattgtttcg
caaagaatgatgacccgtgcatatagtaatctggcaggggtgaagcaa
>SSO1170 Sugar transport protein, hypothetical
atggtgaatcaagaaatgaaaaaagaaaagttattttcccttttttatattttgcccata
gtcatagtaacagttttcctcttcgtatttccattactttattcagtttatatttcattt
actaatctaagcttattacactttttaacctacagttatgttggattgaggaattatctc
attatatttcaatatggctatttcttggagctgttaaagaatacgttaatctggactata
ggtagtttgttaacgatgatgtcgttaggttttgtattagccttgattctaaaccaaaca
gaccttaagggaagatcaattttttacgctatattaatactaccttgggcttttccgggc
tttatatctattctaatatggcaaggtttatgggtagatccgtacgggatgatgaatagg
ctaatcttgccattactccatttacctaaagtgaactctttgacttcaactactgatgct
tggatagagctaatagccactaatgattggctttcgttcccatattttatgacagtgttc
tactcagcattacagagtatacctagagaactgtacgacatagcagatttagacggagct
aatgctttcacaaaattcttaactataacattaccctctctcaagaggactattgcattc
gtgttcataactagcttcgtgtttacttggaataacttttatccaatttatgtcctaacc
ggtggaggtcccgggatctcgactgagacatttatagtttatgcctatcaagaggccttt
agctacaataatttcgctctagcagctgcttggtccataatatcaaccattttcgtaata
gttttaggaataatagttatcaaatacacgagaattttagattcgtttaca
>SSO1171 Maltose ABC transporter
ttgggtagaaaagggaaaaagatagattataaggcgatttcaaagacattagtagcggtt
ataatagttgtagtgattgtgatagcaataggaggtgtttatgcatttttaagcagccaa
cattcaccagctgcaccatcatcaacaactacctcttttacatctacaacaagtagtaca
acaacctcaagtgttctaaatactagtaaccctcaagctttaatgcagttggttggtatc
tcaactccgccttccacaccagttacaataacagtatggaatagttatagtacctctgaa
aatcaagcgtttaatgaaacactagctcagttcgagcaagcatttccatggattcacgtt
caagtaacatatggagttggagttggtacttcccaattcgagactgctgcaaaagctgga
caagctccgatagtatatagggatactagtgattctggaggcgcgttattcgctgctgga
ctagtactaaacttatctcaatatttgcctcagagtataacgtctctatacgtacctact
gcaataaaagattgggaattaaacggctccttatatggactaccagataatgtgaactat
attgttatgttctataacaagaagttcgtcccgtatcctcctaacactactgaacagcta
gtacaaatagccgaaagcgttaacaaaacttatcatgtctggggaatagcatatggagct
ggtgatgaatatgggtatagatttgcagcgtggtttgccggatttggaggacaaatattt
actactaataatggcaagattgttcctgctttaaacagtactgctatggttaacgcattg
aacttctggtataatttaacttataatcttaaggtcaattacttggctccttctactggt
gctggaggtgctgaaggtcagctatttgttgccaatcaaactgccataatatttgatggt
ccttgggatttaaatgcgtatctccaagcattaggacctaatttaggagctgcaccgcta
ccggtagttagccaaactggattaagagctgcaccatttataggttcaactggcttttta
gtatcttcacctcaagcaagcggtgctacaccattacagataaaggcagcattattattc
gttctatatttcactaactatcaggctgatttgagattatgggaagttgcacacgatata
ccagctaatttgcaagcctataatgaggctctaacccaattaaaggaaggaatgttacaa
ccaacataccttaatcaaataatggaaggcattttagaacaagctcaatatggtcaacaa
ttccccaacataccccaaatggcgtactactggaactcattccatcaatatgccagtgag
ttcttcgctaataaggtaaatgcgactcaagcatcgcaaggaatggaacaagcttttatt
caagctcttgttcaaaacggcctaatgtcttcactatcacctttacccataattcctcag
tatatgttattactaatctcagtgatattaacgccaatggtcgtagtgattactcctaga
aaaagatgg
>SSO1172 Conserved hypothetical protein
atgataaaaattgcaattttagccatgggtaatttgcctaaaacagcgaaggcattttta
actctattttttcttctaagtttaatttcttgttcattcctcattccaacatcacagtca
ataagcgtaaactttactgtgtcaagcaatggtatggtatccatttatattggaggtata
ccatggaataacaccgttattctacactacggaatagagaacggaccacaacaagcgtgg
actaacatctcaaacgttgtaatgaaatggaatgggcagaatttcagcgcaaccataggg
cctttcgctaatggaacctggataggttgggtgttttacgataatactactggacaatgg
ataaattacgataatcatccattctggaattggaatttagaggttaatcctccaaatgta
gggcaaacttacgctacagtgcttcaaaacggttcaatattaataactgcaataggaaga
gcaccagaccagctcgatatacattatgggctaactactggaccccaaacgggattacca
tggggtaatataactgatgaattgatgacttacaatccattatggggtaattatacgata
atcataggtccttttaagccaggccaatgggtacaatgggtctatcacgatctgactcta
aatcaatggtatcacaacacatctggtcaaaacttcgcaatacaagatgtttattcattc
attcaatacatcaatgcttcatataatagatatgtttacgttgagggtcagccagtaagt
gttataatatatctacagaacactatttcgcaagcgattaattcctcaatttcgattcag
atcgctggcaaattatacaatatctcctcaacgttaaaaccgggatataatctattatcc
ctaacactagatacctcccaaataccacaaggtatatactatccacaattaagcatttac
gtgaataatactcttcaaagacaagcaactctaccacaattatatgtcctaaacactact
ggaaagaagcccttaagtttagtaatagtctggaatatgcaccagcctctttatgtagct
ccaaatggtagttgggagcaaccttgggtatggttacacactgggcaagacttctactgg
gatggaagtttagtcggagcctatgaacttcaagcgttattgataagacagtttaacgtt
agcgtaacgatagatttcacacctgttctattatatcaatgggagacaatactgcacgag
aagaattatagctttacgtctaattttggaattattcccaatcatgatatatctgctgta
aattataccattaatctctataggcaattaattaatgagggtaaggtagatgtccttaca
gtgccattttatcatcctttacagccattgctacttcaagatggttattggagcgacgtc
ttagctcaaatcagaatgggtgagaatttcactcatgaagtttttggagtgtgggctaat
ggaacgtggactccggaaatggcatttgacatggatttagtaggactttataatgagagt
aatatatcctatactatacttgaccaacaagccttcttaccttacgttacattggttaga
ggttcgttgaacccagatcagccctttatcgtagagaataatctaggtcaaactattatt
gtactatttagaaacacaactttatctaacgaatttggttttaagttctttagccaatct
cctcagcttactgcacaagaacttatacaacaattggctgaaatatatatgaacaatcca
ggtggtgttgttacagttgctttagatggggagaatcctcttattttcaatccaaatact
ggcccagctgatctatacgcaatctatcaagctttatccgaatatcaagggcaatggcta
ataactcaaactgcaagtgaggcaatagctactcacaagccttacagtgtaataaccaat
ttacttgtgaattcatgggatcttaatctaaactattggaataatggataccttggaaag
actgaaatatggcaaaacgtttcgctagctagggaatatctagtagcttacactgcagct
gttggagccaacatttcaccattagtctatctacctttgaatgagacacctaattcaact
aatttatttgatacattatggaattacctatatgttgcagaaggtagtgattggacttgg
cagactggtcctccagcctatggtccattatggtttaaagaacaagcactgctctacact
tctacgataatttcagaggttaaacagcagtttgatctaataaaactacaaagtgtaaag
ttagatggaaataacttaaagctcggcatatataacggaatcaacactacggtacattta
ttactggtaattaccaacggtaagcaagaaatacaattacctataatattaagtcaagga
caaaacaactttaagataaaaatatctaatgtgtccggtcaacttcaaatagcactttat
tctcctatttctgcttcacaagtaggcttaacattaatacccattaatagttatggattc
ctagtagcccaatatcaagttaatctaaacaaatcaacaagttccatgggaacttacctg
ttggcgttagttggtatactagtagtgtcagcaataatagttatagtaatgaagaggggg
cacatt
>SSO1173 Amino acid permease related protein
gtgagtagaagaaaactttcagtttttgaagccttttcactgtcctttggaggacaagcg
ccctttacctcaataattacatttggtactataggtctacaacttggtggatccttctta
actattgccacaattattgggacgattctagtgttagtgaatggcatagtaatatataga
ttgtcgttaaggtattcccaacatggaggatacttcacctatgccttctattcgcttacc
gaaaggctaggattagtaactggatggctatttttactttatgcatttagttatggtggt
acattattagctggttcaatttacattataacaagttatttaaagataagtgctgaccta
gttgcatttctagtcatattattttcagcatttctggttataaggggtttagatgtttcc
gttaaatacgccgagttcataagtattgctgagatagttgcaataattgtcagctcagtt
gtgctattgttagggacgaaaccaagttttaacttaacgattccgactaatccctttcta
gttatactttacgccataggaatgcccataggttatggaaatttgaacccaatgagtgaa
gatataaagaatgcgaagaaaattgtggggataattactgttatcgtgatacttttaggt
ggattgctatcagctttgcttttttacgccagtgcgctatatgggactgatttgatagaa
attcttttagataaggttggattcatatttccctatttgatcttctcagctttaaatggt
ggaatattgggtggaatagcctatattatagcgatgtctaggatccttcatgcaatgtca
ttaaagaatcttatgccatcgattatttcatcggttaaatataatagaccatataacgct
gaggtcatatcactcattatctatactgttattttgtttctcctaactcacttcgttggg
ctatatacaacctttctagttttagggggacttacggtattaagctatttgataatatca
ctttcagccaatctttcgctatttaggatagcgttgaaaaaactaaggaagagaaaaatg
gaaataacgattgcgatcacttctacgttattatccttaataatattagtgtattcgata
caagaaaacactcccataattaactacatattcttcgcttggataattgctgggtttatc
tatgcagaagtacttgaaatagcaggaaataatggaaaagatgatgaagat
>SSO11734 First ORF in transposon ISC1058
atggaaaagagtaagtacaagagggactggagcaagtacgacgagaacgtcataactaga
tataagttgatgttccccttctacgtattcgaacattggtgggacttattagcagaggag
aacaggaacgctaggacaaagtataaagctccgaaggagttcaacgacttcctagccttc
ctccacatcttcctaccttacagagcaatagaaggagtattaagagccttagaacaattg
aaaatcatccccacaagccaacaatatgggagagag
>SSO1174 Na(+)/Ca(2+) exchanging protein related
atgctactattttggttagaatttatcggaattttcatagcgatctttgtgtctgcagag
ctcttagctaaaggggcagacgaactagaggatttcttaggacaaggtataactggtggt
ataatactcggattcctcacggcgttaccagagaccattttcgtaattgtagcatcttta
gaaggtagttttgatgttgcattaggctcagcaattggaggtaacgtattgttatttaca
ttaggtattggactagttggagtattttatgcatttaagtggaggactgcacttcaaatt
tctagtgagtatagtgttgaaaatgtttttctggtattaactactattggaatgttactc
gttctgatttacggaaaattaaatatcatttcggggcttttacttatattaatctacgtt
atttacgttgtctatagggtagctaaatttaggagagagggaatggagagagaaaagggt
aatttaatgaagccagttggatttataattgctggaggggttctactagtggtcttttcg
cattactttgtagagtatataaatgagatcgcaatcatgttcaatgttcctgcaatatgg
ctttcactagtaatagcacctatagcgggagaacttgaagaaaagatctcggcatttagg
ttggttctaatgtccaaagatggaggatcgctttcgattttgagtttcgttggaagtaag
atcgagaacgcaactgtattgttagggattataggtatttttacggattacgaattacag
caagccttaccagaatacgcttcttccctaattgctaatatgatagccttatatgtactt
tttgataagaggcttaagacatttgaatctgtaattctgattggtgtttatgtaataata
gtaatattatccttctatctc
>SSO1175 Hypothetical protein
atgtatatgaaggcaaagcatttaatttccttaatagtaatattaactccattagttact
ttactcactagcgccgtctatacgtctggtggtataactttttacagtccagcctataac
ggtgagtcctattacactgggcaatcaataaccattgacgcattactaccgcaacaattt
gcaacagatgcagcaaccataaacttctttttccccaattcatccttagctgtgacaata
cccgttcaaattaatggaagtggtggaatatacgtacctaatgcctatgctttccccaat
gttcccgggacatggcaaattacaatagaagttgcgggcggtgtggcagtaggtaccatt
aacgttaacgttattcaaagaactccattagttacagtacatctgggttacggtgttgtc
ggtcaagcactaccacaaacgccaaccataaccttaactttccctaatggtacaacaatt
acagttcctcttcaaggtacagttaacgttccttccggtacttcatatcaagttgagcaa
gcaataactgaaaataatatcagatgggctaccaattacactagtggtactataacccca
gcgactacatccataacgcctacatattatcaacaatatctagttacctttaattacaca
gtccaaggaggtactggctactctccacctacagtttactatcgaagtcttggaatgaac
gaaacagcaaaagcaccagcatcagtttgggtagatgccaattcagcttatatttactcg
ccagaacttcaatctaacgtccaaggagagagatggatagcggtaaacttcactgggatc
attaaagctcctggcgaaatcaatgaatattatattaaccaatatctagttaccgtacaa
tcccaaatcccagtttacgcaatagtaaacggagctaacgagaccttaaactctacaaac
tggttcacacaaggcactacaatcaaactagaaaatataacgaaatacgtaagcagtgtt
gagagatatgtaatagctaatttctcaccctcagaggttataacagtaaatcagcctact
acgataaaagtaaatactgtaacccaatatttcattaacgttaactctccagttcaatta
aaagccttaataaacggcgcaaatgaaagccttacagcaggttggtataatcaaggaaca
tcaatcaaaatagagaaccttacatactacgtgggaaatggagagagattaatcttaggt
aaagttcttccatccttagagataattgtaaatggctcctataccataagcactacaacc
ataactcaatacttcgtcaacgtctcttctcccataccagtccaagtactaattaacggt
tctaagactatacttaactcctcctggataaacgctggaacatcgatactagtgttaaac
tacacttacaacattagtccacaagagagggttataatagttggtatatcaccctcacag
tcatttacagtgaactcacccgaaaccctaaagctacttacagtcacacaatatctagtc
acaattaatggtgtgtctaaattctataactcgggatcaaagatagtccttaatgcgagt
gtgccattctacgaaactgccacgtttaagggaacgtataatgtctctccgggagctaca
attacagtgaaccaaccaataactgaaacattagtagaatctccaaattacttaatttta
ggagcaatagcagctgttataataatagtagtagctgtggtggtaataatcctcttaagg
cgt
>SSO1176 Holliday-junction resolvase
atgaatagggatataggtaagaacgctgagagggaattagtttccatcttgaggggagag
ggatttaacgcagttaggattcccacttcaaattcgtctccgaatccattaccggacatt
ttcgctaccaaggggaacactttgttgtcaattgagtgtaagagtacttgggaaaataag
gtaaaggttaaggagcaccaagtgaggaagttgttagattttttatcgatgtttactatg
aagggtgtaccattaatagctattaagttcaagcaagttcacgaatggagagttctagtc
ccagaaaaagctgaggatataatagtgacaatcgataattcgatccctatagaagacctt
ttcaaaatactggagaagaggattgaggaaaaaatattaacgcct
>SSO11766 Second ORF in transposon ISC1212
atggggttcaatgacgtttttctcctcatgggttatactacttccaggctcaagaacttc
acagcctttaggaagtataagggtagttggggtaggaagcacggtaagtcctacttcggg
tttaaggtcttgtggaaaggaggactaatttcgttagggacttcaaggttggattgt
>SSO1177 (aspB-3) Aspartate aminotransferase (EC: 2.6.1.1)
atgtacccagaattttgccttgaaagatggcaatccttaagggattggagagctaaatac
gtcctttcagaaagtggagtagaaccattagatctaagtgaaatccaaatacctaacgtt
aagctagagtatggtcacacaaagggactaataaaactaaggcaactagtatcatccttc
tatcccgggaagaaagaggaagacgtaataataacagcaggaggtgcggaagccaactac
gtaacagtcctctccacaatagaaccaggagatgaagtaatagtagaaatgcccaattac
atgcaaatccccggattactaaggggaataaacgccaagataaagtacatttggctaaat
gataactttaagttagacttaaatgagctcaacgaaatggttagtaagaaaaccaaggca
atagtaataacaaacccgaataatccaactggcatggcactttctgaaagtgaaattaag
ggaatcgttgatatagctgaggataatcaagtgaccataatagctgatgaggtttatagg
gggtcggagcatgatggaaatataagaccaagctttattgacttatacgacaatgcaata
agtaccaatagtatgtcaaaggtttatggattaccggggataagaatagggtgggttgtg
gcaaacaaagagttagttgataagatgtggagtattagagattacacgtcaatttcaccc
tcaattttagggcaagaaatagcatataatgtactcttagagaaggagaaatatatggat
agggcgaggagaattgggttaaataatataaggttattggagaggttaataagtgatatt
gacgttaagtgggttgaacctaatgctacagtattagcttatcttaaattgaatgttaag
aacacttacgatttcagtgcaaggttgtttgagaaatatagtgtgttggttaatcctgga
gagtgctttgagatgcccggttatgtcaggattggtttgggaagtacaaatacagagttt
ttaaatgaggcattatcattattcatagggtatttaagggagtatgaa
>SSO1178 Conserved hypothetical protein
atgcaccatcaccggcattattaccctccagaggactttagacggacatttgagagacca
gaggaatatctcccaaatatatttgagggaaagaaaggtgtaattgtggactacgggtgt
ggaaatggattttactgtaaatacttgttggaattcgctaccaaactatattgtattgat
ataaacgttattgccttaaaggaggtcaaagagaagttcgatagtgtaataaccctttcc
gatcctaaggaaattccggacaattcagttgatttcattttatttgccaactcatttcac
gatatggatgacaaacagcacgttataagcgaggttaagagaatactaaaggatgatggt
agggttattattatagactggaggaaagagaatactggaattggcccaccactaagtatt
agaatggatgagaaagactacatgggatggtttagcaacttcgtagtggagaagagattt
aacccaacaccttatcactttggactagtgcttaagagaaagactagt
>SSO1180 Second ORF in transposon ISC1439
gtgggagaaaaggaacaagaaaaagcagagggctttctactctacaactggaagagaaaa
ggaataaagatgagatccttgaacctcgtatatcccttaaggttacccctcctagtggag
gtagcagatttgagaagtgacagtccatcacagttcctactcaggagcgtgatggaagta
agccaatacatggaaatagattacgttgtagctgacgccggattcttgaacctaggggtc
atcaaggaaatgcccgtgaagaccattgtgagaggaaagtcaaacttgaagggattcaag
gaactatctaacgttccattagttgagaagagatatgaggttaaggacagggtttacgtt
gcgtatagggtcttgaaatttgaagggctttattattacgatgtggtttacgttaaggga
aagccgaggcacttcatcttcgtgacgaacttcgagggagatccctatgaactggctgaa
ctctataggttgaggtggcaggttgaggagggtttcaaggttaggaaggcaaggataagg
tatgttaggaagttgagtaataagatcttcttgttcctctattacacggttctggattct
gcgtggaatctagtgaatcatcttctctttaacttcaagtccacgtgtaagaagggtttg
tccttcgatttattcgtcaagcttctc
>SSO1181 First ORF in transposon ISC1904
atgctaagacctaaggaagcatgccaacgtctaggaatatcctatgcaacacttagagaa
tacgttaagaaaggatacataaaaccagttatactacagagcggaaaatggagattcaga
gaagaagacgtagagaggctaatgggaattattagaaaaagaaaagtaatactttacgct
agagtatcatcaaacacacaaaaagacgatctagtaaaccaagttaagtacctagaggaa
caagtcaaagaatacgacctcgtaattactgacataggttccaagttaaacatgaagaga
aaggggttcttgaagttgttgagaatgatactgaacaacgaagtatcacgcgtagttgtt
acttactcagataggctagtcagattcggcttcgaaatcctcgaagaggtctgcaaagca
cacaactgtgaaatagtagtactaaaccaagaggacaaagaggaagaattggtcgaagac
ttagtctcaatactagtctcgctcagcgggaaactgtatggtatgagaagtcatgaatac
gaaaaggtgaagaaatgtgctgaagaacttaagaattggaaaatt
>SSO1182 Second ORF in transposon ISC1904
gtgctgaagaacttaagaattggaaaatttgaaccggaagaggaatacgtgcacttcacg
tactccatcaagaatagtgagagggagaagagcaaagagttaattaaagaatacagaaca
ctactacagaaagcaattgactacctgtggaatttaacgaaaatacaagtaagaaaaaag
aacggtaattacaagataacactaccgaagaagaaggaagtatacaaaccacttagggaa
gagttggagaagatcaaccaccttgcgtcacattacgtcgataaggcaattaatgacgca
ttctcgatcttgaagtcgtggaggaaaagggccataaaggggagagcttcgattgaaaaa
ccaagggtgaagaaggcttacgttaggataaagacgactctgaggaaggttgtgggggaa
agcgttagaataacggtaagaccttatgagtacatcaccttctcgtggagtaagtcatgg
ttctcaagaagggttagggagttggaactcggcgaacctataattaaggaggagaaagtg
tatttgtcatttcgttacaagttaccttgggtaactccattaaactttctggcaattgac
tccaacctttatactctagatgcttatgatggtgagaaattcgttacaatctctctgaag
cagttatattccatgaagtactccatggaggtgaagagggctaaggtgcaatcatttgca
tcaaagtacacgaagagggggagagagttgatgaggaagtattcgcatagggagaggaat
agcgttctggacttcgttcgtaaatttgtaaatgcgttactagacctatatcccataacg
tttttcgctgtggaaaagcttaacaaagagagtatgtttaaggatgctaatgactctctt
tcgaggaagatttctaggactgtttggaggagtatacatagagtgttgaggtataaggct
ccgctttacggttctttcgttaaggaagtgaacccacacctcacctcgaggtcttgcccc
agatgtgggtttgtatctcgaaaggttggtaagacctttgagtgtgagaggtgtgggttc
aagttggataggcaattgaatgcttcactgaatatttatctcaagatgtgcggttttcct
cacatccgtgatattccaagggtgtgggttggggttattccgctaatggggcggagaggg
atgaacgtccgcgacttcggtgaagcccaagggctgaggattgatattgaatatcatgaa
atccca
>SSO1183 Inorganic phosphate transporter
atgaatgtaaagaacgtattcaaaccgttagacgaggcgaaattcggttggtttcacgca
aagtcgttaataacaacgggaatgggagttttcacggatggctatgatctatcatctatc
ggtatagtacttctctctgtgctagcctcatttggtataactaaaaatagcccagactat
gtaataacaacatcactaataaccggtgctgcgttaattggcgctacaattggagcaata
cttttcggtttcttatcaaacatgggtagaaagaaattttatggaatcgatgttacattg
atgacgtttggagcgttactacaagccttcgtacaaaacccccttgaactaataatagtt
agatttcttttaggtttaggaattggtgcagattacgttctctcgccaacgataatggct
gaacacagtaatgctaaagacagaggaaaaaccttagtattaggttttggactattctgg
ggctttggagccagtaccgctgcgggattatatcttatactacaaacaatgggacttcca
acagatcttatctggagaatcgtattagcggctgggagtattccagcagcatccgtaatc
taccttagaagaaagataccagaaactgctaggtatttaggtagaataaaaggcgattta
aatgagcttaaaaacgtaattaaagaggttacaagactagaagtaagtaatgtaaaagac
attaaggacaacgtcaaattaactgaatattttatagctaactggaaattaatattaaca
gccgccattctatggttcctattcgacattgtagcttacgctggaatactatttggacca
agtttaatagctaacagtctaggtatgaactctggaacttttcaactactgatagaggga
gcttttactattccaggtggacttatagctctcacattaatagataaactcggtaggaaa
ccattacaagtaattggggtttgggcttcatgggatttcatgatattcaatatcaatcct
cagcccttgggcttcaccgaagtcgcggacgttcatccctctccgccccat
>SSO1184 (entB-like1) Isochorismatase related protein
atgtcgttcttcaatccagaagagataaagaggctagtaaataagaacaattctgtatta
gtcgtatgggatgtgcaggaagggttagtaaattcgatttttaataaaaacgagtttatt
gctaagctgaaggaactgatagagtctgctagaaagtataatgtgccaatagtttataca
atgattacaccgtatcctgagagatttcagcctagaataaggcgttcattcaatccaggt
gatatttacaaggaagtttatccaaaagaaggtgatgtgatcttaaggaagaatactcca
agcatatttgtaggaacgaactttgagctaatgttaagaaacgctggtatttattcaata
gtcttcacaggtatagctactgatattggagtagaaacttcagctaggcatgcacaggct
ttaggttttataccgattgttgcaaaagaggctgtatcgtcagcggacaaagaagcacac
gaaaggtctctactaaatatgcaaagactaatgcttgtgttaacaaacaaggagattact
gaattgtgggaaaga
>SSO1185 Hypothetical protein
atgaactacactgaagcggaatataaaggattaagctatttaaggagaggtaatattgaa
atcatcataataatactcattgaactaatagcaatactattgacatacatcatgcaatct
ctagggttacccaatccactacaagactttctgatattactgccttcatctgcaatctcc
gcactactagtaatactagcataccttgatattcaacgaggtttatctaatctagcgaag
gcagagataaatattggaataaataacgtaatatcgttcttgttcctagtattatcgatc
ttggcaataattggagttgtttcttatacattatctctagtattaactagcgttaccagt
tcaatactcgcttcattacaaacgttattagaaatatttgcatttataacactaatattg
ttaggattttcatataagttaattggcgatcattacagtaataattatttgtcaatagga
ggattagttctaattttaggagtaatcttatttatctttaaactagaatatggtgggctt
ttggcatttataggtctaattattacatacattgggcttactaatttattaaccattaaa
aaaccagtttctcctccaccgcctcctcttcaaactccttcagctcccagtgaaactact
tcttcaactccctctgctgagaccacatcaactcctccgacagtcaatattatctcacac
ggtgggatactaagaagcaatggagaagcatttattgcagtctcttctgatattgaagat
caaatacttagttctaccattttaaatactgactattcaacgaatgaaataacaccgaaa
actctatcaaaaggttacaattctataaaaataaagtttaacattaaccctcagcagttt
acctctggaaacaattacacaattaggctagtcttagccagtggaaaaaacatcgatgtg
actacctttttccaacct
>SSO1186 Hypothetical protein
atgaagaaaccaaaaatcttgctgagtattattaagagcttgttagaaaataacggtcat
attacatcccgacagcttccaaaatcaaagaaagttcccatgaaccaattatacaaggcc
atattaatccttaacaaattagggctaattcaaattaatggagagctaaataataacaag
ttcgagcttcaccttattcgaaatcccgaattccttaatctagaacaaaaagtcaaagta
accttttatgaagataggagcaaaactaagagctttaaatttcactctatcgtattaaag
aatggccttttatatattgaagatagtagttactggtcagctgatgataaggttaaaact
aaggtaaaagtctataaaccaaaaagggaatttggtaaagtagttgttgagaagattgaa
ttgggaactcaaaaggcctacattaaattagcattagctccaccaacgaaagttggagag
aaaataatccacggatttaaagtaatccagtctaactacttcacattcacgcaaaaggaa
acaatagagagatatggagaccctgaaatgatggacggtctatcagtaatgcaacctacc
ctattcgcaacattagaaattaggttccctgagagttatagatttatagatgtaaaggcg
gaaaaatacgatttagtaataatagatggtcctcaaataccatctccaatcccaaaccat
cgtttactaattgatagaaataagatagttcttaaactattttaccctccttttggctat
tatttcgtttcgtggaaagctgctcaa
>SSO11867 (fucA1) Alpha-fucosidase N-terminal fragment (EC: 3.2.1.51)
atgtcacaaaattcttacaaaatcttgaaatcacttccagtaccatctaatggtcctttc
aaacctacttggagttcattaaaaaagtatatagtcccatcgtggtttaccacctctaaa
ttcggtatttttatccattggggagtatactcagtaccagcatttggtaatgaatggtac
cctagatacatgtacatgccagatagaccagaacaccaatatcacctaaaaaattcggcc
cag
>SSO1187 Transposase ISC1316
atgcccaccttagggtttcgcttccgtgcatacactgacgaacaaacccttagggcgtta
aaagcccagttgaagttaacatgtgaaatctacaacaccttaaggtgggcagacatatac
ttttaccaaagggatgggaaaggacttacgcagactgagttaagacagttggctctagat
ctgagaaaacaagatgatgagtataagcaactctactcgcaagtggttcaacaagtagct
gaccgttattccgaagctaagaagaggttttttgaaggtttagcacgtttcccaaaagaa
aagaaacctcataaatactactcccttgtctatacgcaaagcggttggaaaatacttcac
gttagagaaataagaaaaggcaagaagaataagaagaaactaataacgcttaaactatca
aatcttggtacgttcaaggtaatagttcaccgagactttccccttgacaaagtaaagagg
gtagtagtgaagctaacaagatctgagaggatttacatcactttcgtagttgatcacgaa
ttccccaagttacctaacacgggtaaggtagtggcgatagatgttggtgtagaaaagttg
ttaataacgtcggatggtgagtattttcctaatttgagaccttacgagaaagcgttatgg
aaagtgaagcatatacacagagaactttcaaggaagaagttcctctctaataattggttt
aaggctaaggttaagcttgctagggcttatgagcatttgaagaatctaagaacggatctt
tacatgaagttgggcaagtggtttgctgagcattatgacgttgtggtgatggaaggtatt
cacgctaaacagcttgtgggtaagtccttgaggtctctgaggaggagattgagtgatgtg
ggatttggtgagttgaggggtgtgctgaagtatcagctggaaaaatacggtaagaaactc
atcctagttaatcctgcatacacttccaaaacttgtgctaggtgcgggtatgtgaaaaat
gacttgtctctatctgatcgtgttttcgtttgtcccaactgtggttggattgcagatcgt
gactataatgcttctcttaacatcttacgtggatcggggtcggagcgacccttagtgtgg
agctccgccctctaccagtactctggcaaggtggggctg
>SSO11870 Hypothetical protein
atgcagatacaaagaatgaggggaaatccacatccagacgttattacagcagctatagcc
attaacccaaaaattattaaaaaatctcataaagagcacgtagatgttgaaactaatgag
gggttgactagaggtgtcactataatagattacgtggaccctggacatattattggtaac
aataaacctaacgccgaagtcgtatatgacatcgattatgagaaatttgtccaaatctta
ctaaaaactttaagttcagat
>SSO1188 Phytoene dehydrogenase related protein
atgagatatgatgtaataattattggtgctggccataatggtttagtttcctcaatatat
ttagctcagaaaggccttaaggtattagttatcgaggccagggatagacccggaggaatg
gctgacactgcagaatataagggggttaaatacagtagagcatcttatgtattaggacta
tttcctaaaagaatccaagaggaattagggatagtttttcccacgattgactcagatatt
gcagatgtttttgtcacggaagagggaaaggttgtgaatatatggagaaataaagagaag
agactcgaggaacttaagcgcctaggtcaatacaaataccctaaaatggaggagctactg
ttcaagattaaggagaagattgaacaagagatgcaatacgttatcaaaccaccgtcattt
gaggatttcaagaaagcagtagaaggaactgaacttgaaatatttactcaaccatccaga
aagtttctaaatgaatacttagatgaggaattccagccctatttctcatatggatttatg
tatgatttgccagcgtacgttgtagcatattattttagtctagattggaagatagtgaaa
ggaggaatgggaaaagtaggagaaatgttaatgagtagagctagacaattaggcgtagat
ttcctattcaatacaaagataagtgagatagttatcaaagataatgtggctactggtgtg
agaactgacaatgataaaattgttgagagtaaaatagtgatcaatgcagcaagcccggtt
ctactgaacaaattaaccaacggactgcttaaagttcaccatccagagtttagaccaaga
tggaagagggatactttagtgctaagggaattaccaaatctaccagattatatgagaagc
catttagatacgttatttacgttacctataggcgaagttactattccttctgctgttgat
aatagcctaggaggtcatgtgatgacaataatgggtagttatgaagaggctaaagagttc
ttcccagatttggaaaagaaggtgatatatattgatagactagatgcatataagctcgag
agagaatataatgccccctacggcgatatgaatcatatgccaatgtacacagaatactta
ttcgatggcagaccggttaaaggttggggatacgctactccaattaagaacctctatata
acaggctcagggacttacccaggaggacaagttactggagtaccgggtagaaatgctgca
atgaagattatgactgatttgggtattgaa
>SSO1189 Conserved hypothetical protein
ttgatgataaaagtcattgatgctcatgttcactatcacatatatgctagaaagatccca
gaacattgtaaggaattcctagaaaatgttgaaggaacaaggatgactttaaagaacgat
aatgtagaaattgaaaaaatcctccttgttccctcacatccatgtcatagtgaagattgt
tacgatggattttacattgattacgaggaaaggaagagaaacccagacctttatatgcag
tggggagaggtaaacccactaaaatgcgatgttaaaagagagttagaaagacaatattca
ttaggcatcataggaattaagttacaccctgtacatcacacattcaaacctaatgcctat
agggaagaggaaggaggattaaagcaactactttacatttatgaatttgctgaagatcac
ggtttaccaatcctaattcacactggaaccagtataggagtggggagtagaaacaaatac
gctgatccaatttacgctgatgatattgcaaaggattttcctaagcttaggataatcttg
gcacatgcagggaggccattatggtataatacggcattccacatggcacgttttacacaa
aatattttcttggaaatctcatctataccccctaagaatatattgaaagtcctacctaga
atacatgagatatccgataaagtaatttacggaagtgatttcccagcattcaaggggcaa
gatctagcagagtacgcttaccaagtatacaacgttttaaaaaacgagaagataatgaga
gataatgctaaaagaatattaaaaattagt
>SSO1190 Hypothetical protein
ttgacaatatcacaagttaaggattaccttaacctacagctcaaaaaggctatccaaata
aacggtattggcgttgaggaaattcacgatatgagagtggctgtgagaaagtatttcgat
gtgctatacgctatccatccagtatatgaaaacgtggaatgcctattcttagcaaaagag
gcaattaaaagattaggaaaggtcagagatatggatatttgtgaaatagctaatggagag
agaactaagctggctattagggcgctaaaggatgttagagaacttcaagtttgtttcgta
aatgataagatatacggggtcagacttactatatataatagaattctctcctctttgcat
caaatacaagatattacagacttccacgaattaaggaagaacataagggtgactagaaac
ttagttgaggctctaggttatgacaacactgaaattaaggctctagctaagaaaatggga
gatataagagatgaaatactaaagatgagatgtagaggactaactcctccagatataaat
ataattcaatataaggaagaggctaagagggtaatactaaagataatagcgtctcaggaa
gagtttcatcatttcaaaatcgaagataggtat
>SSO11909 Hypothetical protein
ttgaggagggctttctatcttgcagctttgactgccatcaaggttaatcctgttatcaag
cgtttttatgaggagcacaagggtaggcttaggggtaagaagctgattgttgcgtgtgca
aggaaattagctgttattatttgggctgtgttgtattataggccctttgatgctagcgag
>SSO1191 Thymidylate kinase related protein (EC: 2.7.4.9)
gtgaatatattgataatagcctttgagggaattgaaggttctgggaaaacatctcatcta
gaggctactaaaaagtatttggagaaagaaggatatggagtagttacatttgggttacag
atgtctaaattaataggagatagaatagcacaagtcaagaggaatataatatttgaaagg
agaacattgtttttagcttatgtcacagacttggctgaccaaattgagaattatgttaaa
ccatcaatagattctggatttatagccttagctgatggttacacattaacattaacttct
tggggattaaccagaggtttagagaaggaatggatagatgacgtcctctcaatgcttcct
aaaccttcaatctctttaccactgatatcaacaccagatgaaatagtaagaaggataata
aagaaaaggggttatctggatccattagaaaccggaatagatatatgcatcaaggaggac
acatttgaggcctacatagattatattaataggtttcaagaagctttaatgtcaatttcc
tctagagaaaacataatatacactgacaaggaatttgatgaggtacagaaggagatagtg
agaagaattgacaatatcacaagt
>SSO11914 Conserved hypothetical protein
atggagagggtaaaggttacgagaaattaccagataactattccagcctcggctaggagt
aagattaatataaaagaaggagatatacttgaggtttacttgaacggtgacgagatagta
cttcggaaggttaagactgagaggccgaggataaggctaggcagtaaactctcactggga
gatattgaggaggcaatagagcgtggagaaggcaatagt
>SSO11915 Hypothetical protein
atgaagtcactttcaacggaaagggatactttaatcaaggttgataaagcctttccatgg
aaaatttttagggataaacttgagtcactttactccaagaagcccggtaggacgtcattt
tacccttcaaagtgctct
>SSO11917 Partial ORF in transposon ISC1212
gtgggaaagttccaccagagaatacagtatcctacaagaggttgtagaaaaccgttattg
atgaggagacaatgcgacgttctatataggataactctaatgaatgagctcaacgaggcc
ttagacaaggtgattaacaagtataaggaaaagggttttgaacttaaggtcgggagaggg
aaaaacgacaaattcgaggactaccacataatgaattttttccgcgaggggaagaagact
cttcaaacggatctagaa
>SSO1192 (tmK-2) Thymidylate kinase (EC: 2.7.4.9)
atgagaggcttattaatagcttttgaaggtattgatggttctggaaagtccagtcaagct
gtattactaaaagattggattgaaatgagaagagacgtttacctaactgaatggaactca
tctgaatggatccacgatataataaaggaggcaaaaaagaagaatatgcttacatcaata
acctttagtcttattcacgccactgatttctcagacagatatgaaagatatattttacca
atgctcaagagcggattcgttgtaatatgcgatcgatacgtatatactgcttacgccaga
gatgttgttaggaacgtggactttgattgggtgaagagactatactccttcgcaataaag
cctaactttaccttttacataagggttactccagaaattgctttggagagaattaggaaa
gctaagagaaaaataaaaccacaagaggctggaattgatatactgggtgagataccttta
gaagagggcttcttaaaatatcagagtagaattgtagagatttacgataaaatagctaaa
gaggaaagcaacttcataacaatagacggaaatagaccattaaaggacgttcagattgat
ataagaaaaattttaggtgaatatattgataatagcctt
>SSO11920 Hypothetical protein
atgataccaattttaccattttatggaatacatgatttaaatttgatttcaatatttgca
atcttaggcttagtttttattctcacattgattggtcaagattctgttatatatacagca
aacaaattgccgataagtttagtgacgtcagtcgagttgattgagccagtgattgtaacg
ttgctagcaatactaatttatcatcaaatacctaatttacagaagata
>SSO1193 Exopolyphosphatase (metaphosphatase), putative (EC: 3.6.1.11)
atgatatcggcagttatagattgtggctataattcgtttcgaatggtagtttaccaagtt
tttcgtaacggaacgttcagagcgcttggttcttctaaatcattcgttagaataggagaa
ggattaaaggaaggagatactattccagaggaaaaagtcgaaaaagcagaaaggactttt
actatttttaaaagaatattaaatggcataaacgtagatgaagtcaaaatagttgctact
agcgcatttcgatatgcgtctaacggtaacgaggttaggctaaggctaagcaaaataata
gaaaatgaagttagagtaatttccggagaggaagaagggagttatgccgctttgggtatg
ttaaacacgctcccaattcctgacggaatatttttcgaattaggtgggggatcattggaa
atagccgaagttacctcgggtaatataattagagtgcatcaattgccaattggagcattg
aaattagttagccttccagaaagggaaattagaaaaaaagtatccgatgagctctcaact
ataaatattaagaaagctaatatcatggttggctcaggagggaacgttagggcactagct
aagctcgatctcaagctatcttcttttccgacaaagtcagtacacggttatttactatct
tcgaaacaaattagtaaatatgcctcccttttaccttcactagatgatgagagtaggaaa
tccctccctgggataagtaaggaaagggctttaactatacattcagcttcagtaattgtt
gatgaacttataaaatatctcaatgggagcgacatgattgtctcccttttcggtatgaga
gagggagtattaactgaaggtaagaaattggataagatgaattggttggaagaaatatca
tattctaatgcaattgatcctcctttcggaatttttaaagaggtaatgagcgaggttgat
agtaagtactccttctatgtcgcttcctctgctctcttatcgttaatctttaaaatggta
gggtatttcaacccatttagggcttgctatagatttatcaaggaatcagttttacctggt
tttactctagatgaggtattgttaattggtttgatttgtgaggctgctagtgggaaagtt
aagaaaaaacatgtgaaacttttaaaggacgatattacaaaaaaagagttattaagtttc
ggaaatatagtaaagaatagtatagacaagtacgttgtcggtgtaagagta
>SSO11934 Hypothetical protein
gtggctataatgatttccttaccaattattagaagattattagcacccttagtagtaagt
ttatttgcattaggttggtatggattctcagtacaatacatagtttccaacaataatgtg
gcattagaaaacggcgtattttcagcttacatatccccatcacaattgcaaggatatata
gaggcaaccagatatatttgttatgtagtagtttatttgggactcatattcttctggtat
aatctagttaagacggttagagaattggaggaggcgaataaacaa
>SSO11939 Conserved hypothetical protein
gtggaagatctaactttaagacaaccagatgaggttcttgatgttagaggagaggaatgt
cctgttccagaaatgagcgcgagcaaaaaattgaagaaaatgaaagtaggacaaatgtta
gaagtgttaacagatcacgaacccgcagtacatgttactttaccttctttatgtaaatcc
ttagggtacccatttgtagtgataagagataacggactttacaaggtgagaatcctaaag
gtgaaa
>SSO1195 (sixA) Phosphohistidine phosphatase (EC: 3.1.3.-)
atgataactttaatcttggtgaggcatggggacgctgaaccacaagttgatggtaaagag
gataaggacagaaaactagtaaaaaaaggagtgaaacagatgagaagagtggctaatttc
ttggaggaattaggatttaacgtagatagaatagtttccagtccgtacttgagagcctat
caatctgccgaagttatattagaggaactcttcgatgacaatagtgagaaaaaagttgaa
actttcgatgatttgactccagataaggaaccttctctatttttggaaaaacttaaggat
ttcgttgataactcaacaattctcgtagttggtcatgaaccatatttatccagtttcgta
aagacgataagtggagctaacgttgagattaagaaaggtggggttgcagttttagattat
gatctgaaggaaggaagagggaccctgaaaatcctactcagccagaaagttcttaagctg
att
>SSO1196 Conserved hypothetical protein
ttgatatttgatcttcatccaaaggaaaccattgaggaacttgtaggtagagagaaggag
gttgagcattgtatttcgcagattctttctaaaaactggataataattggcggtcaaaga
gagattggaaaaacttcattaatgaaagttgttataaacgagataaagaaaagggagcaa
atagccggtatttatatcaatttaagaggagtaagaagtttaaattcgcttcttactatt
ttagtttcagaaattaataaggagaaaatctcatggaggtttaaagttaatattaacttt
ctaataacttcagcgggaattgaaataagaggaggtagcaaaagaagggtagtaaatagt
ttaatagaactcctaaactcgtcagatgagatagtaatcgcattcgatgaggtacaagag
ttgtcctttgcgtctaagcagtttttggacatcttgggaaacgtttacgcaactaatccc
aaagttcacatgatattttccggttcttatgtgggtcttgttaaagctttattatcacct
ccgtcagactctccgctacatggaagaccacctactgagattagactg
>SSO1197 First ORF in transposon ISC1217
atgaccaaagaattgacgagggaggagtactataaggcattggaaaaggcagttaacgag
gtcatactatccatgactggaacgaggaaggacgttgccaagaggctcgtcctgggggcg
gttgtgggaagaaatgctaccgagatagctcaggaggccgagatggactacgagaccgtg
ctgaataacttggacaaggcagctcaagccaaactaatcgaggtcgtgaagaagttagtc
ggggatcatcctgtccttctcatagtggacgacacccacgaccacaagctctacgctagg
gccatgccggtctccagaaacggggcgcagatcttctactgtagggcgcacaagaggttc
gaacccgcgatccaactccttgtgattggcgtcaaggatctggtgaacaaccagatctac
gttagtgctttcagaaagtttatagctttaggcaaaggatatatcactagatca
>SSO11972 Conserved hypothetical protein
atgatagataatcctactgatataattataatcttagtggttattgctgtactcttcttt
ggatcatctaaaatgccagagcttttcagagctttaggaagatcaatgggggagttcaag
aagggacaactagaagcagaaatggaaatgcaacaaatgatgtctagcaatgtagttgaa
aagggggagaggagtgaaagtgtagaagaacttgagaagaaaatagtagaattacaaaag
caattagaagcactaaagcaaagcaagaaggcc
>SSO11979 Hypothetical protein
atgagtttcaaatttgaggatataaaaaacatattgcaaaatccttcaattaagggattt
aaagttagtgtgaggaaagcagtaaatttttctgagagcaataccttccaatcaatatcg
aagacaacagtaaaggaggggactaactttgaaggtatgtggattaagtgcattaaagaa
agattagaatgcgatgtagtaacagaaaaaggggatctatatataattaattttaaagat
aaaataataataaaacttgaatatatt
>SSO1198 Partial transposase ISC1190
atggaggccccagtcgccggaatagatgtttcaaaagataaattagtagtgtacttccaa
ggtaaatactatgaatttcaaaataataagcaaggttttgaaggagtaaagcaagtcttg
ccaaagggttgcaaagttgctatagaaagtactggaatttaccacatcaacttggctaag
tacttgggtaaggagtacgacgtgaggattattaatcccctcgtactcaagaagttcaag
gacattaggggtaagaagagtgataagaatgacgctaaaaagctcgctgaactagttata
agtatgggcagtgagtttacaacgagtgaggctaaggagtcaacaagccaatgggatttt
attacaaggagcattgttagggttaagaataggctaaggagggatttaatacttctaggc
tataaggacagtttgtccaagaagaacttgaatgaggtattgaggggggaggataatata
gtattatctgaggttaggttcctcttggacgagttggagaggcttaaggttaggaagagg
gagattgaggaagagcttgaggatcttgttcctaaggatagtttgatcttcactagtatt
tccggaaagttcttagacttcaattttatc
>SSO11986 Hypothetical protein
ttgatgcatgtttataaagtcaagcttgatattaagcacggttcgtgttggacttataag
acgtctgatttcaaagtaaaggccaaggtaatgtatctctttccactgataactaagaat
tcaattttcgaaatagctgagatttactccaatgataaaaacgaactttcagatttcata
tcaacaattaatatgaagatatggcaa
>SSO1200 Transposase ISC1048
atgcaagatttggttcaagcttataaggaagagaagaacgcgagaattaaggagaggatt
cttgcagtgaagctgcacgtagttgatggtaaatcggagaaagaagtttcgaaaatgctt
aacaagggctattccacgataaaattgtggattggcaagtacaagaaagaaggtcttgat
ggactaaaggacaagcccagatcaggaagacccagaaaagtagaagaggaaaagataaaa
caaattctggaagataagccccaaaaatacggaatacaacaagaatattggacaatgaaa
acactcaagatagcactacaagaacaaggaatagaatacaagaaatccagactatacgaa
ctagtccacgaactaggatacaacctagtaaaacccagacctaccaacatccaagcagaa
aaggacaagtgggaagattttaaaaaaataaagaaattggaaagaaaggcactgttcttt
ctagacgagtgtaggacagtaattagcacgtcaattaagaaggttctagctaaggttggc
agtaagcccgtaatgcgcgtcaatataggtttttcctcaatctatgttattctagctata
aacgcttggaccggcgaagtagtggtttctcttgctaaaaggcctaactctgaatccgtt
aagtatttcttgaggtactttaagaggcgtgtgggtagtggtagggtttacatggtcatg
gataattactctcctcacaagactaagggtacgcttgaggtttgtcgcaggaagggtatt
catcccgtgtttactcctccttactcgcctgagcttaatatggctgaggcggtcttcaag
tccctcaagaactacatgagcaataaaatattctatacgatagaagacgttaaaaactgt
attaaacagttctttgaagaaaataagtatagatttaatcttaatgcaataacataccta
ggattagataaaattgaagtc
>SSO12018 Conserved hypothetical protein
atggaaagacgtagagtaaaggtttataaaaaaggaataatagttattcctaaagaaata
agggaaaagcttggaataaaagagggagatataatagaattaattgttaatggagatagg
ataagcatagagaaacctttgacgcttttggatctttttggaatagacggagacgaggct
ttagaaattgctaaggaaataattaaggaaaggaggaaagaagttgagaaagaaatacgt
tct
>SSO1202 Transposase ISC1058
atggaaaagagtaagtacaagagggactggagcaagtacgacgagaacgtcattactaga
tataagttgatgttccccttctacgtattcgaacattggtgggacttattagcagaggag
aacaggaacgctaggacaaagtataaagctccgaaggagttcgacgaattcctagccttc
ctccacatcttcctaccttacagagcaatagaaggagtattaagagccttagaacaattg
aagatcatccccacaagcctcgattactcaacaatatggaagagagtgaggaacatgaaa
ataaccttccccgaggcaagtgacgaacttgaagtaattgcagacgctaccggcattagc
acaaacacgggaggacaatacattgttgccaagtggggtaagactagggattcaaaattc
ctcaagatcgagatagtaatggacaataacgaattcaacgtgataaacgctgaggtcact
agcaacgaggttgaaagcgctgtaaaaacagttaaggatcttcaagataagggaaagaag
gtcaagaagttttatggagataagacatatgacgccaatgaggtttacaagaccggagtt
gaggttgtagttcctcccaagaagaacgcttctactaaaaggggccatcttgctagacgt
aaggctgtgcgggagtttaggaagttgggttatgatcgttggagggaggagaagggttat
ggcgttaggtggagggtcgagtccttgttctctgcggtgaagcgtacttttggggaatcg
gttagggcaacaagttttgctggacaagtagttgaggctaagctcaagttctgggcttac
gcgtggatggttcacttggcgaattctgtagtcggtagggctccgggcattagggtg
>SSO1203 Third ORF in transposon ISC1217
ttgaatgtaaaagctagggtcttcgactcatggtacgtgaactcgaggactctccaatgg
aatactgtgggggaactcaagtccagcgcgcgagtcgtcgagggtggcagatccgtgccc
gttagcgagttcccccaaggggagtacctggtagagtacttgggtactcccataaagtta
cttgttatagatgattataagggttacgggaggaggtatttcttctccaccgaccttaac
gacacggctgaagatatcataacgacctgggagaaccgttgggacatagaggtcttgatc
agggagctcaaggccttgggactcgagggtgggtccttcttgacctgggttaggaactca
ggcttcgtggccttgaaggctctctccctcctcgttgttcaatacttcaagtactccacg
ggtctgatgctcggggccaaaaggttggccagattgataaaaagtatttaccgtgaggcg
ggtgggatcaaaaaactgttcaagaggaggagaaaaccg
>SSO1204 Hypothetical protein
ttgacgctcttcggtaatttctacgctgtgagaaaattagattttgaaattgcattacgt
gagactattggagagggcaagaaaataatgctggaggaatttaatcatttcctttcaaat
aaggaaaataaacagttatactgtaatataatgaacgtgcttaaactagctagtaagtgg
aaagatattaaaaatggtgtcgagatcagaatgggcaaagtagatgataaagttttcagt
aacgcgttacaaaatttagttaactttaacttcgtttcaaaagtcgatgatgagtataag
attgttgatctgatgttaaaggaaatagatttcaataagtgt
>SSO1206 (porB-1) Pyruvate synthase beta chain (Pyruvic-ferredoxin oxidoreductase beta chain) (EC: 1.2.7.1)
gtggctgttttgagtagtcaagtaacaccgaagagaatgcctaaattctacagaggaaat
gctgcttgtccaggctgtccaatacctaaagagttagacgtagccctagaagttttaggg
aataagacagtgctagtagttccagcttcatgtactacgataataatgggagatactaat
gggatgccttcaactgtaccagtagttcacagtgcctttggagcagctgctgcaataggt
tctgggattgttagatccctaagaatgaggggagataatgacgcaatagtggctgtttgg
gctggtgatggttctactggtgatataggatttgccgcagttagtggtgctgctgagaga
aatgaggatatcctttacatatgctatgataacgaagcttatatgaatactggaattcag
cgttcaggcttaactcctaagggggcttggactactacaactcctgaaggtaagagagag
gttaaaaagcctttaccattcatcattgcagaacataaagtaccatatgttgccactgcg
tcaattgcttacatatatgattatgaagctaagatgaggaaagctaaacagattcgagga
tttagatatatacacttattgtccccatgtccacctggttggcgtttcgattctaaatta
actatcgatattgcaaaacttgcagttgagactggagtttggccactctttgaaatagaa
aatggtgaatttaaactaactagtgtgagtaagacgttagttgagaagaagaataggaaa
ccagtagcggagtatttaaaattacaaggaagatttaaacagctcactgaagaacaaata
aagggcatacaagaggagattgacgagatgtgggaggaaattaaaagactaattaagaag
>SSO12063 Third ORF in partial transposon ISC1160
gtggtgtttaggctttacagcaaggtgaacccaatagagacttcctataggaatatcaag
tcgtttctcccgttcataagctcaaccaagttcgcgttccgtaagctgatcttcatgata
gctctctacttccttccacggtggcagaaaatcacgttactgccacagtccactttgtta
gaggcgaagcatgtggtgcctcttcaccacattcaaggatgtgaagagggaagactttta
ctcatccttttattacat
>SSO12067 Second ORF in partial transposon ISC1160
atgatagactttaagggaagaaagggaaaagaacaagtgaaaccctcgtcacagccgtgg
aacgactcaatcgagaacaagtcaaagatgttcgagacctcaagccaaacagtgaggaac
tacgccgagaaagaagaagtagctgagaaattactcgaacgagtgaagcaactatccctt
gaaatgctaaaagcagtgaggaaagtaaacatatcaatagattggaccacgataaggtgg
cagaccggtagagaggttagg
>SSO12068 First ORF in partial transposon ISC1160
ttgagtaatattagattctggaaaaataatagaaattatagctttgttaggaactcaacg
actaaagaaagatttaaggtgaggagatctatattaccaagaagtgaattccaaatgata
atactcgactttccccacctaaattcagcaaatagggta
>SSO1207 (porA-1) Pyruvate synthase alpha chain (Pyruvic-ferredoxin oxidoreductase alpha chain) (EC: 1.2.7.1)
atgcaagttttaaagaggaaagttctagctttagtcggtaatcacgcagttgcttatgct
gttaagcaagctaaacccaaagttttagcagtattcccaataactcctcaaactacaatg
ttggagaaactttctgagtatatttcttcggaggaattaaaggctgagttaataaaggtt
gaaagcgaacattcagcattagcttcaatttatggtgcagcattagctggtgctagagtt
ttcactgctacttcttctcaaggacttctatacatgactgaaatgatatattgggccgga
ggtcaaagagttcctattgttgctgcagttgcaactagagctatagctgagccatggagt
atttgggatgatcatcaagatttcgtaagtaaaagagacgccatatggattcaaataatg
gcagaaaacgtgcaagaagcttacgatatgacaatacaagcttttagaatttcagaagat
gagagggtaatcttaccagtcatgatgggatttgacggcttcatattaactcatacaatg
gaaagaattgaggtattggaggataatgaggtagataattttttaccgcctaggcaattt
aatctaattgacttttccgaccctattgctattggaccaattgctactccagaggaatat
atcaagtatagatacgaggctatgaaagccatggagagagcaaaaggagttattgaagaa
ataatgggtgagtacgaaagaataagtggtaggaagcagcatggtttagttgagtgttat
aaatgtgaagatgctaaatacgttttcgttaccatgggtgcttggagtggtgacggtaaa
gctgcggttgatagattaagggatagtggagttaagactgggttgcttaaaatcagagtg
tttagaccatttccaaaggagaaagttgaggagtatttaaggtcaatgaaaggtgtagtg
gttttcgatagagcttactcatatggttatggtggcatcttagtgaatgagataaaggct
gcactttatgggtatagagtaccagtttatagtgtagtagcgggtattggtgggaaggac
gtcagaccacgtcatttccaaaaggtaattgaagacctaattaacgataatttagaagaa
gagaggtggctgttt
>SSO1208 (porG-1) Pyruvate synthase gamma chain (Pyruvic-ferredoxin oxidoreductase gamma chain) (EC: 1.2.7.1)
ttggaatattataattgtgacaaaatgactcttattgaattagctttaagaggaagaggt
gggcaagggatagttaccgctggagaacttatgacgaaggcgatggttttagaggacaaa
tacgcccaatctattccctttttcggcggagaaaggaggggagcaccagttgtttcattt
gtgagactatcagataagccaatactcttacatagagaggtttacaatccagatggtgta
gcaatatttgatgtatcaatgatccaactaattaacgttacggagggtcttaaggaaaac
gggttcttgctattgaacacaaatacacctaaaagaatttggaagaatgagtatgtagtt
gacgctaccaatattgctaaagaattaggactaatagtagctggatgggctattgttaat
acagcaatgataggggctttagcaagaatcttgggccaaccttccttacactcattggaa
gaggctgtaaaggaggaatttcccggaaaaatcggtgaactgaatgcagaggcagttgaa
ataggatataaggaggtgaaaagggttgat
>SSO12083 Hypothetical protein
atgataggaagaatactaagtggtataggtggtattattgctctaatagctagtttagtg
agtataactacaagagagccactaattaatcatttagtaaaaatattgctcataactgga
gatgcagtagtaggtatgggaataataggactcatcggctctctaactacaatatatggt
gtatataagaacaactggaagtacatggttagcggaggtatactaggtctatttgctccg
ttactacttccagtaagtcta
>SSO1209 (cutA-1) Carbon monoxide dehydrogenase, large chain (EC: 1.2.99.2)
atgatacaagagcatttacctcttataactggcaaaggtagttatatagatgatattaat
ccgaagaatgtagtttaccttcacataattagatctccaatagctaggggtataataaag
agtatatccaaaccggaaagcgcactcttatcgttaacatgggaagatgtgaaattatac
atgccagtgaggctatttccagacctagctaaaactgcacaagttgctaaaatgccagta
ttggctgatggtagggtcaacttcgtaggtcaaccaattttagcatttgtggttgaagat
aggtacaggactgaggacgttgcagaggaagttttaattgattatgacgaattaaagcca
gtagttgatcctgaggaatccttaaatgcggatcccattcatccaggtttaaaaagtaac
atctccatagatcaacttttagaagggggaaacttatcattaaaaaataaggctgaggtt
gttgtaagtaggaaacttaagcaacaaagggtagtttcaaatccaatggaaccaaaaggt
ttcatctgttggtgggataatgatatactaaacgtttacgtttccacacaagcaccgttt
ggagtaaagaatgatctaagggaaattttaggtatttctccagaaaagataagagtttat
tccgcgcctaacgtaggaggaggatttgggaataagagtgggggatacccagaatatgtc
ctagcagcgatagcttccttgaagcttggtaggccagttaaatggatagaaactagaagt
gaaatgctagtcaatactcaatccttaggtagaggggaggtatcagatatgagactttat
gctaccaaggacggtgagattttaggaatagaaggcactataatagcaaatataggtgct
ttcgattacggaataggcttcattgctcctttatttattgcgagactatctaatggtccc
tataagatgaaattcgcatcgataagagcaatgggagtatttactaacactcctccaatg
ggattttataggggtgctggtagaccagaggctgctttaattcatgagactttggttgag
gatttggctgaggagttgggtgtggattctgttgagattaggaggaggaatttgattggt
gataatggttatgttactcctttgggtgttaggattgatcctgctggttataatgaggtg
ttgaatgaggctgagaagtattataggaaggctaaggaggtttataaggacaagggagtt
tcaatagttacgttcgccgagatagtcagaacttcgccaggtgaaggtgctagagttaag
atagaaaacggtaaagtacatttttacttgggaataggtccacatggtcaagcttatggt
agcacattcaagagactggcatctgaagtactaggtataagtgaagataaaatagagata
actactggtagttctgagatagttaaagagggaataggtagtttcggttctagggcaggc
actataggaggttctgccgtgatagctgctgcaactgaattactcaagaagttgaatact
aattctttaaatgagagtgaactagttaagtatgaaggtgttgaggctgaagtgttctat
aaagctgatgatatctttgccccaggagctcacgtagctgtaattgatgtagataaggag
actggatttattagagttttggagtattacgctgttgatgatgttggtagagctatgaat
aaggaagagatagagggacaaataattggaagtgtcctacaaggggcatcacaagttata
attgaagctatgagatatgatgagaggggaatcccattatgttcctcaattgcagattgt
ggagttccaacagctttggaagctcctttaaaggtaaaaactgagtatatagagtatccc
tctcagcttttgtccagaagtagaggtgtaggagaggccggcacgaccggcgctttacca
gctgttttcatagcagtggaaaaggttactaaaaagaagtttgatagaacccccgtagat
ccttggatattagtttcctctaca
>SSO12093 Hypothetical protein
gtgcaagccgagttaaagatcccagaagatatatggcctagaagaagggattggggaggg
gaaatagtctcattatacataaaagaaggaagtgagattaaggtaggagatgttatagct
gaggttgagatcgagaaggcaatattaaagattttatcccagtacaatggtaaggtaatt
aaagttttggtaagagaaggagataaggtatcgccaggatcagttatagccttaatagag
gtt
>SSO1210 Hypothetical protein
gtgttatacaatatcgttttaatgagacaaattgaacaaatcaacaaagtacatacgcgg
tacagaagggaaattagggtcgaaattacgaaaacgaaaaacaaatataaatcctctact
agtatgattattatgcttgaagaatggataaaacaactttctattgcattagataagttt
gtgcacggagaacaattaacggaagatgagagaatagctgtagcctcgatcatttacgct
accataaaatatctcgataactttgataagtgtaatgatgaacttaaggaaattgaagaa
aagtgcaagaaaaagcttgaagaagtgcaaaaagaacttaccgatttacataaacaactt
gaagagaaagaggaggaagtcgatgagaagttaaaaactttagataacttagtaaagata
attgagtctaatccaagattattacctaaaaat
>SSO1212 Transposase ISC1058
atggaaaagagtaagtacaagagggactggagcaagtacgacgagaacgtcattactaga
tataagttgatgttccccttctacgtattcgaacattggtgggacttattagcagaggag
aacaggaacgctaggacaaagtataaagctccgaaggagttcgacgaattcctagccttc
ctccacatcttcctaccttacagagcaatagaaggagtattaagagccttagaacaattg
aagatcatccccacaagcctcgattactcaacaatatggaagagagtgaggaacatgaaa
ataaccttccccgaggcaagtgacgaacttgaagtaattgcagacgctaccggcattagc
acaaacacgggaggacaatacattgttgccaagtggggtaagactagggattcaaaattc
ctcaagatcgagatagtaatggacaataacgaattcaacgtgataaacgctgaggtcact
agcaacgaggttgaaagcgctgtaaaaacagttaaggatcttcaagataagggaaagaag
gtcaagaagttttatggagataagacatatgacgccaatgaggtttacaagaccggagtt
gaggttgtagttcctcccaagaagaacgcttctactaaaaggggccatcttgctagacgt
aaggctgtgcgggagtttaggaagttgggttatgatcgttggagggaggagaagggttat
ggcgttaggtggagggtcgagtccttgttctctgcggtgaagcgtacttttggggaatcg
gttagggcaacaagttttgctggacaagtagttgaggctaagctcaagttctgggcttac
gcgtggatggttcacttggcgaattctgtagtcggtagggctccgggcattagggtg
>SSO12127 Hypothetical protein
atgatttatactctattactgaaattgttgtccaaattcatactattagtcaaaataaac
ttctattctttcaccctttgtaacatgaaaaacttcctcgtgaggaagaaaatattttgt
aatatatctcttccaaattctgaattattacactttctaaggaataatattcaagcactt
aatccaagcttattg
>SSO1213 Hydrogenase formation/expression factor related protein
atgaaggcaattataggtgttggaaataggcttatgaaagatgacggctttggttcatgt
ttagctgaggttataataaacaaggttaagaatgctgtagttgttgacttaggtttaggt
aacttattaagtgttgatttagacaaatacgatactgtaataatcatagatgtggctaac
attaacgaagaatacggaattttcaagataacatcaacaagtaaggggatactcgaacag
tcattacatgagttaggacttaatactattctaaaattgtatgaagataaacagttttat
attatagtatgtaagccagaagaaatccagataggatacggtttatcgaaagactgctta
cttaggatcgaaaagttaattccagaatttaaagcctttttgaagaagctgggaattgat
gctgattttaacgttatggatataattgaggagattaaggagaggtgcgtcaatactctc
aataag
>SSO1214 Carbonic anhydrase
atgatatcggagtacgtggatgaggagataaaaaggagagaggattatagtctaagaaga
ctaaagggtatacctaatgatagaaggctatggatattgacttgcatggacgagcgagtt
cacgtggaggaagctttagggattaggccggaggatgcccacatttacagaaatgctgga
ggtatagtaactgatgatgcgatcagatcagctagtttgaccacgaatttcttcggtact
aaggaaattatagttatcacccataccgactgtggaatgataagatttactggagacgag
gttgccaaatatttcctagacaaaggtgtaaaggttaatgaattacaaatagatcctcta
ttgccatcattaagacttcaaagtacagaggatttcaccaaatggttcaagttctttaga
gacttaggcgcaaatagtccagatgatatagcattaaagaatgctgagatactcaaaaat
cacccattaataccaaaaaatgtaacaattagcgcatacgtatatgaagttgaaactcat
aaattgagaaaacctcatcaaagactttatgaattaacatcaagatttgaacatggaact
gtagttaaggaa
>SSO12142 Hypothetical protein
atggaactcaagagagctgttctatcgttcaaggagacttacgctcaagcaatggcagtt
acggcacccttaggtagtgtagtttctacaactacagctgcaatattatacgctggatct
tcaggttatattcaccacgtttttatccttaataacaagtgccttatggatttatacctt
gtcgatgtatac
>SSO1215 Hypothetical protein
atgccttctgtttccatttggcttagtccaaaaacctataaatatgttgaggagttagct
aattttctcactaaaaaacctaatagattaattaaagagattatagagaataaaatagta
attactgagaatattgagagttattataatgtggttaagggattatataaatggtattat
tatcaaggagagattttagataatgagaaatatataagaagagttttgaaaaggaaaaat
gcagaggccatactaaatataataaatcttcatgatgatattagagtcgtattcaaaaca
ctaggtgttttaatgttaatagtctctttaaaatcttatgcaaaaattcctgaggaaaat
ttctctacattaaagctaataaaatatgatttaatggaagaggttaagcgtataagaatc
tattctttgccattactatactctaaaattttatggttaagatgtgttgaaaaaattaga
gaactttccattttaaagacaaaagattgggagaagcttgcatttaccgctgccatatac
gcagtaacgattttaggagaggagacccctgatagcgtttactctcactataatctaaag
gagtttgaaaaagagtggagtgagttaattaagagttcaattaagataatgactgaggag
gagaacattatacctagatgtactttgtgtaaaaatatagttaatggatctagatgtagc
tgtggaaattcagaaatcttttacgatgatttaaatata
>SSO1216 Second ORF in transposon ISC1904
gtgctgaagaacttaagaattggaaaatttgaaccggaagaggaatacgtgcacttcacg
tactctatcaagaatagtgagagggagaagagcaaagagttaattaaagaatacagaaca
ctactacagaaagcaattgactacttgtggagtttaacgaaaatacaagtaagaaaaaag
aacggtaattacaagataacactaccgaagaagaaggaagtgtacaaaccacttagggaa
gagttggagaagatcaaccacctcgcgtcacactacgttgataaggcaattaatgacgca
ttctcgatcttgaagtcgtggaggaaaagggccataaaggggagagcttcgattgaaaaa
ccaagggtaaagaaggcttacgttaggataaagacgactctgaggaaggttgtgggggaa
agcgttagaataacggtaagacctcatgagtacatcaccttcccgtggagtaagtcatgg
ttctcaagaagggttagggagttggaacttggcgaacctataattaaggaggagaaggtt
tacctaccatttcgttacaagttaccgtgggtaacaccagtgaactttctagctattgac
tccaacctttatactctagatgcttatgatggtgagaaattcgttacaatctccctaaag
cagttgtactcccttaagtactctatggaggtgaagagggctaaggtgcaatcatttgca
tcaaagcacacgaagagggggagagagttgatgaggaagtattcgcatagggagaggaat
cgcgttctggacttcgttcacaagtttgtaaacgcgttgttggacttgtaccccatgacg
tttttcgctgtggaaaagcttgataaagagggtatgtttgtagatgctaatgagtctctt
tcgaggaagatttctaggactgtttggaggagtatacacagagtgttgaagtacaaggct
ccgctttacggctccttcgtgaaggaggttaacccgtacctcacctcgaggtcttgcccc
agatgtgggtttgtatcccgaaaggttggtaagacctttgagtgtgagaggtgcgggttc
aagttagataggcaattgaatgcttcactgaatatttatctcaagatgtgcggttttcct
cacatccgtgaaatagcgcgggtgtgggttggggttatcccgctaatggggcggagaggg
atgaacgtccgtgactttggtgaagcccaagggctgaggattaatattaaatatcatgaa
atccca
>SSO1217 First ORF in transposon ISC1904
atgctaagacctaaggaagcatgccaaagactaggaatatcctatgcaacacttagagaa
tacgttaagaaaggatacataaaaccagttatactacagagtggaaaacaaagattcgga
gaagaggacgtagagaggctaatgggaattattagaaaaagaaaagtaatactttacgct
agagtatcatcttccacacaaaaagacgaactagtaaaccaagtgaagtatctagaggaa
caagtcaaggagtacgacctcgtaattactgacataggttccgggttaaacatgaagaga
aaggggttcttgaagttgttaagaatgatactgaacaacgaagtatcacgcgtagttgtt
gcttacccagacagacttgttagagtcggcttcgaaatcctggaggaagtgtgcaaagca
cacaactgtgaaatagtagtactaaaccaagaggacaaagaggaagaactagttgaagac
ctaatgtcagcactagtctcattcagtgggaaactgtatggtatgagaagtcatgaatac
gaaaaggtgaagaaatgtgctgaagaacttaagaattggaaaatt
>SSO1218 Methylmalonate-semialdehyde dehydrogenase (EC: 1.2.1.27)
atgggtaaggtattgggagaggtaaagaaggattatggaaagctaaagctctacataaat
ggtgagtttatagattctaaaactgatacaataggcaaagcatataatccagctaaagat
gaaattattgctgaagtcccattctcagctaaagatgaagttgaagaggctatacaatca
gcccaagaggcatttgaaaaatggagagaagttccaataacaactagaatacaatacctc
tttgcacttaagaatagattagaggagtattcagaaacaatagctaggataatagttcag
aatcacggaaagaccatccaagaggctagaggagatatgaggagaactatagagaacgtt
gaggctgcaataagtgcagcctacactttatataagggcgaacatctagatcaagtatct
caggaggttgatgagaccgttgttagggaacctttgggagtttttggaattataactcca
tttaatttcccaacaatggttcccttctggttcctcccatatgcgatagttttaggcaat
acggtagtagtcaaaccttctgagataactccagtaccaatggattttattattagaatt
tttgacgagattaagttacctagaggcgttgtaaacgttgttcacggtgcaaaggatgta
gttgatgagtttcttaccaataagttagttcaaggtgtaactttcgtaggttcaacgaga
gtaggaaaatatatttatgaaaatgcagggaaaaacggtaagaaggctattgttcaagca
ggggctaagaactttgtcgttgtaatgccagatgctgatttaaataaggcaataccttct
atcgtctcagcgttctttggcaatgctggacaaagatgtctggccgccgctaatttagta
gctgtagggaatatttatgatgaggttaagaggaagttcatagaggcttcaaaacaacta
aagataggttatggtttagatgaaagtgtagatatgggaccagtagtgacaaaggacgct
aaaaagagaataataggatatatagagaagggaattgaggagggtgcaaaattattattg
gacgggagagatgtaaaggttccagagtatcctaatggatatttcctaggtccaacagta
tttgatgaagttacaccagaaatggtaatagctaaggaggagatatttggaccagtagca
tccataattcacgttaagaatttagatgaagcgattaacatcataaatagaagtaattac
ggtaatgcgtcatcaatatttaccaccagtggttattatgccagaaagtttaggcgtgaa
gtcaataccggaaatataggtattaatataggagtagctgcaccaatggcgttctttcca
tttggaggtaggaaggaatccttctttggcatactgcatgggcaaatagatagcgtagac
ttcttcacagataagaaggtagtaataaccaggtgg
>SSO1219 Conserved hypothetical protein
atgagtgataggttattggagattacgttttccgtagaacatgagaattgttggactaat
ctagttggtaaatacgttgtgaaaactttaaggttttccgtagacactgagaggaacttt
attaggtctctaattgttgtggataaaaaatacaaggagttaataaataagataaaaaga
aataatagtttcatagggtactcattagtttcacttacaacagataataagaaaatactg
tttgatttcagaaagagatacaaaaatagtgtgatggataatataaactccgtagatgga
ataatcttagatggatttaagtatgatggaaaggaatattggcgagttttattatatgaa
agttacgttaatgaactgagagagaagcttaagtcaaaagggaatgtagagtttattagt
tttcatgaattagatataactgaggatgaacttactccatatgaactcaaaactttaatt
ttagcttataaaaatggatattttgattttcctaggaggatcaagtctgataaaatatct
aaattgataaatataagtaaatccacattcacatatcatttaagatcggctgagtcgaga
ataattaaacgatatattgacgacctaaaattctacaatgtaattaacaatgtctctaag
caagaagaggagaaaaaggatagc
>SSO12199 Conserved hypothetical protein
ttggacttggaacttaaggaactacagtcaaaaatgaaggaaatgtatttcgagaaagac
tcgcaaaggggtatttatgctacatttacttggctagtagaagaagtaggagagttagct
gaagcacttctttccaataatttagattctatccaagaggaattggcggatgtcatagct
tggacagtatccatagctaacttagaaggtatagatatagaagaagctttaaagaagaag
tataaattg
>SSO1220 (adh-3) Alcohol dehydrogenase (Zn containing) (EC: 1.1.1.1)
ttgatgaaggcagctagattagtggagtttcaaaaacctcttaaaatagaggatctagat
gttcctaaagtgggaaaaggagatgtacttctgaaagtgataagctgtggaatatgcaga
tcagattggcatctatggcgtggagatcctgctttggtagcatacatgcagtggagtggt
ggtaagttaccaataactcaaggtcacgaggtttatggagaaattgtagaggttggagag
agtgtaactagattaaataagggagataaagtagttatgcctgcttcttctaccggagat
aataggacatgcaaatactgtatggaaggagattcaaatgtttgtgaacacttagtaata
gctggttatggaattaatggatgctttgccgagtacatgctaatcccagagaggtcagta
attgatctagttaaagtaccagatggaataaagtcagagtgggctgctctaagttcttgt
ggttttggaacttcatggaatgcgtttacaatgaagactaatttaaagcccagtgacata
gtggtcataatcggagcaggtggaatgggtttgagtggtatagcaatagctaacgctctt
ggagctaaagtgatagctatagacgttaacgaacgatctttagagaaagctaagatgtta
ggtagcgttgagacttatagacactctggtaagtctgaggaattgaataaaatagtagag
gatattatgaagaagtatggttcagtggacgtaatatatgatactaccggaattccagag
gctgtcattccatttttgcctctccttaaagtacatggaacattgctattagcggggctt
atgatgaaggggaaagagatttttccattgccagcagatttagtagtagcaagggaaatc
agaatacaaggagtattaatgttaccagctcaaaaattcgatacaatatttaaattaatg
aaggaaggaaagattaacctagatccggttatttacaagactataagcatctatgatgtc
aatgatgcctacaaggaaatgagcgagtacaaaaatgcaggaagaattattattaataag
tttagt
>SSO1221 Conserved hypothetical protein
atggaagaaatacgtccttactataatacatttagtttaccaataactaaatctggcaag
tcgcaaatagttccacctccaccatggatatatgcaatagaaatgataggagtaaaagcc
tattttgatcccgttaaagttctagatttagtgcctcctccgttggaaatagtggatggt
gaaggatttgtatacattgctaagattttcacggtaagtggaaatagatgggagatgtta
tacgaagatcctgaagagactaagtatatggaggctgcaatagccctaaaggtcaaatat
aatgataatattttcacctatttcccgttcatgtgggttgataaagacctaccgctactt
cgtgggtggctgctaggctatcctaaaaaactagcttacatatcgatctcagaatttcat
aaacttctagatggttacagcggtccttctagtggggtaaggatgggaggatatgcatta
aggaatggtaaggagataataagagtgaaaataacgctaaaagaaaaagtatcgcaatat
ccaataccctttggtcctatagtacaattcaggagattcccagctgtccaagatggtaca
gatgtttacgagctaggacaaataatctcttcagattttagagtcggcgaggtgtggaga
ggtgaaggggaggtgatattaaatggttcagtgaatgaggagttggaagttttgaagata
aataggattgagggaggatattacttcaattggtcatttaagcagttaggcacaaaaatt
ctaactaaagttccaaataattat
>SSO12210 First ORF in transposon ISC1316
ttgaagttagcgtgcaaaatctacaacaccttaaggtgggcagacatatacttttaccaa
agggatgggaaaggacttacgcagactgagttaagacagttggctctagatctgagaaaa
caagatgatgagtataagcaactctactcgcaagtagttcaacaaatagctgaccgttac
tacgaagctagacagaggtttttt
>SSO1222 Conserved hypothetical protein
gtggtatttttaagtgagataggaaaacttgaaacaagtttaatggagtgcttatttagt
aggttaaaagtaaaagtacctatgacaaaaaataactccgatttcactttacccccaacg
aatagtggtaaatcccaaattgtattccaaccaccatggtattatggtgtaacctacatt
ggggctcatgtaaagttcactaaggaatctgcagaaaaggtaattccgggattcctatca
actgacggtgaaggttgggtttacattgccgaatttatttctacctcagaagacaattgg
gactatatgtatcaagacccagatttagtacagtatatggagggagctattgggttaaag
gtcaattttgaaggaaagaattacttatatttcccattcatgtgggttgataaagattgg
gcattggtaaggggttggttagatggctatccaaagaaaatagctaaaatagccatgact
aaattacatccattacttcccaagtacaataaaccagaaagtggacttagattaggagga
tatgttgtaaggggaggaggtgtaatgtttagaatgcaagttgaattagaggggaggact
gattcactgccccttaagagcttcggaccattcttaaatataaggaggttcccaagtaga
ggtgagggtgaagttgatctttacgaaatagtaagtagagttagggatgagagcaagtac
ggagaaatatggaagggaaaagctaatgtggagctaggcggatacgttaacgatgaagtt
agcttgcttgaagttgagagaacgattggaggttactactataccttatacttcaaagta
actaccactcaactaataagcaagaaaatcgaagaaaccatctctctaaaa
>SSO1223 Catechol 2,3-dioxygenase (metapyrocatechase) (EC: 1.13.11.2)
atggtaaataagttactttcccaattagctagcgtagaaattctaacgcctaaaattgat
gatacattatggtttttcaaggacattttgggattacatgaagttggaaggaaggataga
tcggtatacctaagagggtgggaagattggtacgcatatagtttaaaggttactgaatct
gataccgctggagtcaaggagattgtatggagaacttatagtgaaaaagatctaattgat
tctataaatatagtaaactctaatggattaggattagggtgggatgaaggagagccagat
atgggtgtagggaaagggtataaatttatcttaccaagtggtcaaattggtaaactggta
tgggaaatgaagatatggagagcttcaggtgaacttagatcgggatataaggctagacct
atgaaaaaacctactaaaggagttcaagctaaggatttgtcccatatatttatcttcgcc
tataatgatgaatctcttgctaagaccgtagagttactgaagaggctcacatttaaagta
aatgaaatattaaaagaaggtgacaaaaggattgcatattggatggcagttaatggtaca
gcacatgacttggcggttagcctagatccttccggagttccagccagactaaaccatgtt
acgtttaatgtggattatgcggacgacatacttaaggctgctgatttttacactgattac
ggtttagaaattgtagggggtcctttaaggcacggtataactgatagccactcactttat
gtaaaggagcctggcggtaacgtaattgaattattgcatggtggttaccttaatgttgta
ccggattgggagccaatagtgtgggatactaaggaggatgaaaacagatggttatattat
tggggacatgttaaagaggcattttggcatggtagccctatacctgcaaatagagttagt
gacgaattaaaagagatagtcagacagaaattaggcgcaaaaatc
>SSO1224 Conserved hypothetical protein
atgaacatattaaataagttaggcatatcagatgaattagcggatatgttaataaatgag
gcagtaaggaaggctaaagagttaggagtaaacgtttcaatagcaatagtagatgaagga
ggagaattgaaggcttttaagaggatggacggtgcaccaatcttgaccatacaaatagcc
atagataaatcgtggactgctgtaagttttggtataccgacccatgaatggtacaatata
cttaaagacaacccctcgctggcaatgggatttcctaaaatacctaggttaataatcttt
ggtggaggatttcctataatctataaagagcaagtaataggaggaataggagtatctggt
gcgtctgcagaacaagatatggaaattgccaagagtgcgcttaaaagattggaatca
>SSO1225 (todA) Toluene 1,2-dioxygenase system ferredoxin--NAD(+) reductase component, probable (EC: 1.18.1.3)
atgaaatgtgaatacttaattattggaagtggcattgcgggatataacgcactaaaggaa
ttactccaaataaaaccaaactcgagaataattatgataacctcagacaaatattatcca
tatgatagaccaccactatcaaaggattatcttaaaggaaaattggaaaaagatatgtta
ttcttcgagtctgatgatttttacaagagggataatttagaggtaatgttaaacaagagt
gtcgaaaggattgatgctaatttaaaggaggcaatactaaatgatggtagtgtaatatcc
tttgataaggcattaataagtactggtggtaggcctaggagattaaacattccggggagt
gaaaacgcgttatacttaagaagtttggatgacgcagataggataagggaagctgcgagt
aaaggcaaaaacgcgttaataattggtgctggatttataggtgttgaagtggcctctagc
ttgataacacttggtgtaaagactacagtagtggaagtaatgccatacatatggaataca
ttcgtagacgaaaaagtatcaagagtcatacaacaatacttggaaagtaagggaataaac
ttcattctaaacgagtcagtgaaggagattcaagggaaaatcgcaacaacctcaagcggt
agaaaaattgaggcagacatgttcctaatcgcagtgggaatctcgccaaatgtcgaacta
gcgcagagaagtggaatgcaagtggataatggcatagttgttaacgagtacctagagacg
agtgccagggatatttatgcagctggggacatcgctaacatattcgatccaagggagggt
aagaggaagagaatagagcattggaacaacgcggaatacactggaaaattggcagctagg
aatatggctggaagcagagaggcttacaatttcatatcatccatatggtcagacatattc
gacttacacatagagtcagccggtgaaacaaggaattatgacgaatatataataagggga
aagtttgaattggaaagaccaaggtttagtgtaatatacttaaaaggaggtattataaag
ggttacttagcgataaatagaaacgttaaagaaataatagccctcaataaattaatacaa
aagcaagcagacgtttcaagtaaaagagataagttggcagatgaaagttttgatcttcag
aaacttttaata
>SSO12252 Hypothetical protein
atgtttaaggaactgttaggtgactatgaaccacgaggaagaataattcaaggagtagga
agatttatagctcttggtcttgatgacccatttcatataactaccataactgggtttacc
ttatatggcatagggaaatatatagaaaagaaaagaaccaactatggaatcaggatggct
aaaatggatatagaaaatataaggaaaaatttaagagaaattaccttagacatttctact
attagattt
>SSO12256 Glycosyltransferase, putative
ttgatagttccagtcaaaaatgaggaaagagtgcttcctagattattagatcggctcgta
aatctagaatatgacaagtctaaatatgaaataatagtagtagaagatggttctactgat
agaaccttccaaatttgtaaagagtacgagataaagtataacaaccttataagatgctat
agtcttccgagagctaacgtaccgaatgggaaaagtagagcgttaaattttgccttaagg
attagtaagggagaaattataggtatattcgatggagatacagtaccaagattagatatt
ttggagtacgttgaaccaaaatttgaggatattaccgttggtgcagttcaaggaaaatta
gttccaataaatgtgagggaaagtgtaacaagtagattagctgctattgaggaattaata
tatgaatattcaatagctggaagagctaaagttgggctctttgtaccaattgaaggaact
tgttctttcataaggaaaagtataattatggagttaggcggatggaatgaatattctctc
actgaagatctagatattagcctcaaaatcgttaataaaggctgtaagatcgtttattct
cccacaactattagttggagggaagttccagttagcttgagggttttaattaggcaaaga
ttaagatggtatagagggcatttagaagtgcaattaggcaaacttagaaagatcgattta
agaataatagacggtatactaatagtgcttacgccattctttatggtcttaaatctggtg
aattactctctagtattagtatactcttcttccctatacattgtcgcagcaagcttagtt
tctttagcctctctgctttcattattacttataatcttaatagcaaggagacatatgata
gagtatttctatatgattccttcgttcgtttatatgaactttattgtcgcactaaacttc
actgcaatatttttagagttaataagagcacctagagtgtgggtaaaaactgaaagaagt
gccaaggttacgggggaggtcatggga
>SSO1227 (tmoA) Toluene-4-monooxygenase system protein A. amino end fragment (EC: 1.14.13.-)
atgaaaccagttcctgtagagcctagactaccatcaagagacgagtattatgatttagcg
aacaagttagagtggacgccaaaatatgtaaaagaagaagagctatttccggtagatatg
agtggaataccgaatttaccaatagatgtatggactgagctatatgatgccccctataag
gtgacatatagggagtatgtaaagaatcaaaaggagaaggatcaaagacttttctctgta
agagaggctggagtaagggcagagctagtaaagaaattagataagacttatcatcaaggt
tccttctgtttccacataactgcagttcctataccagaatatactgcggctatagctgaa
gcaagaatggcaaggtttgggaaagctggtgaatggagaaacttatccacatttggttct
atggatgaggtaaggcatgcgcaattgcaaatcctactgtctcatgataatatacaagct
agtcctaagttcgctttcgcgcataagatgttctgggttgacggctggttaccaatagct
gctagatcgttctttgacgatactataactgggactaatgcaatagaatttgctttatta
acgacctttgcatttgagactggatttactaatttacaatttgtagcatatgccgctatg
gcaaataaaactaatgacttcgtgttctcctcagcaactcaaagtatacaaactgatgag
gctaggcatgcgcaaatagggcacccagttctaaaggcttttgttgacgtaacaaaggta
aatgaagagatggaaaagaaaatt
>SSO1228 (tmoA) Toluene-4-monooxygenase system protein A. carboxy end fragment (EC: 1.14.13.-)
atgagtagagaaggaagtttaggccaaactaaaggagaagtcaagcaagtattatcaaac
atttcggagggattaatgaaaaattatagaaatactgttgaatttgctgctaggatgaga
gaaaaaggcccggcatataaagaggcaggagaatatttggtagcgaaaggattctggctc
tccgttaggctaataggagccttaaccggagtttcaatggattacctcactcctctagac
gctagaataatgtcatacaaggagtttatgacagaatgggtaggtgcgcagttaaagaga
ttattagaagattatggaataagattaccttggtattggaaatggtttgagttagagtta
gaccattggcatcatgactttattataggattatatacgtggagaaggactctaaatgtt
tcatttagaggtcctacgcctgatgagagaaaatggttaaacgagaaatatccacattgg
gagatgtttttcggtagagtttgggacttgtatataaagaagattattgatggccaaata
ccgttaccattaactgcagtacatttatgtgcggtttgtcaagtaccgatacaagctcca
gctaatggaaagtacttgaggatctacttaaaagagtataagggaaaaatgtatacgttt
gatagtcccgcttgcttatggatatttgaacaagagccagaaagatatgctgggagaagg
acttacacacaaagagttcttgagggtatgatacagtttactgaagaggcatacaaggat
ccgaagaggctactagatgaggtgatatggaatatgggacaaacagaggaaggggaagct
ggtctagaccctactgacggtgcatatgcattattatatagagagaaagatccagatttc
tttaatagaataaagaagtatacggaggcg
>SSO1229 Hypothetical protein
atgagtatagaagcggtacccatagtgtttgttccagaagaaggtacagtatggttacca
gctgtgcttccaacaaacattgcagtaaaagaagctgttgaaatgttaaagagtttaaca
gtcaatgtgttagtatgggaaaagaaagggaaagagttaaggttagtaaattactttact
ggtcaagtcttagaccctaatgccaaagttagagacgtaataaagccatatgacgttttc
tggttaatctggtggcctcctagagaagagttctggaagccagaaaatcagaatgatgaa
atatttaggattataaaggagaccgaagatgcagtaaagtcagccccaagatctccttca
gtactatttgcagatgagattgagaaatatagtatcgttagaagattggaaagggagggt
aaactaagagcg
>SSO1230 (tmoC) Toluene-4-monooxygenase system protein C.
atgaattaccctggagaatttcataaattactaactctagacgacatttatgaaggagag
gctaagctagtagaggttaatagatatgaaattctagtagtaaatataaagggagagatt
aaggcatattatgctagatgtgcccatgcattaggtttaatagaatcaaactctttcgat
ggtgaggagaaaataatatgcccagtacatctatgggagtataacgcgaggacaggcgaa
agtataaatccagttggtagttctctctttcctttagatgtgaaggttgaaggtagtgat
atttttgttaaagttccatctgttcccatatccgaattcaaggttaaatggtttggtatg
tataggcaaaggggtgtgataaatgagtttggagttaactct
>SSO1231 (tmoD) Toluene-4-monooxygenase system protein D.
atgagtttggagttaactcttgaaacaattttagataaatatcaaataatggatttaagt
aaattaccacaaaatatggtagggccagtgctcatgaaagacgagttcagctatgctgta
gttgaggctttagcgcgcgataatccaaatactttcaaaggagttcttgataggggttct
tacataagagtagtgggtgaaagggaacttatcttaaacaagactacgctagaggaagtg
ataggtatggacgttagatttcctggagaggttgaggtaaggatgagcgcatttgcagga
aagataattgttagaggggattatataaaatggcatttagacttg
>SSO1233 (tmoE) Toluene-4-monooxygenase system protein E. (EC: 1.14.13.-)
atgactagattagaggatttggaatggtataaaaggtataaacaaatgttcggagcattc
aaaagcggtccagaaggggatccgtttttcagagattatgagtataggggatacaagaaa
gtttggtcaacgtggccaatgttggagaaaaagttaggaagaaaaaaaccatcagaatac
caagtagttacttatgcattatcatactgggccgatccaagatcccctacttatatctac
gataaagggccatttgaactagggacagaacacataacccaaaaatggtataaacacttt
agagacaactcaccgttcattaaaccattattcgaaagaggtgaatggcatgattatgaa
gacccatacaaattgacatattggacttataactccatggcggacgataatgaaactttc
ttagataagatttacgaggagattgtaaatactaaatatgattggaacctaaatgaagag
gtactggaattatacaagaacgtttatgacccattaagatacgtattccatattatgcaa
atggagtcaatgtatctagctactatggctcctacaagttctatagctaacgtatttatt
ttcatgggaatggaccatttaaggagagtccaaagaatttcacaaagggtaaagatgctc
gatattgtatatccaagtctaggatttggaaaggaaacaaggaaggtatttgaggagagt
ccaatatttcagccaacaagagaagtattggagaaaatgttagttacgtatgatgtagga
gaagccttagtagcgtttaacttagcagtcaaattcgtattagatgaactgatactccaa
catctaactcaaccattcagtaagttaggagacgagatgataaagcacattcacttatcg
ttctataacgatacgttaagacatagacatcaagctcaagagctgttcaaatacgcattc
agtaaggagccaagtttaaaggatgttattaaaccttgggtgaaagattggcaagagatg
ggatttaaggctacagaagggtttagagatgtgcttaaaggagaatatgataatgctata
aggcagattaggaaggctcatagtgaatatcttggaggaataggacta
>SSO1234 Conserved hypothetical protein
atgaaggagaaggttgtagaaattttgaggcaaatttacgatccagaaattccaataaat
atatatgacttaggactagtaagagagataagaattgaaggcaaaagaatttttgttaga
ttgattttcactgcaaataagggatgtacgctggcagatcttgtagcagttcaagttaag
tataaactaatgaaggtatttccagactataacgtggaggtcaagagtgatttcaatgaa
gaatggaatataggctatgcaacagaaacgggcaggctgatgttagaggaaatatatgga
aaggatgcagtggaggtattagttaataagaccaaaatagaggaattagtatcaacaaat
aaagtcaagttagagaatttcgatccacgtgaatatatgagaaaagcagtggaggagaga
tataaaaaatttagagaatggtatgacaaacacaaaata
>SSO1237 First ORF in transposon ISC1491
ttgaaggaagtattcggaaagaagaccgacaagctagacgcgcaaagactggcaaaagcc
ttcatcctgggagcagttaaggggtcatacataccgaccggggaaataagggaattgagg
gagttaacgaggtatagggagagtttgatgaggaagataacgcaagtaaagaacgagata
aggaagtttctagaaatggcgggatacaagatagagccctttgataagaggggaatggcg
ttgctggagaagttaagtaggggagaagggttgagcaaggaggaaagggacgagttgaag
gagaagttagggagaagtttgaatgatgctgagaagctagctttgaagcagctggtagac
ttactgaagagcttggaggctatggttaaggaagttgaggacatgataatttctaagatt
cctcagcctgtggtcgagttgagccgggagttggtt
>SSO1238 Transposase in transposon ISC1048
atgcaagatttggttcaagcttataaggaagagaagaacgcgagaattaaggagaggatt
cttgcagtgaagctgcacgtagttgatggtaaatcggagaaagaagtttcgaaaatgctt
aacaagggctattccacgataaaattgtggattggcaagtacaagaaagaaggtcttgat
ggactaaaggacaagcccagatcaggaagacccagaaaagtagaagaggaaaagataaaa
caaattctggaagataagccccaaaaatacggaatacaacaagaatattggacaatgaaa
acactcaagatagcactacaagaacaaggaatagaatacaagaaatccagactatacgaa
ctagtccacgaactaggatacaacctagtaaaacccagacctaccaacatccaagcagaa
aaggacaagtgggaagattttaaaaaaataaagaaattggaaagaaaggcactgttcttt
ctagacgagtgtaggacagtaattagcacgtcaattaagaaggttctagctaaggttggc
agtaagcccgtaatgcgcgtcaatataggtttttcctcaatctatgttattctagctata
aacgcttggaccggcgaagtagtggtttctcttgctaaaaggcctaactctgaatccgtt
aagtatttcttgaggtactttaagaggcgtgtgggtagtggtagggtttacatggtcatg
gataattactctcctcacaagactaagggtacgcttgaggtttgtcgcaggaagggtatt
catcccgtgtttactcctccttactcgcctgagcttaatatggctgaggcggtcttcaag
tccctcaagaactacatgagcaataaaatattctatacgatagaagacgttaaaaactgt
attaaacagttctttgaagaaaataagtatagatttaatcttaatgcaataacataccta
ggattagataaaattgaagtc
>SSO1240 First ORF in partial transposon ISC1491
ttgaagtctaagaactttccggaaatactaatggagtcaaccggaccgtacttcttctac
ctacacgaagaactaacagaaaagggatataaggtaacagtaataaatcccttacacttg
aaggaagtattcggaaagaagaccgacaagctagacgcgcaaagactggcaaaagccttc
atcctgggagcagttaaggggtcatacataccgaccggggaaataagggaattgagggag
ttaacgaggtatagggagagtttgatgaggaagataacgcaagtaaagaacgagataagg
aagtttctagaaatggcgggatacaagatagagccctttgataagaggggaatggcgttg
ctggagaagttaagtaggggagaagggttgagcaaggaggaaagggacgagttgaaggag
aagttagggagaagtttgaatgatgctgagaagctagctttgaagcagctggtagactta
ctgaagagcttggaggctatggttaaggaagttgaggacatgataatttctaagattcct
cagcctgtggtcgagttgagccgggagttggtt
>SSO1243 Conserved hypothetical protein
atgaaagataaggaattcttgctcgatgcctcagctttgtattcacttttagattacgtg
gataaggtagatgttaagaaaattcatgtacttaccctaactttttatgaggtaggtaat
gtcatatggaaggagtattatatacataaaaaggttaaagatcctataaccctttcgagg
cttttctataaattaatgcgaaaatttaacgtaatagaggattcgcctcttgagggggta
atgagaattgccatagaaaggggtttaacttactataacgcatcttatgcgtatgttgct
gaatctttagggcttatcctagtgtctaacgataaagagttgataagaaaggctaacgct
atttcgttaaaggatttgataaaaagtatg
>SSO1245 Transposase ISC1359
atgaaacatgagaatacaactaaaccggcgaagttcaaccgggacttcgccaggtccgcc
ctcaagataatttactcgatcctcactaaaatacttttccttgaggaactcctcagtgcc
ttgcttaaggcgagtgggagctacttgagcaggttggggaaagatgggagaagagcgttg
agaaaattgaacgcggttcaagttgaggacgtgagggatgcgttgaggaagatggggagg
atgacgttaaggggagtcagggacaagagggtagcagtggacttccatgccatacctcaa
taccacgctaacaagagtttcttgagtaggataaagccaactaaggggacgtcgtgggga
ctggttcaagctgcgatcttcctcctggggaggacgaggagcttcttggacgtgatccca
gtgaccgtgaagaacgtagctgaaggtttcaaggcggtgatggaggtaatcgtgaaggag
ttggaggaggacaagctgaggctcgtcatggtcttcgcggacagggagttcgcggtgaac
gaagtgattagatacctcttggagttgggcttggacttcgtcatatctgccaaagcccag
atgtacaagaagtacaaggggatgttgcaagatgtggatgtgagttttggcggagttaga
tacactggctttctctgcgtgagacatggaaccggagcttacctcattatcctgaggaag
gaagacggcaagattattgccttcctcgtgaggagggagatcgaccttcacgatgccata
gtccttgccgagatgtacagggagaggtgggggatagagaacgccttccgctcccttgag
gagttcaggatcaggactaggacttgtgacgtgaggaaggaactggttctcgttctgctt
tcctatcttctcttgaatgtctggttcttgatccgttcttggaggaaggtaaagttgtgg
gagttctcggtctccctctcgaatctcctcgatcgggaggtaagagtggaacagggacgt
gtgttccgtgaagtgaagacgtcattcccc
>SSO1250 First ORF in transposon ISC1217
gtgaataaaatcccggcaatacaacagtattaccacgcacttaaagagacaatccagcta
ctagccgaccccatgaccgacgtgagaaaagacacgttagcaaaactggtacttggagga
gtaatgggcgggacggcaaccgagatagcccaggtaataggtatggactacgagacagta
ctaaaaaaccttgacaaattggcaaacgtaaacttgatcaaagcagtaaaggaaatagta
aaagaccacccggtactactaataatagacgacacacacgaccacaaagaatacgcgaga
gcgataccggtatcaagaaacggagcacaagtcttttactgcagagaacacaagagatac
gagccggcaatacaacttttactaataacagtaaaagacttgaggacaaacgaggcctac
gtagtaacaataataccgtatataccacaaaaggttgttgaggtgttaagggagagggga
gaggaagttgagttcaagaccaaaatacaagaatacttggaaattttgccagtgctcgag
aaggagtttagtgttgtatgcaaggtttttgattcttggtacgtcagtatgggaatctca
tttttc
>SSO1251 Conserved hypothetical protein
atgtctataatcgaggtccttgaggagaataagagattgagagataattacataaaaaat
ttaaatttctacctagatagaattaaagaagttgttaagaatattgatccaagtactaag
attattttatttggtagctacataaggggaaatttcagacctgatagtgatattgacgtt
ttaataataactaatgtaagcaatgaattcgataggttgaaaatataccatgaggttaat
aaagctataggcaatccaaatccctttgaaattcacgtgattaatgaagaagaatatgta
tcttggtattctaaatttcttgacgtatataaagaagtc
>SSO1252 Conserved hypothetical protein
ttgcttatgagctttcttctcaacaacgctaaaaatttcttgcacgatgcaaggagagat
tttgaggaaggaatttggaatttatcggtatttcattcagaacaagcactgcaactttgc
gttaaatataaattatatattcatttaggtgattatcctaaaactcatgatttaaaggta
ctaatcaatagtctagggagatttgagaaggtagaaattgatgagctaatgctggatttt
ttagtacaatcttatatctcttctcgctacttaccttatactttctcaaaggagagtgct
gaaaaagctttaaactttgtagagaatatgatgaggggtctaggatgtcta
>SSO1253 Conserved hypothetical protein
atgaagaataaaaacttatttcccatgttatcggtgagcgaagtaaatgaattgcttaaa
caagaagaaattttcaattttatagggattgaatttgaaaaacttgaaaagggctactct
aggctaaagttcaattttaatgagaaattaactagaataggtggaattttacatggtgga
gtagtattttcagcagtagattatgcagggagttacgcagtgagaactttagataaagta
aaagatggggttactgcagaactaaaaataaactttttaaaaccaatgaaggagggacct
tttacagtcgagccaagggttataagtgagggaaaaagattggttgtagttgatatatca
gcatatgacggtaacagtaatctatgtgcaaaggctttgggaacgtgggtagtctatagg
gaaactaactctgaaactcaattatcctct
>SSO1254 (citE) Citryl-CoA lyase beta subunit homolog (EC: 4.1.3.34)
atgataaggagatctcagttatacgtccctgcaacttccgaaaagatgataaggaaatcg
gttgaactaaaggctgattcaataattttcgatcttgaagatgcagtacctcctgaggat
aaagagagagcaagggaatcgctaattaaactcgtgaaggaactggattgggggaagagg
gagttatgcgtaagagtgaattccctacaattgcttgactcatataaggacatttctaca
atcgcaagggaggataaaatcacgtgtattgtcttaccaaaggctgagaacgacctttca
tttctctacaaggcaactgggaaatccttaataccattgatagaaactgcaaagggttta
gttaagattgaggatatagttaggtcggaaggcgttgttgccgtaagttatggagcagcc
gatctttcattgtcccttggcggggactacaatttttatgagaagaacgtgtacgtaaag
actttaattgtcagcgtcgctaggacttatgacgttgacgctatagataaggtttatttc
gatttgaaaaacctagatggttttaggaaggaatgcgaagaagcaaagaagctgggttat
gtgggtaagcaagttattcatccctctcagattgatatttcaaatgaggtgttctcaccg
agtaaggaggaaattgagtgggctaaaaaggttatagaggcttatgaaaaggggaagagg
gagggtagaggagctataaggttagacgataagttagttgattacgtgcattataagata
gctaagaggataattgagtttcagagt
>SSO1255 Transcriptional regulator
atgtcactatcacaaatagcttacgagaaaattctggaatacataattaccggcaaatac
aaacccggcaatactttgaaagaagaggagcttgcgtcattacttaagattagtagaacc
ccaattagggaagccttagctaggttagaaaaggagggagtaatagtaaagaacggtaaa
tcgttcactgtaataccgttaacagaaagtgatattcttcaactctacgaggttagaata
aacttagaatccctatcagctaaactagccgcaataagagctagccaagatgagattaac
aagatcataaatgttttaaacgagataagagggtcagcaaatgctgatccattaacctta
gctaatttaaacggtaacttacatagggcaatagctgaggcatcacataataaatacatt
gtggatattttggatagtattagattgaagctaaaaattgttaggataaccttgtttacc
agctttcagagaagagatgaggagtttagggaacatgaaagtatagtaatagccataaag
aatcgcagtccagatttggcttatgacatgatgcgaatgcatgaggagaaagttttagat
tatgtaaagcaaaatatactgccagtaatgtttaga
>SSO1256 Microtubule binding protein, putative
atgcttaaggacgatatcctaaaattactaaaggaggatgcggagtttagaaaacaagta
gaggaaatattaggtatttcatttataaatgtgactctagccgacttaaaggatatattg
aaagggttattagcatcaatggataaactaaagagttctgtagatcagctggttgatgct
caaagaagggcggaagaaagaatagcgaagcttgaaaatgcagtggagcaactggttgag
gcgcaaaagaggactgatgagagaataactaaattggaggagtctacgaagaagttggag
caagctgtacaagagcttattgaggctcagaaaaaacatgatgagagaataactaaattg
gaggagtctacgaagaagttggagcaagctgtacaagagcttattgaggctcagaaaaaa
catgatgagagaataactaaattggaggagtctacgaagaagttggagcaagctgtacaa
gagcttattgaggctcagaaaaaacatgatgagagaataactaaattggaggagtctacg
aagaagttggagcaagctgtacaagagcttattgaggctcagaaaaaacatgatgagaga
ataactaaattggaggagtctacgaagaagttggagcaagctgtacaagagcttattgag
gctcagaaaaaacatgatgagagaataactaaattggaggagtctacgaagaagttggag
caagctgtacaagagcttattgaggctcagaaaaaacatgatgagagaataactaaattg
gaggagtctatacagaaattggttgatgctcaaagaagggcggaagaaagaatagcgaag
cttgaaaatgcagtggagcaactggttgaggcgcaaaagaggactgatgagagaataact
aaattggaggaggttactatgaaattagttgaatctcaattaggtatgcaaaatgagatt
agagagttaaggaaagctttaggaagtatgggtaaaaggtggggaagggattttgaaaag
ctaataattgaaatagtcgacgagttagctaagcaagaaggactagatttaaagtacgtt
aataagttcacttacaaggatgataatggattatttggtcttaaaggtgttgaatatgat
gttgatctcttgataaaggacactaaagtgtatttgatagagattaagtcctatgtagag
aaagatgatgtgaactgggctgcacataaattcaatgtgatagaaaaggctttaggtcta
aagaatactatcaaaatgatatttgcagttgatgctacaaatttagcaacaaagaagggt
gaagagttgggaattaaagtcgtatacggaagtcaatccgaggaggaagagaaaggagaa
gtaaaggtaggt
>SSO1258 Mandelate racemase /muconate lactonizing enzyme related protein (MR/MLE)
atgaaagttaagcctttttctttatccatcccctttaatactgaacctccctctgattgg
aaggatgcgtgggatgtgcagctctacgttaaagtggaagatgaaaaagattacggttgg
ggggaggcattagtagcgggaagtggaattataaactcttacctctcgattataaatgac
attgcaataccacttttatctagagtagaattaagcgaacccatagacgttaggactatt
ttagagaaaattctttttagtgctggaaattgcggagtggtttctggggccataagtgca
gtggaaatggcattatggagtttaaaagctagaaaaagtaatgtagaattgtataaatta
attggagataaaatcagagattcagtgaaagtatacgctagctttcccaggtttggtaaa
attgatgatgttttgattgctacgagaaaatctttagaaagaggttttgatctggttaaa
cttcatcaatctccttcaactgttttagctgcggtaaaagctataagagagaattacaag
gaagttaaaatagcgattgaccttaattctccttttgataatctagatgtggctaaggag
ttcgtagataaggttcataaatatgaaattgaatggattgaggaaccgttatggcctcct
aatgattatgatctactctctaagcttactgagttttctcctataccaatagctgctggg
gagaacgagtattctttatacggttttaagaaattaattgaaagcggcataacatatcta
caaccagatattgctaaggttggaggggttacaaaatttctcgaaatattagatctggca
tctaagtataaggtgagagtcttgcctcacgatagaccagacgcttcccccatatcttta
atatacacgttaaatatcggactagtaaagagtcaaatagagatggtagagtatacaatt
gcggattttcctaatgatctattttattccttgcctaaattcaaagatggttacatatct
cctccagaaaaccttgaagttgtagagagaaatatagaaaaatacagttataaaaatagg
ctcagaatattacatttcagtgatttagagaataagctaatgaggaaaataaca
>SSO1259 (garD) Galactarate dehydratase, putative (EC: 4.2.1.42)
atggaaaaaccaataataaggggttacattagggaaaacggtagtgtaggagttaggaat
tacgtagctgtaataccagtagatgatttatcaaattccgcttcaataggggtatcgaaa
ttaattaggggtacggtagctattccccatccctacggtagattacagtttggtaaggat
ttagacttactctttcacgtattatctggtactggtgcaaatccaaacgtagctgctgca
atagttataggaattgaggaaaactgggcaaataaggtagctgataagatagctgagact
ggtaagccagttgaggtcttcccagttgagggaaatggtgatttgaaagtaatagagaaa
gctagcagaaaggcaaaggagttcgtccaagaggctagtgagaagcagaggactgaagtg
gacctatcatctttagttttaagcattaagtgtggcgagagcgatacaacatctggttta
gcgtcaaacccagcaaccggttatgctgtggataaattgatagattacggttcaacagtg
atgtttggagagacctcagagttaactggtgctgaagacattgtagccagtaggatacaa
gatccggttttgagggataagttcatgaggatttataacgaatacgttgctttcattgag
agtcaaggagtcgacctattaggctcacaaccaactgagggaaacattaagggaggatta
tcgactatagaggaaaaggctctagggaatattcaaaaattaggcactaaaccaattact
tgtgtgttagactatttggatccattagggaagggatcatctagactgtgtttcgttaat
acttcgtctgctgctgctgaggcagttacgctgtttgccgctaagggttcagtacttcac
ttgtttacaactgggcaagggaatgtagttggtcatccgataattcctgtagtaaaaatt
tccgcaaatccaaagactattgcaacaatgagtgagcatattgacgttgacgtttctgat
ttacttcaattgaaggttagcttaaaagaagcaggggaaagaatattcaactatacgatt
agggttgccaacggtaggttaacttcagcggagatattacaacatgaggagttctctcca
ataaagctttacataagtgct
>SSO1260 Conserved hypothetical protein
atgccatattttcttatccacaacaaaaatgataatgtaggagttgccatagctgacatt
aaaactggacaagaggttgagggaatttatatcgaggacatgacacagggacctaaaatt
aaggcgattagcgatatacccttaggtcataaaatagcattaaaggatattagacaaagc
gatattgtaataaagtatggtagaccaatagggtctgctataaaggatattaaagtagga
gaacatgtgcacgtacacaatataagatctaacaggtggggtaaatggaaaaaccaa
>SSO1261 Conserved hypothetical protein
atggagaaaggattcattatactcatgattatttccatagctgcccatagcgaagaatct
aaccatgagttagctgaaaaggcaaggaaattcgtaaggtcgattaaaccatgcaatcca
atacttttactgggtggatattggggactaatgagagttgtagttgatgaggccttaaga
gagaatataaaaacagttttaatattgccaatagagaaagaaaacatagaaattcctagg
gaagtaatttgcattaagtccggttgtgaatttaggtgcagatccgtaatcctagttaga
tccggtgatttattagtatccttgggaggtggtgtggggactgaaatagagataatgatg
gcttatgcaatggggaaaccaatatacgcgttgactaatactggtcttagtaccgactat
ttcgctaaatcgttcccagactacattgatgataggaagattgtaaaggtaaagtacttt
gataacgtggaaaggatggcagaagagatttgcgaagatgagataaagggtaaagaggtt
aacttcggg
>SSO1262 Hypothetical protein
atgagatttggtttactcaccactataggtttctccttgttagttttatctgtgttatct
attaattcgccaattcaatcattaataagtatttcaaacccctattccattgcagttcct
aagatcgcttatgttacggctagactttttgagaatgatagtaacgttacgatctacgtt
cagattattcataacgggtatacgaaaattgtgaaattaccttcatattttaaattaacc
cctggtaaatgggagttttcaatatataacgaaacgtttcccataactttaacaaaagtg
gtaaacgctactgttgttaataaatcaaacgatatagtatacgtttacgaatatcaaaaa
atagagaaatatcaagagatagtaacgacaaaaaacactacttaccctattgacctcgaa
ataacaatccataaggttgatatacttcagtataaggaaatagcggaagttctaggtgta
atcttaatagttattgatattatcactctgatagttattaggtttaagagatac
>SSO1263 Second ORF in transposon ISC1078
gtgggtgaaggaacaaggggagaagcttttaaaaaaataagagaagggtacaaggtacac
atcttcgatgagtcgtacgtgtcctacataaacaagggtaaaggctggatgaaggtcgga
ggagggataaaggtcaaccctaagaggaagaggtttgcagtagtaggcgggataacgatt
agtaaagagggaataactttctcctattcgacatacaagaagccctcgctgaactcaaaa
gatattatactctacttgaggaaggtaataaaggacgagaagaccgtgatagtgatggat
aatgctagaatacacggtaatgaagtgagggaattccttgaggaaaatggggtggagttt
gtttatctgccgccttactctccggataagagtccggcggaggggccgtgggcagtcctc
aagaaaaggctctactcgaagatttacacggacttcgagaccttaatgtgggatgcaacg
aggttcctacgctccatatccaagagagtaaatgaccttacgtatagtgtgaagaggtgc
ggtgaaccttggacgtcaatactgagtgaagttttcttgccctttaaagtc
>SSO1264 First ORF in transposon ISC1078
atgccgaaatccagaatgcacggtataaggctcaacaagaaacaagaggaagagaggagg
attaacgctgtaaaagatgtgaggaacgggatgagtataaaggacgttgccaagaagtat
gacgtctccatctttaccgtgtacaagtggttgaggaaaggtgacctgagcgctaagccg
aggaagggacccacgaaactgaaggacgaggaaaagctcgtccgaatcttagaaaagagc
ccaagagatttcggcttgaactacgatttctggaccttgaagctcatagcgtatatactt
gacaaggaatttgggataaagtacaacccgaggagtttaagcccagtcctcaagaaatta
ggcttcaagtacaagaaaggaaagagaacttacgttagagacgataacgctgtagaaagg
tgggtgaaggaacaaggggagaagcttttaaaaaaa
>SSO1265 Hypothetical protein
atgatgccttcaagaagttttcaaatatttagactcatatttaaggagagatataggcaa
cctacgcttgagttagtaatcccaacaatgttagtttcaaacgttttcattagtgcgttt
tacgctaggggagtgttcaattattatggtttagtcttagccttcgtgcctttaataagc
gtttcggaaaccttgacctttgccttagccttgaggaacatcattttcgttactggtgat
cacatctataggggttccataatatcctttatgatgatggctataaagagaataagccta
ttcttcttcacttacttttgcgatgtgatattgccttatttattttggctatttacaact
gaactttacatatttctctcaaatattccagttccccaatatctagtcctaatctacact
gttggatatttcttcactgaaaacattgtattatacttcgtcagactt
>SSO1266 ABC transporter, ATP binding protein
atgactattgaagttgaggatttaaggaaaaagtttgctggtaaagaagtacttaagggc
gttagttttaaactcagaagtggatcaataactggttttattggaccaaatggtgctgga
aaaacgactacaataaaaatactttctgggttgttaagaaaggacggagggtttgttaaa
gtatttggtgaagatccttgggataacccaaaggtcatggagagaatttcagttattttc
actaacttaattcatcctcaagagaacacagtaggggaatatttgatggatctgggaaat
gtttatgggaaaaagagggagataattaactatctaattgaggaatttaagttaactcct
caccttaataagaggctttatcaactatcctctggtttagcccaaagagttcaattagta
gctgcattaataaaggatgttgagttgataatagcagacgaacccactgccaatctagat
ccctcctttagaatagagttttatgaggtagtgaaggagttgaataggaaaaatggtgta
acgtttttcatttcatctcatatactctcagagctcgaaaaagttataactgatgtaata
tttattaatgacggaagaattacatactcaggcaggatgaacaaggctttaagcgatacc
gaagaggaagaaatttacgtaatggtagacgatactgatagagctttgaaattattggga
ggaatacttgaaggaccttatataaaggttaaaggtaagttaagggagatagtagataag
ttagatgataatggaatcgagataataagtattaggaggttctcactagatgatgccttc
aagaagttttcaaatatt
>SSO1268 (glmS-2) Glutamine-fructose-6-phosphate transaminase (isomerizing) (EC: 2.6.1.16)
atgggaggaattttcgctttcgtatgcaaggattccattgatgtttcaattattaacaag
ggtttaaagaagttgatttataggggatatgatagcgctggtattgcttaccttgaagac
gatagcttagtaataaagaaaattttaggtaatatctcaaagaatgagataagcgttagt
gacaaggcaagagttgcaataggtcacactagatatgcgagtaggggttggccaactttg
gaaaacgctcacccactgactgattgtaatgggaagatagcagttgtaatggacggtatt
cttgacgattacgaaaaaattagggaagatctgattgcgaagggacataaattcgtctct
acaactgacgctgaggtgattccccacttacttgagaattcaacaaactatctaaactca
tcattaaacgttatgaaaagggtaaagggcatttactctctggtttttgtaaccatagac
attgataaaatattcgcaattaactctggccaacccttgatgataggtatcacacaagag
tgtaaatacgtttctagcgatttaccctctttgagcggttttgctgagaatgcgataata
atgccagaaaatactgtggcagtaatctcttggaatgatgtgcaagtgtataatattgaa
ggtaatgaggtaaaaccggaaattaagagagttaaatataaggaggagatcgctgaaaag
ggtggatttccacacttcatgttaaaggagatatacgatatcccacaagcgttaataaac
tcatttaactctctaatggaaaagtacctttccttagcctcaatgatagtatatggtgcc
aagaacgtctatataataggtaatgggactagtcttcacgctggatttatctcatcatat
tacttttctgaaattagcctaaatgttaatgttgtaagtgcagcggagtttccctattac
gccttgaaaaacgtgactactggttcggtaattattgctataagtcaaagtggggagaca
agtgatgttataaggagtattaaaatggctaagcaaagaggggctgtaatattaggtata
accaactctgtaggttcaagattagccttagaatctaacgtgtacttaccaataactgct
gggccagagatggctgtaccagcgacaaaaactttcacttcaactattgtagtattaaaa
gtgctttcgctatacactggacttcactctggtaaaaacgataggagtgagatcagttcg
ttaaaaagtgagattgaagaattggctaaacagttaatggtaaggttaccggagatggag
aaagaggcagagaaattggctcctaaattagacaaggaaagcttatacatttcgagtagt
ggtataaattaccccatagccttagaaggagctttgaagtttaaggaagcttcgatgact
cacgcagaggggattcagctgggagaactcctccacggtcccattgttctaacaaataaa
ggttaccccgtaattttaataaaacctgtggaggctgaggatttatataacaaggttatt
agatctataaaggaaagaggagatgtaattgtgaccgttgctgaagatggtgatatgaaa
agtataaaggctactagggatttaactcccataagcaatgtaataccgttacacttattg
gcctataaactgggagttaggaaagggttgccgatagatactcctccagggttagtgaaa
gctgtgatagtt
>SSO1269 Hypothetical protein
atggatttagagaagtttaggagagagtattattacgttgtccccataatcgccaatagg
attaagaaagatgaggagaaagttaaaaagtacattgagcttgctataatcttacagagc
gcaataggaaatgaagtatatactgcatattatctttactacatatacgaggaactgggt
gatattgatctaggaattccgatcgttttggcaattgttaaccatagagatgtatggaag
gctagagctctcagaagtgttacagcgtataatacgttaaaggtatttgaggttaaagat
gatgtaaagagaataattgaaaataagttaagggaaattaacattccaataaaaatcgtt
atgaaaatattaaataatattgaaccaatacagattagaaaactattcagcaatttgtct
atagttcacccagaagtgtatagtctgattttaggtgtatttacctcgattaagcaggga
aatgagggt
>SSO1270 Hypothetical protein
gtgttaagaatgataggaaaagtccttgagcttttaaactgtaaggagactgagagggaa
attaacagaagaaaattttcaatatgcgatgatgttaacttcatcttgaatttacccatc
ggttatttaaaagatgtaatttcaccacttgaaaactatttatcaaaacatatgactaat
aacttttcaagattaactcgcgtagttcctaacgattatgaggatacacaactacatttc
agtaaattctttttaaacctttacagtagcgcaatttctgaaatcccaagatttaacatc
cttacctcactagtcatcttagatgagtatcgaatgatgccagataaggctttaattgct
gcagctgacgaattggcgaggaatggcattaacgcaattttctctacttcaacaccttcg
gtattctttgaggaggagatagtaagtagatttagaaatagaagagtggtatctatttca
atagttaatgaatatgggcaagcggttgagggtagggattgcgtgaagaaaggtgaggga
tattatcagtgtaggggtagttacgaagtgattgaattaattgaggattttgacattagg
gatttagattatgagatcattaaaggtgaagaggtatttaaggtaaaggaaccatttacg
cttttcgtaaattcttgggaaaaggcgttgagattatacagaaagttaagggaggaaaga
aatactgaggtatgtttacttaatagtagtgatgaatgcaaagtgactattacacctaaa
attatgcctactaggtttaacgtggtgagcgaaatttcatcattaccaactattgtagct
agaagtggaattattaacgataaggataagatctacgtctggattgatagggataattac
gatacagtgactgaaagtactcttaatctactttcaaatatcaaagtatgcttaaaacat
ccctttggctgtaatggaaagatgggatatgctaacaagacggtcttaaagcctaacatt
gatgaaaggcttataaaaaggctaagtgaaataagccacttaatggatagaagggagttc
gagaaggtgacagaagtcttcagtgatttcgtaacagtcgatctatttactgataaagag
aaaataactacagtacctcccgagtttgtatacgagaacaaaaagaagatattatactac
ggaaatagctgcgtttacacgtactttactgatggagaaaaatgctctaagatagtttat
aattggttagaaggcggaggtgtttcatggcttaagaggaatttagcaagggcttataag
aattatgttgaggaagaaggaaaaaagaaggtgtttttagggttaaaggccagagatgtg
gaagaatggatt
>SSO1271 (alaS-like2) Alanyl-tRNA synthetase truncated homolog
atggatcaagttgagattcgcactcacaccgccttacatgtggtcaaaggagctgtgagg
aaagttttgggtgccaaatggactgcaagcacttacgttaatagcaatcatgggagatta
acggtaaagtttgagaggaaacctagcgatcaggaaatggataaggtctttgaattggct
aacgagaaggttagaaaaaaccttccaataataattgaggttttacctagggaagaagct
gaaaggaaatatggagatgagatctacgatctctttcttatttcagctgaggttagggag
ttaagcattgtggtaataccagattggagtattaatgcttgcaataagcaacatactaag
tttacctctgagattggagagatcatcaaggactattggagatataggaatagtaaacag
ttactcgagatttcatttgacataaagtgt
>SSO1272 Conserved hypothetical protein
atgactaagagaagaatcggtttctcaatcttcccaggttggaaggagataaaagatgag
caaattagtttattgaaaaatgctagagatctgggattttccgaaatattcatgggaatt
ggtcccggaacccattggaggactccggtaaatgaggcgcttagtgttgccaaggagatc
ttaaaagaggctaacaaattggactattatgcctttgtggatataaacccgcaaattctt
aaagagttgaacgcatctcctaggaatttatcaatgtttatggaaattggctttaaggga
gttagggctgactacggatttagtaaagaggaaatcgttgaaatgagtaagcaaatgact
gttgagctaaacccatttgagataagcgaggaagaggtagactttattgccagaaatgca
aatcttgaaaggattaaggcttgccacaactattacccagtcttgtatagtgggatatct
aaagagatctttatagagaaaaataggatatttaaggaaagaggtatagagatcggtgcg
tttatctctaatccaaagtttaatctcagaaccacattagaggttttaaggtatgtagaa
ccattcgattctgccaattacttgttcaaattcgtcgacagagttttaataggagacccc
attccagattatgaaagtttaaggcaagtatcggaagttttcaagtctgatattacgaag
ataagaattaaagtatatgatgaaagcgtgggcaaaagattagataaaaagtttgcagtg
gaaaattatagggagttcgccatagtatgttatactagggataatatatatgaaggtgaa
acgtgttatactaaattatttaaaaatgcggtggcagtgaggggcagagaagtatggata
ttcactagggatttgggaattggtccctacaggttagtaggggaaatagatgatattaat
atggaaattgtcaaaatgtcgagtgagataatgttaattagtaaa
>SSO1273 Conserved hypothetical protein
gtgtatagtgtgttaagtataaaagacaaaaaaataatttcgctcttaatactagttgca
actgctatcagtcccatttttgccatagcacaatctgccagttcctcgcctgcttctaca
gcaataacaataatttcatataacggtaatgacgccaacggtatattggcttttgagcat
gggcaaatagccttttatgcttacgctgtacctccatcagaatatacaagtttgcctcca
ggggctaaagcttacttactaccgaatacttattatgacattctggtaaatccattaaat
actacttttggttttaacccattccaattccaagaagttagattcgcactgaactatata
gtaaatagaacctattttgtagatagtatactacacggttatggtataccaactatatct
ctatatgctggagaacctgatgtgattcatctccaacaaacactatctaagtacgctaat
gttcactataatttcacttatgcaaatgaaaccatttataaagttctaactgctcatggt
gctaaatatattaatggacaatggtattataatgggaaacccataacagtttacgtattt
gtcagaactgatgccactgtaaggagagaatatgcccaatactttataactcaactacag
aagttaggttttactgtccagcaaattcaagggaatttacaaaaggaaatttctgtagta
tacggtagcgatcctgcaaatactacgtggaatatattaattgaagcttggggtgggact
tatgggtattatgattctagtttagcagtaggactttacagtactttaggggcttctgat
ccattttcttcatattacggcttaagtatgggtacgtataacgatactaggtatgaatcc
tcattattacttaaagaggctaatgagcttgacaatctatcattgataatagcccaaagt
cagttcactagcgcccaagaatattaccaaatatataataagattgtagagttaggtatt
aacatgtcagtaagaataggactaggaatgagtctaactccaatatacgcactatctaac
attaatggtgtgtatccaagttttgcccaaagtacactactaagcttccagacatattat
tctataacgaatggaagctatcctaatgttacaataggtgttagatacttaagtcaaggt
tcggctaatcccggtgctggtttcactgattcctatacagatgaaataggaaacgcttta
ttcactccgtcctctttaacagtaccaggttcgggatacccagtacctttcatttatact
tacaagatagttaatataactccacatgctgtagtatcagtaccttcaaatgcattgtgg
tggaatccaactacgcagcaaataactaaggtatctcctaatactactgcgcaaatggct
gtaatatataacttagccccactgttcaataacgataaatgggctgatggtcaaaatata
actcttgctgacataatatatgaatatattgttgcatccgagatgtccttaaactctagt
aatccaatttatgactcaactgcatcatcagtatatgctccagcactacagactattaaa
ggatttaagataattaactccagtgctatagaaatatggggcaatgattggttcttcgat
cctactgaggctgtagttagcttatttggatctttcaatccactaggttacgcgttagct
ggcggaggttatttcccatggcaaatgtatgttggtatgaaagatgttgttgcacaaggt
aaagctgcgtggtctgagggagcagctcagtccaaaggaattgattggctgaatctagtt
agtccaactgatattggatatataacttcagcgttacagaatgcctcagctactggatat
atacctaagagtttacagatagtagagaacttaagcggtataactctagtaactccacaa
gaagcaaaagctggatatgaagcggcaattaacttcatgaagacctatggaaatggatta
ataggtgatggtccatatatcttggtagcgtggaatccgagtgcgtctccaccctacgca
aaactgataaggaatccctacttccatttggttcctccatctaatgcgttagccttaccg
actatgtattcagtttcactaagcatcccatcaacagtttcacctggtcaaaccttaact
ggtactgtaatgggaactcctgctggaagtaccacagcaatacctactccaaatgccgta
gttaatatagaattactgtatccaaatggctctataatatcaggatatcaattaatgacc
aattctagtggacaatttaccttcactgttccatcttcattatctcctggatcataccta
ctatcggtatcagcgtacagtaatacttcaatattaataaatccagtaacatatactctt
gtagtattaccatccataacaactactacgagcactacaacaagtacaacaactacaaca
agtactactacgactacatcagtcagtacgtctttatccacaactacgattacttcagtt
agtactgtaatcagcactgtagtgagtactatagtcagtacagtagtatctagtgcctcg
aatattggctatattgctgtaatagtagtcctaataattataataatagctttagcggta
ttattattcagaaggaga
>SSO1274 (dppB-1) Oligo/dipeptide transport, permease protein
atgggttttaccacatatatgataaaaaaggtacttatttatttttcagttcttctagcc
actttaaccattctttatatttttacttttcccatattgcaggaggttatagctaagagt
atcaattttcaagttgcacagttctctcaaactttgtttaaaaatgcccataatctaaac
tctactcaaattcagattgcagtagagaagtatagggaatctttaattgcggcttacggg
cttaaccaaccaattatcgataaatattttatccaaatgtataatttgatgcgtttcgat
ttcggtacagcttactttttacaagctccttctggttctagagaggttagttcaattata
gcttattatttgcccaacactattctcttatttactactgctactatagtattcatagta
gctgggactataattggcttactctctgcaaaatctaaattctgggagaaggtaatcgca
ataatagctgtaatacactctagtattcccacttggtggttaggttttgtcctaattgct
gctttagcatatgcagttaaagttttcccacctggaggaatgacctcagttccaccgcca
aagaatccatttgattatggaataagtgttttatatcacatggcgttaccactgattact
atctttattgtaaacgttggaggatttgcgtatattgttagaagtttagttacctcaatt
atgaaagaagattttgtaattacagcgaaagctagaggattaccagcctctagaatacta
tatagacatgtcttacgctcaggctcaccatcaattgccacacaagctattttagcatta
gctggatcattaggaggtagtttaaccacagaggttgttttcgaatggcctggggtaggt
ttgttaacttatgttgccataaccttaaatgatttaccagtgatattagggataacctac
gttttgacaattgtgttgctacttggattgtttttaggggaattagtttacggattatta
gatcctaggataaaagttggtgag
>SSO1275 (dppC-1) Oligo/dipeptide transport, permease protein
ttgagtaaaagaaatgtaggcttttcctcttatattagagattttttgtcgagtaaaatt
ggattagtaggccttataattctaattattttacttatatttactggaatagccttatct
atccctgcaaaagtttacgtttcgtggaataatccagcagcctggaatcaatatccggaa
cacgtacctccagcttggttatccatcttttacccgggaaagtatttcacaacagaagag
ctatcaccaataaatatgtctttgtattctcctgctaaaaatatattcgtagcgataatc
acatatcaatttaattggtctaaggtcttaccggcatacaacgtatatttcataacttcg
agtaatgttacccctatagaagaagtaatatattggagtaaaccggatggttatacctta
caggtaaatgttccagctggtgtatttaatgtgccatttgatcttacaagtattagaggt
gatattttaagttatatatcttcaattacgggaaaaacaccaaatatagttaacagcacc
gtattgtcatcagctttatttaactctccaaaatctaattttacggtaattgagcagggg
aagtatgtagttaagatagaaatagtatcctcattacccatgaatattacaaagtcaagg
ttaattctattagggaattcctatggcttgatgggaactgactatttcgggaggccattg
gatttaggaattcttttaggattaccgaatgcgctagaaataggtgtattaacttcatta
gtagctgtacttgtgggagtttttgttggaggcatctctggttatctaggtggaaataag
gattctataatacaatgggttaccttagtattccttgcattaccagctctccccttttta
gttgcagtatcgtttgttgcagaacctaacatagttatagaggctctattaatagctttc
ttatcctggccattttatgccataatagctagatcaatggccttatcaataaagtcaaat
agttatgttgaagctgataaactacttggaataccatcatatagagtattctttacacac
ttcatgcctaggttaataccaataacagttgcttacatggtattaggtgttcctgcaggg
attcttttagcccaaacgttagcctttttaggaatagctccagccaatatagtaacttgg
ggagggattttagatgctgcagaaacttatcaagctcaagttaatggatggtggtggtgg
gttgtgttccctggagcaatggtcgttattgtagcaatacctttcgtgctaataggtttc
gcaatagaaagagttacattaggtgagaga
>SSO1276 (dppD-1) Oligo/dipeptide transport, ATP binding protein
gtgagagataggatgttattagaggtaagaaacttaaaggtttacttctacacaaagaga
ggtattgttaaggctgttgacggagttaacttatatttagataagggagaaatagttggg
ctcgctggtgagagtggatctggaaagagtacgataggttatgccataatgaggcttgta
ccttttcctggaaagattgaaagtggggaaatattatttaaaggtgagaatatactaaaa
ctagatgaagaagcatttaggaaaaattatagatggaagaagatagcaatggttttccaa
ggctcaatgtctggattcactccagtgtttaaaataaaggatcagataatcgaggtttta
cgtattcatggttggaacggagattatgaggagagaataaaggagttgttcaaaatggtt
aacatggatccacaattagctgaaaagtatcctcatgagctttctggaggtcaaaagcaa
agggcttttattgcaatggccctagccttaaatcctgaggttctgatagcagatgaaccc
acaacagccctagatgtgatggtccaagaacatattcttaacctattgaagaagttaagg
aaagagttaaacttgtctataattttcataacacatgatttggccttactttccgagatt
tcagatagggattatacgctatatgcaggtaaagttatggaaagtgggccatcagaagtt
atattcaaaaaacctagacatccctatacttcactacttatcgaatccattgccacattg
gacaaagatataataaagggaataccgggagctatgccagacctctcaagtccaccgtta
ggttgtagatttaatactcgatgtccctttgctagagacatttgttttaaggaagaacct
aaaatgaaaacgttctcagatggtgatgaggttgcctgttggctctac
>SSO1277 (dppF-1) Oligo/dipeptide transport, ATP binding protein
atggtgatgaggttgcctgttggctctactagtaattatgtagttaaagtagaaaactta
aaagtatatttcactaagggtggaatgtttactaagaagtatgtagttaaagcgctagat
ggtgtgacgttaagtataaaagaaagggaaattatgggagtcgtaggtgaaagcggatct
ggtaaaaccacattaggtagagtaacaataggtctccaaaaaccaacttctggtaatgtt
tatattaaagctgataataaggagattaatgtaaataaggcaaaattaaaagatattagc
aactacgttcagatgatatatcaagatccatattcctccatagatcccataatgagagta
tatgacgttttagcaactccattgaaatacaaaaagatgagtgatatagataagaagatt
gaggaggcaatgaggttagttgatcttccactggaactgttggaaaatagggtatatcaa
ttatctggtgggcagagacagagattaagtatagctagggcaatagttgtcaacccaaaa
tatattgtagcagatgaacctactacaatgttagacgcttcattaaaaggagagatcttg
aagataataaaagacgctagagaaagtaaaggtttttcctttatgtatataacgcatgag
ctaccaatagcaaaaataatatccgataggattatagtattatatttaggaaagatagta
gaattagggaactcaaatgagattattaaaaacccattacatccatatactcagggacta
attgaggtttatcctagaatagatccctcacttagagataagatcaaggagataaagatc
aaggttgatatagtgagaccagataaggggtgtgtgttttatcccagatgtccatttgca
atgcctaagtgtaaggaacaagaaccagagctgaaggaagtttctcaaaatcactacgta
gcgtgctggctttat
>SSO1278 Hypothetical protein
atgttgcatgccacctatattaacttgtttttatcattatttttcttttttcctttattt
ctatctctgactttttatggcacacaattaataggatatcatggagtattaagctctctt
gcaataaatatgaacgtaggagtatcagttaatcatttgcctgacggtggttataacgtt
actattagggagatcggtaattcttacaacaagactttaggaatccagctcagttataat
ggagaatattattacattataaacatgagtgggaaggaaatatggattacgtactacata
tctaacgcgtctagcaacataggattattagctccattttatatgccttattcaactaat
ggaacttactcatttaatgaaaaaattgtaaatatgagtaataataaaattgaaagtcaa
ataataacgaacattagtatcattaagcagaatagcggaaaattggttgttaacttctca
gacttaaatattacaacgatacctacttattacgtaagccaaagaataatttacgttaat
ggtttaattagtcaaatgcagagtaattacaccaattcgggacaaatttacctatatact
aacatatctcgaatggaaggtgggaccgattattctggcgtaattataccaagtgtagta
attgctattattataatagtagcaagtagtattgcagtgtacagatttaggaaatcatca
aaa
>SSO1279 (dppF-2) Oligo/dipeptide transport, ATP binding protein . carboxy-end fragment.
ttggtgaaacaccactgtagaataggagtaatgtatttaggtaaggtagtggaaatcgga
actccggaagaagtaataagcgagcctttacatccttacactcaagcactactgcaagca
gtgcctgttccagatccagatattggtataaaggaacccaatatcaaaggtgagattcaa
agcccactagagttaccaaagggatgtgtattctatagtagatgtccatttgcaaaagat
atttgtaaggaaaaacccccagagataaagaggattaaaggagatcattatgttgcatgc
cacctatat
>SSO1280 Transposase ISC1439
atgcaaaccatgatattacccaaaacggagctgaagtccctcgctataactttagcaaca
aacaatattaacgttatctctcaagatctagacccggaaatagtgaaagcagcaccatcc
ttgctaaccggaaacagaggaaaatactacttgaaggtagtaagacgaggcgagaaagta
attagtaaaggtcagagaaccttcaagttctacccaatctacagagaagtaaagggagag
atcaacgtagtcgctgtagatgagaccggattaaccgtgggagaaaaggaacaagaaaaa
gcagagggctttctactctacaactggaagagaaaaggagtaaagatgagatccttggac
ctcgtatatcccttaaggttacccctcctagtggaggtagcagatttgagaagcgacagt
ccatcacagttcctactcaggagcgtgagggaagtaagccaatacatggaaatagattac
gttgtagctgacgccggattcttgaacctaggggtcatcaaggaaatgcccgtgaagacc
attgtgagaggaaagtcgaacttgaagggattcaaggaactatctaacgttccattagtt
gagaagagatatgaggttaaggacaaggtttacgttgcgtatagggtcttggaatttgaa
gggctttattattacgatgtggtttacgttaaggggaagccgaggcacttcatgttcgta
acgaacttcgagggagatccctatgaactggctgaactctataggttgaggtggcaagtt
gaggagggttttaaggttaggaaggcaaggataaggtatgttaggaagttgagtaataag
atcttcttgttcctctattacacggttctggattctgcgtggaatctagtgaatcatctt
ctctttaacttcaagtccacgtgtaagaaggttttgtccttcgattcattcgtcaagctt
ctc
>SSO1281 (dppF-2) Oligo/dipeptide transport, ATP binding protein . amino-end fragment.
atggacaataatgagattatcgtaaaagttcaaaatgtttggataaagtatcccatgggt
agagttggattatttaggaaactttacgtacatgcagttaacgacgtttctctcgagatt
aagaaaggagaaatatttggtttaataggcgaatcaggctctgggaagaccacgttagga
aagggaattttgagacttatcgagacttactctggaagtatatactggaaagttgatggt
ggtaagttagtggatataacaaaattaaatgataacactttaaggaggctaagaaaagat
tttcagataattcaacaagatccgtatggtgctttagatcctagaatgagcgtatatgaa
attttggctgaggggctaagattacacaaactcatatcgaataaaagtgaggaagttgag
caaatatataaaatactatcaatagtgaagttaaccccccctgagaattttgcaaataag
aagccaatggagttatctggaggacagagacaaagagttgtagtagctagggctttatta
ttaaggcccaagtttattgttgctgatgaaccaatttcaatgttagatgcatcaaccagg
ggtcagattttggaatttatattaaacgatagggatcaaaggggaacggcgtatttgttt
ataacacatgatatctcaatagctagttacgtttcagatagaataggcagtggtgtttca
ccaaattatttcatt
>SSO1282 (dppD-2) Oligo/dipeptide transport, ATP binding protein .
ttgagtttacaagttagggaccttaacatatcctacaagattggcaaagggtcaattagg
gctattaatagagtgtattttcaattggagaagggtgattctttaggagtgattggtgag
acaggttccggaaaaaccacaattgctaatgctattatgagggcattgcccgaaaatgca
gaatattctggtagcattttttttaataataaggatattttgaaaatggatcaagaaacc
tacagaaaggagataagatggaagaaaatatcgataataccccaatactctatgaatgcg
tttaatcccataaagagggttggtgaacaattagtaaagataatgatggaaaatgatagt
aatattgatactagtaaagctagtgaaaggatattttacctatttaatcaacttagtttg
ccaccagagatctataagaagcttccagacgaactatctggaggacagagacaaagagtt
gtaattgcctcagccctattattagacccagaattagtaattgcagacgaaccgactact
gcattagatgttataaaccaagcaagggtcatatctttaattaagagggaaattgtggat
aagcaaaagactttaatctacattactcatgatatagcagttgttgctggagttgctaag
aaggtactaacactttatgccggagagataatggagttcggagattctcgtaaaatcttc
aaggaaccactacatccctactctaagggcttactgtcctcagtaccggatattagattt
ggtaaggtaaagaaagtgcattatattccaggtgatccaccagatctgtcaaaggagatt
aaagggtgtccatttgcaccaagatgttcgatagctaaagatatatgtaaggttgaaaaa
ccaaaattaagatatgtggatggaaggtacgtggcttgtcatcttgtaggaggggaagaa
aatggacaa
>SSO1283 (dppC-2) Oligo/dipeptide transport, permease protein
gtgaatttaatgagaattcccccaatattaagactgaagctactttgggttgcgctaatt
atattcatttttcttttagggagtattgcatatggtttctttacagcgcctaaggcaaac
ccttatacaccagctggtcagtatgcagcttcaccatatgcagtgccttcgtgggcttca
atcttctacggtaatcttccacctgacataaaagtacctaatgattatgatctgattgct
gcgaagacagcatctgttataaattattggcatttgtctaactttacttttaacggagat
gctgttataataatttataatagtagctatggacccaagggagaaactaacttccaaaag
acactttattcttatggaaacactggaaacgggagtgtagagataataatagaaggaact
aatccattaaatttaactctgtatcatgactttctttataactatttattgcctagagag
acaaaatttggagactatgaattctatatcatccaagccagtatttccgcttatgctaca
aacgcttactatacttttaatggatatgtgataaatccgtcaaatgccacattttggttg
ttcttagctgggaactacttgccaacaaatttggttacgctctcaactgtatttaagtac
ttagggaatggaggatggaattacatattagcatcttcggcatcagctggagaaactcca
tggttctatacctcaaatatacctcctaatgaaagcgcagtagcttctgttataatgctt
caaagcatgtttaatagtaccggaaattacaaggtggaattcaccataaattatatccca
aacggacctaactccaaattagtagtttacttatctgacctttatttcgaatttcttggt
agtagatatggagt