Genomapper BLAST  psiBLAST  Mulalbla  Multalin  Genes & Genomes  BLAST (restricted)  Genome Guts  COG Guess  INTERPROScan  CDD search  Pattern search  Sequence Patterns  COG Trees  Genome Syntenizer
Corynebacterium urealyticum DSM 7109
>TRNA16 Anticodon: GAC
GCGCGATTAGCTCAGCGGTAGAGCACTTCCCCGACACGGAAGGGGTCACTGGTTCGATCCCAGTATCGCGCA

Supplementary options
Additional orf sequence data See Genomic Environment
Search GenBank with PSI-Blast at NCBI Search Complete Genomes DataBase with Blast at LBMGE
Search InterPro Database at LBMGE Search CDD Database at LBMGE
Determine COG functional Category (microbial) Determine COG functional Category (eukarial)
__________ GenBank id: 172039680 Gene name: - COG: Taxon: 504474 Lineage: Bacteria: Terrabacteria group: Actinobacteria: Actinobacteria: Corynebacteriales: Corynebacteriaceae: Corynebacterium: Corynebacterium urealyticum: Corynebacterium urealyticum DSM 7109
__________